5 mental health disorders are extremely prevalent in liberia and should remain a top chronic disease priority
báo cáo khoa học: " A win-win solution?: A critical analysis of tiered pricing to improve access to medicines in developing countries" pptx
... visceral leishmaniasis (VL; kala azar), a fatal neglected tropical disease highly endemic in India, Bangladesh, Nepal, Sudan, Ethiopia, and Brazil Amphotericin B is better tolerated by patients ... applied in developing countries, but such systems are in place in the UK, Canada, and Australia, where national governments are major purchasers of pharmaceuticals However, pharmacoeconomic approaches ... Switzerland Authors’ contributions SM drafted the manuscript and participated in conception, design, and analysis EJ, MC, and TvSA participated in conception, design, analysis, and interpretation, and...
- 11
- 402
- 0
Herbal Antibiotics Natural Alternatives for Treating Drug-Resistant Bacteria doc
... stored in a dark place, off the floor Actions: Antimalarial, astringent, antibacterial, antimicrobial, anticatarrhal, hemostatic, anthelmintic, antifungal, mucilaginous (roots and gum), anti-inflammatory, ... is sedative Use roots to make mucilaginous tea that is antibacterial and anti-inflammatory Helpful for soothing gastrointestinal tract infections (including mouth and throat), as it coats and soothes, ... may be harvested at any time of year Actions: Antiparasitic, antimalarial, antibacterial, antifungal Active against: Malaria, Staphylococcus aureus, Shigella dysenteriae, Neisseria gonorrhea,...
- 180
- 557
- 0
Báo cáo y học: "Percutaneous laser disc decompression for thoracic disc disease: report of 10 cases"
... lumbar disc disease Thoracic discogenic pain or herniation causing neural impingement is less common than that in the cervical or lumbar regions Certain impact injuries, such as parachute landings, ... pain medication, and epidural steroid injections Physical examination revealed localized thoracic pain without recreation of symptoms with palpation The pain was either centralized or radiating ... via a 27-gauge needle A 15 blade was used to create a stab incision of approximately ¼ inch Through the incision, an 18-gauge, 3 .5- inch spinal needle was inserted and the needle was guided into...
- 5
- 593
- 0
Advances in StentTherapy for Ischaemic Heart Disease
... JoMed Igaki-Tamai Pharmacologic Approaches Anti-inflammatory Immunomodulators Anti-proliferative QP-2, Taxol Dexamethasone Actinomycin M-prednisolone Methothrexate Interferon γ-=1b Angiopeptin Leflunomide ... Schwartz Mak Heart Late Loss and Healing Negative late loss indicates a lack of neointima to cover stent struts Probability for TLR (%) 100 50 -1 .5 -1.0 -0 .5 0.0 0 .5 1.0 Late Loss (mm) Mak Heart ... Estradiols NO donors EPC antibodies Biorest Advanced coatings Many agents have multiple actions SIRIUS Analysis 3-year Clinical Outcome Sirolimus (n =53 3) Death All myocardial infarction Q-wave...
- 38
- 375
- 0
Tài liệu Báo cáo khoa học: Amprenavir complexes with HIV-1 protease and its drug-resistant mutants altering hydrophobic clusters docx
... indicate van ˚ der Waals interactions and dotted lines show C-HÆÆÆO interactions Interatomic distances are shown in A with black lines indicating PRWT and ˚ red lines indicating the mutant Interatomic ... directly interact with APV, but mutations of Ile54 are frequent in APV resistance and the I54M mutation causes six-fold increased IC50 [20] Mutation I54V appears in resistance to indinavir, lopinavir, ... chains of Val56, Leu76 and the main chain atoms of residues 77–78, and Ile32¢ showed new interactions with the side chains of Ile47¢, Ile50 and Val56¢ in the flaps (Fig 3A) The flaps can exist in...
- 16
- 582
- 0
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... Pacific and the Americas A substantial number of people travelling to endemic regions are also infected each year In the last year, DHF has again been on the increase in India and in several Asian ... protein (69 kDa) is a multifunctional protein with an N-terminal protease domain (NS3pro) (1–180), an RNA triphosphatase, an RNA helicase and an RNAstimulated NTPase domain in the C-terminal region ... (as monovalent) PhaseII Preclinical US Food and Drug Administration Hawaii Biotech National Institute of Health Preclinical Preclinical Preclinical polyprotein processing and RNA replication The...
