5inhibition of specific nf kappa b subunits as a therapeutic strategy c rel as a target
Báo cáo y học: " Nontypeable Haemophilus influenzae induces COX-2 and PGE2 expression in lung epithelial cells via activation of p38 MAPK and NF-kappa B" pps
... 5' GCCGTCTTGACAATGTTAAAGC 3'; COX-2: forward: 5' GACAGTCCA CCAACTTACAAT 3', reverse: 5' CATCTCTCCATCAATTATCTGAT 3'; GAPDH: forward: 5' GTCGGTGTGAACGGATTT 3', reverse: 5' ACTCCACGACGTACTCAGC 3', ... 5'GAATCATTCACCAGGCAAATTG 3' and reverse: 5' TCTGTA CTGCGGGTGGAA CA 3' The primers for mouse COX-2 were as follows: forward: 5' CCAGCACTTCAC CCATCAGTT 3' and reverse: 5' ACCCAGGTCCTCGCTTATGA 3' Enzyme ... induces NF-< /b> kappa < /b> B activation in our system, and p38 MAPK is up-stream molecule of < /b> NTHi-induced NF-< /b> kappa < /b> B signaling pathway EMSA analysis showed that NFkappa B translocation and its DNA binding...
- 9
- 290
- 0
Báo cáo y học: "The S100A8/A9 heterodimer amplifies proinflammatory cytokine production by macrophages via activation of nuclear factor kappa B and p38 mitogen-activated protein kinase in rheumatoid arthritis" potx
... activaS10 0A8 /A9 -induced nuclear factor kappa < /b> B (NF-< /b> B) activation and its independence of < /b> p38 mitogen-activated protein kinase (MAPK) activation (a) Activation of < /b> the transcriptional factor NF-< /b> B ... were measured by cytometric beads array (CBA) with a series of < /b> anticytokine monoclonal antibody (mAb)-coated beads and phycoerythrinconjugated anticytokine mAbs followed by flow cytometric analysis ... µg/ml) Lactate dehydrogenase activity in these culture supernatants was undetectable or detectable only at negligible levels, indicating that S10 0A8 /A9 is released as a consequence of < /b> active secretion...
- 12
- 644
- 0
Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx
... reverse transcriptase-polymerase chain reaction (RT-PCR) using primers (forward: TGACTCTAAGTGGCATTCAAGG; reverse: GATTCAGACATCTCTTCTCACCC) and by Western blotting using anti-CXCL10 antibody (R&D ... toxin; RA: rheumatoid arthritis; RANK: receptor activator of < /b> nuclear factor -kappa < /b> B; RANKL: receptor activator of < /b> nuclear factor -kappa < /b> B ligand; RT-PCR: reverse transcriptasepolymerase chain reaction; ... bacterial toxin that inhibits Gai activation by ADP-ribosylating Gai subunits, and the inhibition of < /b> Gai by PTX was confirmed by measuring CREB phosphorylation that was increased following Gai...
- 8
- 176
- 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf
... the nuclear localization of < /b> NF-< /b> jB [7] The canonical pathway of < /b> NF-< /b> jB 28 activation passes through the activation of < /b> an IjB kinase (IKK) complex, composed of < /b> two catalytic subunits (IKK1 ⁄ a and ... ionotropic glutamate receptors activates transcription factor NF-< /b> kappa < /b> B in primary neurons Proc Natl Acad Sci USA 92, 9618–9622 Lilienbaum A & Israel A (2003) From calcium to NF-< /b> kappa < /b> B signaling pathways ... Centre of < /b> Study and Research on Aging, Brescia; by MIUR Center of < /b> Excellence for Innovative Diagnostics and Therapeutics (IDET) of < /b> Brescia University and by the Rotary Club Rodengo Abbazia, Brescia...
- 9
- 527
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... TTGCAGgaga ACCACGgggt CTGCAGgcgg ACCACGgcgt CACACGacgt GACCAGgggt CTGAAGgatg CTCAGGgagt GGACGGgagt 21707 13715 253 458 440 501 2746 486 366 1142 67 4086 cttcGTTCAG ccccGCCTGC ttccAATCCT ccgcGACGTG ... TGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAG TGGAAAAACTTTACAT-3¢ for XPR130, the primers 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT...
