5 using free pins and a single image to paint a 3d object
Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf
... Jonathan S Yedidia, William T Freeman, and Yair Weiss, 2003 Understanding belief propagation and its generalizations, pages 239–269 Morgan Kaufmann Publishers Inc., San Francisco, CA, USA Fabien ... data with the automatic segmenter Juman (Kurohashi and Nagao, 1994) There is a caveat to this evaluation, though The reason is that the segmentation and alignment scheme used in our gold standard ... University, California K Yamada and K Knight 2001 A syntax-based statistical translation model Proceedings of ACL M Collins 2003 Head-driven statistical models for natural language parsing Computational...
- 9
- 455
- 0
Báo cáo khoa học: "Validity of leaf areas and angles estimated in a beech forest from analysis of gap frequencies, using hemispherical photographs and a plant canopy analyzer" pot
... between the tree basal area, the height to the base of the crown and the total leaf area was established Finally, this latter relationship was used to calculate the total leaf area in the two surveyed ... appear to be practical tools to assess temporal or spatial relative variation in L but require an extra calibration for Assuming a canopy to be an infinite number of randomly distributed black leaves, ... stems) forms a fully closed and homogeneous canopy In each plot, a 60 m study area was delim2 ited and all trees were measured (height and diameter at breast height) Basal area and stem density...
- 10
- 384
- 0
using pair work and group work techniques to increase students' participation and interest in communicative english classes at hanoi university of industry
... is that “the administration of small group work is a demanding and arduous process, as it is a careful planning, preparation and constant motoring” To sum up, teachers have to deal with a number ... because I feel free and active” “I myself like playing games because I can learn and play together” “We prefer playing games and working in pairs and groups because we have opportunities to express ... a more active and participatory role than in traditional approaches Teachers work as facilitators, consultants or supervisors Also, “activities in CLT are often carried out by students in small...
- 43
- 1,562
- 5
Báo cáo hóa học: "Interaction between High-Level and Low-Level Image Analysis for Semantic Video Object Extraction" docx
... system in a completely automatic way The second task takes the characteristics of the specific implementation into account and aims at identifying areas of the image that correspond to semantic objects ... available [13] Camera noise and local illumination variations are then tackled by a change detector organized in two stages First, sensor noise is eliminated in a classification stage Then, local ... on local and global feature reliability Local reliability of both spatial and temporal features is estimated using the local spatial gradient The estimation is based on the observation that the...
- 12
- 359
- 0
AN1069 using c30 compiler and the SPI module to interface EEPROMs with dsPIC33F and PIC24F
... Viejo, CA Tel: 949-462-9523 Fax: 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - ... DS01069B-page 11 WORLDWIDE SALES AND SERVICE AMERICAS ASIA/PACIFIC ASIA/PACIFIC EUROPE Corporate Office 2355 West Chandler Blvd Chandler, AZ 85224-6199 Tel: 480-792-7200 Fax: 480-792-7277 Technical ... ready for additional commands The WEL bit is also cleared at the end of a write cycle, which serves as additional protection against unwanted writes The part remains in a continuous RDSR loop and...
- 12
- 315
- 0
Báo cáo hóa học: " Research Article Pose-Encoded Spherical Harmonics for Face Recognition and Synthesis Using a Single Image" docx
... of 3D face scans For a test image at a rotated pose and under an arbitrary illumination condition, we manually establish the image correspondence between the test image and a mean face image at ... Another approach is to require multiple training images at various poses in order to recover the new set of basis images at each pose However, multiple training images are not always available and a ... Jacobs, “Appearance characterization of linear lambertian objects, generalized photometric stereo, and illumination-invariant face recognition,” IEEE Transactions on Pattern Analysis and Machine...
- 18
- 354
- 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach for the improvement ... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with...
- 14
- 593
- 0
A cross cultural study of using hedges in refusing a request in english and vietnamese
... a lion As fierce as a tiger As slippery as an eel As slow as a tortoise As slow as a snail As stink as a polecat As thick as ants As wet as a drowned rat Like water off a duck’s back To fight ... words: A dark horse Smell to a rat Leading a dog’s life To work like a dog A bull in a China shop A book worm Piggy bank Chicken Raining cats and dogs As blind as a bat An early bird A quiet as a ... strength to that of a buffalo since they are familiar to horses rather than buffaloes Horses can also be used to pull ploughs and cards, to transport and to entertain They are energetic enough to be...
- 49
- 740
- 0
Tài liệu Writing and Reading XML Using a DataSet Object ppt
... " + "FROM Customers " + "ORDER BY CustomerID"; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); ... ANATR Ana Trujillo3 Emparedados y helados Ana Trujillo Avda de la Constitución 2222 ... myDataSet.ReadXml("myXmlFile.xml"); DataTable myDataTable = myDataSet.Tables["Customers"]; foreach (DataRow myDataRow in myDataTable.Rows) { Console.WriteLine("CustomerID = " + myDataRow["CustomerID"]);...
- 8
- 360
- 0
Tài liệu Creating and Using a DataRelation Object doc
... true) parentDataTableName and childDataTableName are the names of the parent and child DataTable objects parentDataColumnNames and childDataColumnNames contain the names of the DataColumn objects ... childDataColumn) DataRelation(string dataRelationName, DataColumn[] parentDataColumns, DataColumn[] childDataColumns) DataRelation(string dataRelationName, DataColumn parentDataColumn, DataColumn childDataColumn, ... RelationName property of your DataRelation parentDataColumn and parentDataColumnsare the DataColumn objects in the parent DataTable childDataColumn and childDataColumns are the DataColumn objects...
