5 9 comparison of fluid rise in a capillary tube bundle of varying diameters

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... with further increase in relative gap width The possible explanation for increase in the heat transfer due to a gap is that the gap in the inclined rib releases the air partly belonging to the secondary ... square duct and reported that a gap in the inclined rib accelerates the flow and enhances the local turbulence which will result in an increase in the heat transfer They reported that the inclined ... were machined to develop integral ribs on the surface of an Aluminum plate The height and width of the ribs were kept equals to mm A gap in the continuous rib has been made at a distance of 0.25...

12
831
0

Báo cáo y học: " Replication of the genetic effects of IFN regulatory factor 5 (IRF5) on systemic lupus erythematosus in a Korean population" doc

Danh mục: Báo cáo khoa học

... OR ( 95 % CI) Pa Cases 58 9 454 0.3 85 724 0.6 15 1.32 (1.14–1 .54 ) 0.0003 95 0 610 0.321 1 290 0.6 79 Cases 284 3 09 0 .54 2 59 0.46 1 .52 (1.20–1 .93 ) 0.000 35 2 79 2 45 0.44 313 0 .56 Cases 444 55 9 0.63 3 29 0.37 ... statistical analysis All authors read and approved the final manuscript Available online http://arthritis-research.com/content /9/ 2/R32 Additional files The following Additional files are available ... Arthritis Research & Therapy Vol No Shin et al laboratory data were obtained: sex, age, ages at onset of first symptom and clinical diagnosis, ACR diagnosis, and Systemic Lupus International...

5
244
0

Bài 5: BẢO MẬT VÀ IN ẤN VĂN BẢN docx

Danh mục: Tin học văn phòng

... 12/ 15/ 20 09 TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn BÀI 5: BẢO MẬT VÀ IN ẤN VĂN BẢN Biết cách bảo mật và định dạng trang in, cũng thao tác in ấn văn bản ... http://www.ispace.edu.vn IN ẤN Thiết lập máy in Cài đặt máy in Lư a chọn máy in in ấn Start-> Printers and Faxes TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn IN ẤN Chọn máy ... trang văn bản 12/ 15/ 20 09 TRƯỜNG CAO ĐẲNG NGHỀ CNTT iSPACE Website: http://www.ispace.edu.vn BẢO MẬT Biết các thao tác liên quan đến việc bảo mật tài liệu Bảo mật tài liệu Bảo...

6
325
1

Báo cáo y học: "A quantitative evaluation of gross versus histologic neuroma formation in a rabbit forelimb amputation model: potential implications for the operative treatment and study of neuromas" ppt

Danh mục: Báo cáo khoa học

... regenerating fibers grew in a retrograde fashion was not evaluated Using a mouse sural nerve model, Scadding and Thomas demonstrated a 37% increase in myelinated axons at a distance of 1 .5 cm proximal ... Gonzalez-Darder J, Barbera J, Abellan MJ, et al: Centrocentral anastomosis in the prevention and treatment of painful terminal neuroma An experimental study in the rat J Neurosurg 19 85, 63 (5) : 754 - 758 ... A- fibers into the superficial dorsal horn of the adult rat spinal cord after topical capsaicin treatment to the sciatic nerve J Neurosci 199 6, 16(16) :51 89 -51 95 65 Woolf CJ, Salter MW: Neuronal plasticity:...

10
433
0

5 9 women of the civil war

Danh mục: Tài liệu khác

... War even began They wrote against slavery and spoke out in public speeches Sarah and Angelina Grimke were abolitionists who came from a family of wealthy slave owners in South Carolina Yet they ... The Civil War was a difficult war that cost the labor and resources of Americans in the North and the South What did women in the war? In this book you will read about some of the brave women ... speaking The Woman Behind the Song You may have heard the song that begins, “Mine eyes have seen the glory.” Julia Ward Howe wrote it after she had heard some Union soldiers singing a popular marching...

10
272
0

5 9 women of the civil war

Danh mục: Tiếng anh

... War even began They wrote against slavery and spoke out in public speeches Sarah and Angelina Grimke were abolitionists who came from a family of wealthy slave owners in South Carolina Yet they ... The Civil War was a difficult war that cost the labor and resources of Americans in the North and the South What did women in the war? In this book you will read about some of the brave women ... speaking The Woman Behind the Song You may have heard the song that begins, “Mine eyes have seen the glory.” Julia Ward Howe wrote it after she had heard some Union soldiers singing a popular marching...

10
117
0

INDUSTRY SURVEY - What future animators say about what they are looking for in a school, and what professional animators say are the most important things to look for. ppt

Danh mục: Cao đẳng - Đại học

... important to advancing your education as a professional animator They also state the importance of creating and maintaining a professional network One in five animators say they have a mentor at ... quality of curriculum as their top picks Canada also highly valued individual attention, as did Italy at 50 % and the United Kingdom at 41% Brazil, India and Spain chose having an innovative teaching/learning ... getting started in their animation career Although professional animators got their education in a variety of different ways, they all agreed that in order to really learn animation and improve their...