- 17
- 462
- 0
Tài liệu EXTERNAL SYMPTOMS FOR DIAGNOSING POULTRY DISEASES ppt
... aspergillosis; Arizona paracolon; paratyphoid Laryngotracheitis; ammonia burn; Newcastle disease; nutritional deficiency-vitamin A Epidemic tremor Nutritional deficiency-vitamin A; fowl pox Marek's disease ... Paralysis (limber neck) Twisting Retracted over back Retracted under breast Scabby necrotic areas Possible Cause Botulism; yellow jasmine poisoning Newcastle disease; fowl cholera; brain ... brain infection; improper injection of Marek's vaccine Newcastle disease; nutritional deficiency-thiamin Nutritional deficency-vitamin E; Newcastle disease Improper injection of drugs; other injury...
- 5
- 450
- 0
Tài liệu Báo cáo Y học: Receptor crosstalk Implications for cardiovascular function, disease and therapy ppt
... vasoconstriction, decreasing renal blood flow, and glomerular filtration rate, while bradykinin and ANP cause vasodilation and increase glomerular capillary permeability [50 ,52 ,59 ] Such crosstalk may primarily ... cardiovascular regulatory pathways as in valvular heart diseases, in which a concomitant downregulation of b-ARs, up-regulation in a2 -ARs and GRKs 2, and occur both in the myocardium and peripheral ... [12,13 ,53 ,54 ] The observation of a causal relationship between the attenuation in b1-AR and/ or uncoupling of b2-AR with an up-regulation in a1 -AR in both experimental heart failure and in human disease...
- 18
- 621
- 0
For Chronic Kidney Disease: Evaluation, Classification and Stratification doc
... creatinine measurement • Autoanalyzer manufacturers and clinical laboratories should calibrate serum creatinine assays using an international standard • Measurement of creatinine clearance using ... Foundation ix Table 48 Table 49 Table 50 Table 51 Table 52 Table Table Table Table 53 54 55 56 Table 57 Table 58 Table 59 Table 60 Table 61 Table 62 Table 63 Table 64 Table 65 Table 66 Table 67 Table ... Proteinuria in Patients Not Known to Have Kidney Disease 256 K/DOQI National Kidney Foundation xv A CRONYMS AND ABBREVIATIONS AASK ABPM ACE-inhibitor ADA AFT Alb ASCVD ASN AST ASTP AV BAP...
- 356
- 600
- 1
FACING THE REALITY OF DRUG-RESISTANT TUBERCULOSIS: CHALLENGES AND POTENTIAL SOLUTIONS IN INDIA pot
... York ANDREW M DAHLEM, Eli Lilly and Company, Indianapolis, Indiana TAMARA DARSOW, American Diabetes Association, Alexandria, Virginia JAMES H DOROSHOW, National Cancer Institute, Bethesda, Maryland ... addressing drug-resistant TB: inadequate diagnostic capacity, an inadequate drug supply, inadequate capacity to deliver care, and inadequate international assistance Inadequate Diagnostic Capacity ... ordering and training are easier, and mismanagement is less likely The disadvantages of a standardized treatment strategy are that it is not as effective as an individualized strategy in all cases;...
- 147
- 375
- 0
Medicines for Reproductive Health: Ensuring Access to Quality Assured Products potx
... 28 European states plus Argentina, Australia, Canada, Israel, Malaysia, Singapore, South Africa, Ukraine and the USA Other countries such as Indonesia and Thailand are now transitioning to PIC/S ... international norms and standards for quality, efficacy and safety; giving assurance that international norms and standards are applied at all the steps of the prequalification and within the ... pharmaceutical use Equipment Methods, specifications and sampling Qualification and validation Documentation Personnel and training Complaints and product recalls Sanitation and hygiene Self inspection...
- 28
- 395
- 0
INFLUENZA VIRUS a model for learning about disease
... Ivanovski and Beijerinck showed that a disease in tobacco was caused by a virus Loeffler and Frosch discovered an animal virus that causes foot and- mouth disease in cattle Many years of ... inactive Obligate intracellular parasites Cannot multiply unless they invade a specific host cell and instruct its genetic and metabolic machinery to make and release new viruses 6.3 The General Structure ... up to 450 nm in length Viewing viruses Special stains and an electron microscope Negative staining outlines the shape Positive staining shows internal details Shadowcasting technique...
- 59
- 1,519
- 0
Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx
... TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC ... GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG ... IV Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Aldh1 (class I Aldh) – Mouse Rat Rat Mouse Rat Mouse Rat Rat Rat Rat ⁄ mouse Rat ⁄ mouse ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT...