- 12
- 507
- 0
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
... varia (alfalfa), Arabidopsis thaliana, Oryza sativa (rice), Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, and mammals Combining the ASBD and pro®les with a variable linker between ... Xenopus laevis; ce, Caenorhabditis elegans; sc, Saccharomyces cerevisiae; sp., Schizosaccharomyces pombe; at, Arabidopsis thaliana; rn, Rattus norvegicus; dd, Dictyostelium discoideum; os, Oryza sativa; ... the Ba subunit of < /b> protein phosphatase 2A0 J Biol Chem 271, 2578±2588 Zhao, Y., Boguslawski, G., Zitomer, R.S & DePaoli-Roach, A. A (1997) Saccharomyces cerevisiae homologs of < /b> mammalian B and Ba subunits...
- 7
- 550
- 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx
... of < /b> O2 binding to the a and b subunits within liganded hemoglobin as a function of < /b> NaCl concentration Bars 1, and are the relative changes in the association (k¢), dissociation (k) rate constants, ... rate constant, k, and the O2 affinity, K, can be derived for both the a and b subunits from the averaged parameters of < /b> HbA oxygenation (Table 1, Average) The association and dissociation rate constants ... The Authors Journal Compilation ª 2005 FEBS 6111 pH and NaCl effects on HbA subunits oxygenation S V Lepeshkevich and B M Dzhagarov kth, can be considered constant with an accuracy of < /b> 9% Dzhagarov...
- 11
- 577
- 0
Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-specific Rnf33⁄Trim60 gene pot
... dehydrogenase (Gapdh) gene in each RNA preparation was determined using primers GAPDH-F (5¢-GCCTCCTGCACCACCAACTG-3¢) and GAPDH-R (5¢-CCAGTAGAGGCAGGGATGATGT-3¢) The real-time PCR program was: pre-incubation ... and RNF33ChIP-R (5¢-CATCAGCTTCCCTTATGAGAACAG-3¢) primers in 10-lL PCR reaction volumes The PCR was performed for 33 cycles at an annealing temperature of < /b> 65.6 C to generate a 300-bp amplification ... degradation of < /b> IjBa through phosphorylation by the activated IjB kinase (IKK) complex leads to the release of < /b> cytoplasmic NF-< /b> jB and nuclear relocation of < /b> NF-< /b> jB In an IKK-independent pathway,...
- 14
- 381
- 0
Báo cáo lâm nghiệp: "Carbon partitioning: fructose 2,6-bisphosphate content as an indicator of specific changes in carbohydrate metabolism in needles from class II spruce trees" pot
... needles could constitute an early indicator of < /b> affected carbon allocation tion partitioning of < /b> carbon into (starch decreases) and this situais obviously continued during summer Class li -specific < /b> changes ... (1980-1983; based on dry weight) differ significantly in the levels of < /b> starch, TP and F26BP, in that class II needles show a decrease in starch, compared to increased amounts of < /b> TP and F26BP In contrast, ... change in concentration is shown by F26BP The significantly increased amount of < /b> this regulator will surely inhibit cytosolic FBPase and will thus largely reduce carbon flow towards sucrose (compare...
- 5
- 175
- 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
... C C C T C T C C A A A T G T G T C T T G G G G T G G G G G A T C A A G A C A C A T T T G G A G A G G G A A C C T C C C A A C T C G G C C T C T G C C A T C A T T Figure Abundance of < /b> each base along ... with a phosphorothioate backbone (Exiqon); the sequences were 5’ACATGAAGTAAACACACA-3’ for miR-30-TSB and 5’CAGTCGAAGCTGTTTAC-3’ for TSB-neg (mismatch control) TSBs were used at a concentration of < /b> ... exclusive manner to human miRNAs, as well as miRNAs of < /b> species other than human (mirBase 16), to UCSC annotated sequences (UCSC Refflat file) and finally to non-coding RNA classes (fRNAdb, database of...