- 7
- 325
- 1
Tài liệu Creating and Using a DataView Object doc
... SqlCommand mySqlCommand = mySqlConnection.CreateCommand(); mySqlCommand.CommandText = "SELECT CustomerID, CompanyName, Country " + "FROM Customers"; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); ... mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); mySqlConnection.Close(); DataTable customersDT ... rows are read from the DataRow objects stored in the underlying DataTable The following example uses a foreach loop to display the DataRowView objects in the customersDV DataView: foreach (DataRowView...
- 5
- 330
- 0
Tài liệu Creating and Using a DataViewManager Object pdf
... SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, ... "Customers"); mySqlConnection.Close(); DataTable customersDT = myDataSet.Tables["Customers"]; // create a DataViewManager object named myDVM DataViewManager myDVM = new DataViewManager(myDataSet); ... myDVM to create a DataView // named customersDV for the customersDT DataTable DataView customersDV = myDVM.CreateDataView(customersDT); // display the rows in the customersDV DataView object foreach...
- 4
- 350
- 0
A study on increasing students’ participation in communicative activities in large classes by using group work and questioning technique at marie curie high school, hai phong
... then Situational Language Teaching represented the major British Approach to teaching English as a foreign language In Situational Language Teaching, language was taught by practising basic structures ... theoretical assumption underlying Situational Language teaching (Richards and Rodgers 1991:64) As the scope of Communicative Language Teaching has expanded, it was considered as an approach rather than ... effectively, a speaker must know not only how to produce any and all grammatical utterances of a language but also how to use them effectively The speaker must know what to say, with whom, and when and...
- 42
- 616
- 2
Tài liệu Báo cáo khoa học: "Japanese Dependency Parsing Using Co-occurrence Information and a Combination of Case Elements" pdf
... balance of the two probabilities, and is fixed to the best value by considering development data (different from the training data)1 Reranking Candidate Candidate Candidate Candidate Candidate ... method Sadao Kurohashi and Makoto Nagao 1994 Kn parser: Japanese dependency/case structure analyzer In Proceedings of the Workshop on Sharable Natural Language Resources, pages 48–55 Sadao Kurohashi ... 719–724 Sadao Kurohashi and Makoto Nagao 1998b Japanese Morphological Analysis System JUMAN version 3.5 Department of Informatics, Kyoto University (in Japanese) References Eugene Charniak and Mark...
- 8
- 481
- 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot
... 778-783 Kar A, Modi-Parekh K, and Chakroborty A. K Advances KAVITA MODI – PAREKH ET AL 10 11 in tuberculosis diagnostics Health Administrator 2003; 15: 118-123 Heifets L Dilemmas and Realities of Rapid ... with saliva All the samples were processed for bacteriological investigations, namely smear, culture and PCR Sample processing, culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization ... single gold standard was available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards Efficiency of microscopy, culture and PCR...
- 8
- 524
- 0
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx
... total pregnancy according to maternal characteristics and infant characteristics Information on these characteristics was obtained from questionnaires in pregnancy and from medical records, as ... for each wind class Various input data was taken into account in the calculations as described earlier [18,19], including annual data on traffic intensities and annual emissions from traffic, ... ambient air pollutants display significant smallscale spatial variation This intra-urban spatial variation has been documented especially for traffic-related pollutants such as NO , black smoke,...
- 11
- 514
- 0
Exposures to fine particulate air pollution and respiratory outcomes in adults using two national datasets: a cross-sectional study doc
... design and collection of air quality and health data, and other critical considerations [35] Recent efforts to link ambient monitoring data to health data, in attempts to reduce potential misclassification ... and covariates, described below) to facilitate analyses Respiratory health outcomes Answers to three questions from the NHIS sample adult questionnaire about asthma and additional questions about ... social environment has been demonstrated to be an influential factor in the exacerbation of asthma and severity of asthma attacks [77], and evidence in adolescents and young adults exists to suggest...
- 12
- 549
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... antiviral effect against vesicular stomatitis virus and encephalomyocarditis virus Virology 256, 8–14 11 Itsui Y, Sakamoto N, Kurosaki M, Kanazawa N, Tanabe Y, Koyama T, Takeda Y, Nakagawa M, Kakinuma ... high-molecular-weight GTPases such as dynamin and the antiviral protein, Mx Because of similarities in the molecular architecture of GBPs and members of the dynamin family, GBPs are classified as a part ... fluorescence titrations and analytical gel filtration Results and Discussion Hydrolytic activity of hGBP 5a/ b and hGBP5ta In light of previous observations for hGBP1 and other large GTPases, we analysed...
- 9
- 462
- 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and PMluI (5Â-GTACACGCG TCTGATCAG-3Â) ... software (Digital Instruments, Santa Barbara, CA, USA) and spip software (Scanning Probe Image Processor; Image Metrology, Lyngby, Denmark) In general, AFM images were low-pass ltered, and single ... H+-pyrophosphatase T.-H Liu et al Fig Purication and proton transport activity of V-PPase (A) Analysis of puried V-PPase by western blotting (top) and SDS/ PAGE and Coomassie Blue staining (bottom) Lane...
- 14
- 332
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25