- 12
- 504
- 0
Managing drug resistant tuberculosis ppt
... isoniazid and rifampicin and also to a fluoroquinolone and a second line injectable agent (amikacin, capreomycin, or kanamycin) Drug resistance in new tuberculosis cases (primary drug resistance)—Drug ... tuberculosis in KwaZulu-Natal, South Africa Clin Infect Dis 2007; 45: 1409-14 National Institute for Health and Clinical Excellence Tuberculosis: clinical diagnosis and management of tuberculosis, and measures ... bacilli He was started on Rifinah (combined isoniazid and rifampicin) and pyrazinamide and referred to the local tuberculosis service The patient failed to attend his first two appointments at...
- 6
- 95
- 0
Radiological Findings of Extensively Drug-Resistant Pulmonary Tuberculosis in Non-AIDS Adults: Comparisons with Findings of Multidrug-Resistant and Drug-Sensitive Tuberculosis docx
... opacity that was well-defined or poorly defined Consolidation was defined as a homogeneous increase in pulmonary parenchymal opacity that obscured the margins of vessels and airway walls GGO was ... defined as an area of hazy increased lung opacity, within which margins of pulmonary vessels may be indistinct A cavity was regarded present when a gas-filled space was noticed within pulmonary ... was 47 years and the age range was 15- 85 years The mean ages were significantly different for the DS TB group (mean age, 51 years; median age, 53 years; age range, 158 5 years, standard error, 1.61),...
- 10
- 460
- 0
Safe and Effective Medicines for Children: Studies Conducted Under the Best Pharmaceuticals for Children Act and the Pediatric Research Equity Act potx
... submissions In other cases, FDA was prepared to accept extrapolation with the submission of pharmacokinetic and safety data and limited data on efficacy Compared with an agency staff analysis that was ... marketing to adults and thus available for offlabel use, study sponsors may find that clinicians and parents are reluctant to enroll a child in a trial, especially a placebo-controlled trial In ... reviews into databases such as PubMed and ClinicalTrials.gov To obtain a better understanding of the dissemination of information, FDA could seek an analysis of third-party dissemination of labeling...
- 351
- 420
- 0
Báo cáo khoa học: Amyloid–cholinesterase interactions Implications for Alzheimer’s disease pot
... Mesulam MM (1993) Protease inhibitors and indolamines selectively inhibit cholinesterases in the histopathologic structures of Alzheimer’s disease Ann NY Acad Sci 6 95, 65 68 Nakamura S, Kawashima ... synthesis, and biological evaluation of conformationally restricted rivastigmine analogues J Med Chem 47, 59 45 59 52 Belluti F, Rampa A, Piazzi L, Bisi A, Gobbi S, Bartolini M, Andrisano V, Cavalli A, ... Monte-Millan M, Valenzuela R, Usan P, de Austria C, Bartolini M, Andrisano V et al (20 05) Design, synthesis, and biological evaluation of dual binding site acetylcholinesterase inhibitors: new disease- modifying...
- 8
- 254
- 0
Addressing the Threat of Drug-Resistant Tuberculosis potx
... California, San Francisco Catherine Bonuccelli, AstraZeneca Pharmaceuticals, Delaware Linda Brady, National Institute of Mental Health, Maryland Robert M Califf, Duke University Medical Center, ... been significant, large gaps remain in the availability of appropriate TB diagnostics, primarily in the area of rapid point-of-care diagnostics—tests that can yield quick and accurate results ... IDA IHR IOM IT IUATLD International Dispensary Association International Health Regulations Institute of Medicine information technology International Union Against Tuberculosis and Lung Disease...
- 253
- 296
- 0
Guideline for Alzheimer’s Disease Management pdf
... Establishing and maintaining alliances with caregivers is critical for care of the Alzheimer’s Disease patient (Bultman & Svarstad, 2000; Family Caregiver Alliance, 2006) Major physician organizations have ... early-stage individuals and patients in the more advanced stages of Alzheimer’s Disease Patient and caregiver education and support are essential components of disease management, and have been ... Probate Code §813); Managing personal and financial affairs (California Probate Code §1801); Driving (California Health and Safety Code §103900); Nominating a conservator (California Probate...
- 122
- 277
- 0
Delamanid for Multidrug-Resistant Pulmonary Tuberculosis pdf
... vital signs, standard 12-lead ECG, clinical laboratory tests (including a hematologic profile, coagulation measurements, a urinalysis, and measurements of hepatic aminotransferase and thyroid and ... statistical analysis plan that was developed, finalized, and filed with regulatory authorities before database locking and unblinding The Supplementary Appendix, including further details regarding ... Clinical Laboratory Standards, 2004 (NCCLS M22 -A3 .) 17 Susceptibility testing of mycobacteria, nocardiae, and other aerobic actinomycetes; approved standard Wayne, PA: National Committee on Clinical...
- 10
- 420
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008