- 13
- 365
- 0
Báo cáo y học: " NF- B subunits RELB C-Rel RELA p50 p52 bound DNA b EMS" docx
... C C C C C T {MATCH-score: 703 } G G A T C C C C C T G {MATCH-score: 417 } G A T C C C C C T G C {MATCH-score: 232 } A T C C C C C T G C T {MATCH-score: 231 } T C C C C C T G C T A {MATCH-score: ... 10204080 RELARELA p50 RELA p50 RELA RELAp5 RELAp50 RELAp52 NF-< /b> kB (nM) complex- UV CTGGGGATTTA UV AGGGGAAGTTA DNase I AGGGGAAGTTA p50 RELA p50 RELA RELAp50 RELAp52 NF-< /b> kB (nM) - 20 100 60 80 NF-< /b> kB - ... RELAp52 (a) Page of < /b> 18 NF-< /b> kB - 20 40 26 22 20 40 26 22 (nM) complexEMSA DNA- GGGGAATCCCC(MHC H-2) 30 AGGGGAAGTTA 25 CGGAATTTCCT(AGGAAATTCCG) 20 CTGGGGATTTA 15 NF-< /b> kB interactor r r egion UV-laser...
- 19
- 280
- 0
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... infected cells, we analyzed the level of < /b> apoptotic markers such as caspase-3 and PARP in both infected and uninfected cells Caspase-3 is a member of < /b> cysteine protease and plays a key role in apoptosis ... total cell extracts were collected and subjected to Western blot analysis of < /b> caspase-3 and PARP Westeron blot of < /b> βactin was used as an internal control B) Twenty five microgram of < /b> each Purvalanol ... of < /b> Tax and an essential component in Tax-mediated NF-< /b> B signaling in both canonical and non-canonical pathways Therefore, we reasoned that the specific < /b> targeting of < /b> both the NF-< /b> B signaling and...
- 16
- 391
- 0
Báo cáo y học: "Neonatal retroauricular cellulitis as an indicator of group B streptococcal bacteremia: a case report" ppt
... streptococcal bacteremia Pediatrics 1981, 67:376-377 Patamasucon P, Siegel JD, McCracken GH Jr: Streptococcal submandibular cellulitis in young infants Pediatrics 1981, 67:378-380 Albanyan EA, Baker ... infección tard a por streptococcus agalactiae Revista chilena de pediatr a 2004, 75:455-458 Chakkarapani E, Yoxall C, Morgan C: Facial submandibular cellulitis-adenitis in a preterm infant Archives ... has been suggested that subcutaneous infection is secondary to GBS bacteremia in infants with a previous skin or mucous colonization Probably, certain subcutaneous areas are predisposed to becoming...
- 3
- 411
- 0
Báo cáo y học: " The role of secretory leukocyte proteinase inhibitor and elafin (elastase-specific inhibitor/skin-derived antileukoprotease) as alarm antiproteinases in inflammatory lung disease" ppt
... [2•]) was first identified as a ‘non-SLPI’ lowmolecular-mass anti-elastase by Hochstrasser et al [7] and Kramps and Klasen [8], and further characterized by us in bronchial secretions [9] and by ... tracheal biopsies and bronchoalveolar lavage from both normal subjects and patients [13], and its synthesis by Clara cells and type II cells indicate, as for SLPI, a tracheo-bronchioalveolar ... 61:695–702 Hochstrasser K, Albrecht GJ, Schonberger G, Rasche B, Lempart K: An elastase -specific < /b> inhibitor from human bronchial mucus Isolation and characterization Hoppe-Seyler’s Z Physiol Chem 1981,...
- 6
- 188
- 0
Báo cáo khoa học: "Serum neuron-specific enolase as early predictor of outcome after in-hospital cardiac arrest: a cohort study" ppsx
... is a known marker of < /b> ischemic brain damage and has already been evaluated in traumatic brain injury [10], stroke [11] and anoxic encephalopathy after cardiac arrest [12,13] NSE, the neuronal ... Critical Care Vol 10 No Rech et al critically ill patients Biochemical markers, in contrast, are a low-cost alternative that may be more suitable for this purpose Neuron -specific < /b> enolase ... 2), and group was formed by patients who recovered consciousness (GOS 3, and 5) A patient was considered conscious if awake or capable of < /b> following simple commands at least once Statistical analysis...