14
465
0

Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"

Danh mục: Y học thưởng thức

... Denmark, and the Netherlands, as well as in the US Drug subclasses that have increased the most have been the selective serotonin reuptake inhibitor (SSRI) antidepressants and the atypical antipsychotics ... Anticonvulsant-mood stabilizers (ATC-MS) included carbamazepine, divalproex/valproic acid, lamotrigine, gabapentin and topiramate Cross-national comparisons of any psychotropic medication use presents a ... (0 .9% ) Table illustrates that there was a limited but disparate use of lithium (< 01% in German, 0.01% in Dutch and 0. 15% in US youth) and antiparkinsonian agents (0.01% in German and Dutch and...

8
488
1

Báo cáo y học: "A Comparison of Immuncapture Agglutination and ELISA Methods in Serological Diagnosis of Brucellosis"

Danh mục: Y học thưởng thức

... Brucellacapt for the diagnosis of human brucellosis Journal of Infection 2004; 49: 102–108 Clavijo E, Diaz R, Anguita A, Garcia A, Pinedo A, Smith HL Comparison of a Dipstick Assay for Detection of ... Mah MW, Qassem LA, Osobad AO Comparison of the Brucella Standard Agglutination Test with the ELISA IgG and IgM in patients with Brucella bacteremia Diagnostic Microbiology and Infectious Disease ... Chemother 2001 Apr;13 :54 -9 15 Araj GF, Kattar MM, Fattouh LG, Bajakian KO, Kobeissi SA Evaluation of The PANBIO Brusella immunglobulin G and IgM enzyme-linked immunosorbent assays for diagnosis of...

5
604
0

Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

Danh mục: Y học thưởng thức

... radiation treatment for advanced esophageal carcinomas Anticancer Res 2003; 23: 3 493 -8 Yamada H, Maki H, Takeda Y, et al Evaluation of combined nedaplatin and docetaxel therapy for human head ... head and neck cancer in vivo Anticancer Res 2006; 26: 98 9 -94 Yamashita H, Nakagawa K, Tago M, et al Radiation therapy combined with cis-diammine-glycolatoplatinum (nedaplatin) and 5- fluorouracil ... definitive chemoradiotherapy for esophageal squamous cell carcinoma J Gastroenterol 2006; 41: 4 25- 32 Sakaeda T, Yamamori M, Kuwahara A, et al Pharmacokinetics and pharmacogenomics in esophageal...

7
531
0

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Danh mục: Y khoa - Dược

... questionnaire Time to diagnosis, time to ablation, baseline data of ablation Regarding the time interval between the first occurrence of the tachycardia, its diagnosis and the year of ablation, ... defective (5) and insufficient (6)) Patients with AVNRT, AVRT and EAT rated their state of health before and after ablation The changes within the ranking scale before and after ablation is demonstrated ... therapy for initial treatment of supraventricular tachycardia 15 16 17 18 19 20 21 22 23 24 25 and its impact on quality of life and healthcare costs Am J Cardiol 199 8; 82 :58 9 - 59 3 Lau CP, Tai YT,...

9
679
0

Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx

Danh mục: Báo cáo khoa học

... whereas phosphorylated EIIA activates adenylate cyclase (CyaA) and leads to an increase in the intracellular cyclic AMP (cAMP) level [1] Mathematical models of catabolite repression in E coli The ... the EIIA and B domains being part of the phosphorylation chain and the EIIC domain representing the membrane domain As all components of the PTS, depending on their phosphorylation status, can ... time windows The analysis of the mutant strains clearly showed that a large experimental effort is necessary for the rational design of bacterial strains based on mathematical models Nishio et al...

9
723
0

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

Danh mục: Báo cáo khoa học

... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...

16
646
0

Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx

Danh mục: Cao đẳng - Đại học

... farms adopting the organic approach because of access to high quality pastures and the ability to manage pasture as a dairy feed source These areas also have a long history of small dairy operations ... Survey (ARMS) of U.S milk producers The ARMS data include detailed farm financial information, such as farm income and expenses, and farm assets and debt, as well as farm and operator characteristics ... study addresses these limitations, taking advantage of a unique nationwide data set of organic and conventional dairies Data Data used in this study come from the 20 05 Agricultural Resource Management...