- 6
- 391
- 0
Báo cáo y học: "Baicalein inhibits IL-1β- and TNF-α-induced inflammatory cytokine production from human mast cells via regulation of the NF-κB pathway" pot
... 3' and 5' GGA TTA TAC TGC CTG ACC AAG G 3'; IL-6: 5' ATG AAC TCC TTC TCC ACA AGC GC 3' and 5' GAA GAG CCC TCA GGC TGG ACT G 3'; IL-8: 5' ATG ACT TCC AAG CTG GCC GTG GCT 3' and 5' TCT CAG CCC TCT ... TCT TCA AAA ACT TCT C 3'; and MCP-1: 5' GTA GAA CTG TGG TTC AAG AGG 3' and 5' AGC CAC CTT CAT TCC CCA AG 3' Densitometry was done by normalizing target genes to house keepers using Un-Scan-It ... Ma A, Liu Z: Cardioprotective effects of < /b> peroxisome proliferator activated receptor gamma activators on acute myocarditis: antiinflammatory actions associated with nuclear factor kappaB blockade...
- 10
- 207
- 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
... alphabet based on Roman characters and a historical legacy that has created a greater awareness of < /b> French and English than many East Asian rivals Young Vietnamese with better English communication have ... analytical and technical skills KPO is often used in such following areas: pharmaceuticals, biotechnology, data search, integration and management services, financial services, research and analytics, ... Vietnam software status in the international arena LIST OF < /b> ABBREVIATIONS AIC : Advancing Technologies & Investment Consultants Corporation APEC : Asia-Pacific Economic Cooperation BPO : Business...
- 79
- 611
- 6
Tài liệu An Evaluation of A Participatory Research Approach in Rainfed Lowland Area of Vinh Trach Village, B pptx
... new crops and animals, pests and diseases on new crops, lack of < /b> capital and low price of < /b> agricultural products, etc Under such circumstances, the JIRCAS Project has continued to promote a participatory ... objective of < /b> the FARM Program is to enhance the capabilities of < /b> GOs and NGOs, to build local capacity of < /b> resource poor farmers for sustainable use and management of < /b> agricultural and natural resources ... JIRCAS project (un-publishing) JIRCAS, 1997 A diagnosis of < /b> the rainfed farming systems in coastal area in Bac Lieu: A PRA study (A scientific report to JIRCAS project) Tóm lư c Đánh giá c ch...
- 8
- 492
- 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... USSR/Russia Japan China Vietnam Nigeria Colombia Thailand Nicaragua Peru Ecuador Trinidad and Tobago Guyana/British Guiana Jamaica Dominican Republic Philippines Honduras El Salvador Guatemala Haiti ... Honduras Nicaragua South Africa Portugal Turkey France Thailand Trinidad and Tobago Guyana/British Guiana Syria Jordan All other countries Total *The Census Bureau gives data for Israel and Palestine ... with percent), and Mexico (1 percent) Mexico India Korea Cuba China Vietnam Canada Iran Philippines Poland Italy Colombia Taiwan Germany El Salvador Pakistan England Greece Brazil Israel/Palestine...
- 37
- 436
- 0
Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx
... CTC CAT TAC CAA-3¢ (forward) and 5¢-CCA CAG CCG TCC CAG TCA CAG TGG-3¢ (reverse); SR-BI, 5¢-CCT TCA ATG ACA ACG ACA CCG-3¢ (forward) and 5¢-CCA TGC GAC TTG TCA GGC T-3¢ (reverse); glyceraldehyde3-phosphate ... (DAB) (Boster Biological Technology, Wuhan, Hubei, China) The following antibodies were used: rabbit SRBI polyclonal antibody (1 : 1000, Abcam, Cambridge, MA, USA); rabbit KLF4 polyclonal antibody ... m, and cells were washed twice with ice-cold PBS The chromatin lysate was sonicated on ice to an average DNA length of < /b> 600 bp Chromatin was precleared with blocked Sepharose A, and ChIP assays...
- 9
- 516
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25