30
660
0

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Danh mục: Sức khỏe phụ nữ

... epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In some ... obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0. 75 * number of epidurals per year) ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

14
610
0

Báo cáo khoa học: "A Comparison of Rule-Invocation Strategies in Context-Free Chart Parsing" pot

Danh mục: Báo cáo khoa học

... Inactive Total Time Rank 50 15 3 258 7232 3237 6 154 1283 27 19 9 15 26 75 26 75 554 7 26 75 554 7 55 47 26 75 26 75 7 690 59 33 127 79 59 12 11701 6830 53 94 3 59 0 121 78 192 132 i17 70 74 41 (7) (5) (2) (3) Table ... LCK Active 1628 157 9 3104 157 9 2873 697 1460 52 7 Inactive 3 496 3 496 396 7 3 496 396 7 396 7 3 496 3 496 Total Time 51 24 50 75 7071 50 75 6840 4664 4 95 6 4023 Rank 62 58 (5) 79 57 64 47 (3) 45 (2) 40 Table ... Grammar III, sentence Total Time Strategy Active Inactive TD 13676 52 78 18 95 4 91 0 52 78 1 457 9 7 65 TDo 93 01 798 0 2 750 2 91 3 LC 1 95 2 2 52 78 1 457 9 2604 LCe 93 01 798 0 26207 731 LCK 18227 93 39 482 798 0...

8
355
0

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Danh mục: Sức khỏe giới tính

... fits the data It indicates the amount of the relationship between the variables that remains unexplained by a model; the larger the value, the poorer the model fits the data As a rule of thumb, a ... (78- 89) 22 ( 15- 30) 86 (80 -91 ) Ziehl stain 66 (56 -76) 99 (98 -100) 65 (56 -74) 93 (88 -96 ) 64 (56 -73) n .a Cavities 21 (14- 29) 97 (94 -100) 22 ( 15- 30) 95 (91 -98 ) 25 (18-33) n .a Apical infiltrates 42 ... HIV infection Br Med Bull 199 8; 5: 57 9 - 59 3 Cantwell MF, Binkin NJ Impact of HIV on tuberculosis in subSaharan Africa: a regional perspective Int J Tuberc Lung Dis 199 7; 1: 2 05- 214 Batungwanayo...

7
506
0

Báo cáo khoa học: "A comparison of clausal coordinate ellipsis in Estonian and German: Remarkably similar elision rules allow a language-independent ellipsis-generation module" pot

Danh mục: Báo cáo khoa học

... [oma jalgratta]b parandas * dass Jan [sein Fahrrad]b reparierte ja et Peeter oma jalgratta puhastas und dass Peter sein Fahrrad putzte (20) Jan parandas oma uue jalgrattab Jan reparierte sein neues ... cleaned (16) *… et Jan asjatundlikult oma jalgratta parandas dass Jan fachkundig sein Fahrrad reparierte ja [et Jan]f hoolikalt [oma jalgratta]f puhastas und [dass Jan]f eifrig [sein Fahrrad]f ... * Jan parandas oma jalgratta asjatundlikult * Jan reparierte sein Fahrrad fachkundig ja Janf puhastas [oma jalgratta]f hoolikalt und Janf putzte [sein Fahrrad]f eifrig SGF (Subject Gap in clauses...

4
321
0

báo cáo hóa học:" Comparison of the effects of vitamin D products in a psoriasis plaque test and a murine psoriasis xenograft model" docx

Danh mục: Hóa học - Dầu khí

... OH did the statistical analysis, VH organised the clinical study, KK and MAR participated in the design of the studies and interpreted the data All authors read and approved the final manuscript ... patient the statistical analysis was based on data in an incomplete block structure The study and statistical design was chosen so as to make the data as balanced as possible P-values were Page of ... and F) transplantation Immunohistochemical stainings of a keratome biopsy before (A, B and C) transplantation and after (D, E and F) transplantation and treatment in the psoriasis xenograft SCID...

9
532
0

Báo cáo hóa học: " Comparison of three rapamycin dosing schedules in A/J Tsc2+/- mice and improved survival with angiogenesis inhibitor or asparaginase treatment in mice with subcutaneous tuberous sclerosis related tumors" docx

Danh mục: Hóa học - Dầu khí

... Untreated Asparaginase * Asparaginase+Rapamycin * # Rapamycin * Control Untreated Asparaginase * Asparaginase+Rapamycin * # 100 3000 Percent survival Tumor Volume (mm 3) 350 0 250 0 2000 150 0 1000 ... important regulator of mTOR signaling [ 35] L-Asparaginase is an enzyme that catalyzes the hydrolysis of L-asparagine to L-aspartic acid and is used as part of the curative combination chemotherapy ... into 10 randomly assigned groups: untreated control group, single agent rapamycin, single agent asparaginase, combination asparaginase plus rapamycin, single agent vincristine, combination vincristine...

18
611
0

5 9 comparison of fluid rise in a capillary tube bundle of varying diameters illustrates the distribution of saturation