4mouse model based evidence that nf kappa b functions as a tumor suppressor in

Báo cáo y học: " Cellular receptor binding and entry of human papillomavirus" pdf

... involved in HPV binding And it has been clarified that a6 integrin played a leading role in this process with the evidence that a monoclonal antibody against the a6 integrin subunit reduced the binding ... interactions, and as the previous researches revealed, capable of acting as virus receptors for initial binding and/or internalization, as in the case of echovirus (a 2b1 ), coxsackievirus (avb3), hantavirus ... Tetraspanins are an evolutionary conserved family of four transmembrane domain-containing proteins including at least 32 members in humans [41], which are able to interact laterally with each...

Tài liệu Báo cáo khoa học: Staphylococcal enterotoxin C1-induced pyrogenic cytokine production in human peripheral blood mononuclear cells is mediated by NADPH oxidase and nuclear factor-kappa B doc

Danh mục: Báo cáo khoa học

... concentrations Primary antibodies including mouse monoclonal NF- jB p65, rabbit polyclonal NF- jB p65, goat and rabbit polyclonal NF- jB p50, and rabbit polyclonal p47phox were obtained from Santa Cruz Biotechnology ... messengers that regulate intracellular signaling cascades and transcription factors Some investigations have reported that NF- jB can be activated by ROS [32,33] produced by a pathway involving 5-LOX ... phase proteins both in health and in many diseases [11,12] NF- jB has been identiﬁed in various cell types and is regulated by many inducers, such as ultraviolet irradiation, cytokines, and bacterial...

Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt

Danh mục: Báo cáo khoa học

... atoms ˚ Average main chain B- factor (A2 ) ˚ Average side chain B- factor (A2 ) ˚ Average ligand B- factor (A2 ) BGC 1a ˚ Average ligand B- factor (A2 ) BGC 2b ˚ Average ligand B- factor (A2 ) L3-1c ˚ Average ... cell wall Surfacebased carbohydrate binding sites of weak afﬁnity are well known (e.g in lectins and haemagglutinin) where Carbohydrate binding sites in Candida exoglucanase shallow indentations ... position to interact with the b- 1,3-glucan substrate Strikingly, the carbohydrate-binding module CBM 4-2 of a bacterial laminarinase, which recognizes the same substrate (laminarin) but which is...

Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx

Danh mục: Báo cáo khoa học

... determinant for ET-1 binding On the basis of chimeric ETB derivatives and binding of antagonists, Wada et al proposed a 60 amino acid area spanning I138-I197, and thus covering TMS2 and TMS3, as ... approach gives good evidence for a ligand-binding activity of CF-produced ETB 3262 Fig Ligand binding of ETB derivatives Binding of ETB derivatives to bET-1 was analyzed by pull-down assays Bound ... loaded on the bET-1 chip, and binding kinetics were evaluated using biaevaluation 3.1 software In general, signals obtained from the Biacore assay were lower than expected for loading of ETBcHx...

Báo cáo Y học: A b-lysine adenylating enzyme and a b-lysine binding protein involved in poly b-lysine chain assembly in nourseothricin synthesis in Streptomyces noursei pot

Danh mục: Báo cáo khoa học

... stand-alone A- domain that activates b- lysine by adenylation It was also found that S noursei harbours a protein that after activation speci®cally binds b- lysine as a thioester This protein contains ... pyrophosphate into ATP per second in the presence of b- lysine The b- lysine binding protein was assayed in a coupled assay with the b- lysine activating enzyme The assay contained 1±2 pkatal of b- lysine ... that the active site of the enzyme can strictly distinguish between an a- amino and a b- amino group of lysine Other b- amino acids such as b- alanine or b- aminobutyric acid, c-aminobutyric acid and...

Báo cáo khoa học: Nuclear factor kappa B and tumor necrosis factor-alpha modulation of transcription of the mouse testis- and pre-implantation development-speciﬁc Rnf33⁄Trim60 gene pot

Danh mục: Báo cáo khoa học

... Kowalik TF, Schmid RM, Huang ES, Baldwin AS Jr & Nabel GJ (1993) Dimerization of NF- KB2 with RelA(p65) regulates DNA binding, transcriptional activation, and inhibition by an I kappa B- alpha (MAD-3) ... an anti-p65 (ap65) serum The arrowhead and arrows are as in (A) above (C) ChIP assays of in vivo p65 and p50 binding to the jB site in nuclear extracts of testicular cells using antibodies against ... Petrungaro S, Galli R, Filippini A, Ziparo E & De Cesaris P (2005) Characterization of signaling pathways leading to Fas expression induced by TNF-alpha: pivotal role of NF- kappaB FASEB J 19,...

Báo cáo Y học: Barley a-amylase Met53 situated at the high-afﬁnity subsite )2 belongs to a substrate binding motif in the bﬁa loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate speciﬁcity pot

Danh mục: Báo cáo khoa học

... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley ... 128146 Plant Plant Plant Plant Plant Plant Mammal Bacterium Mold Yeast Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium ... amylase G6-forming amylase G5-forming amylase Branching enzyme Amylopullulanase Neopullulanase CDase a Tre 6-P hydrolase b Oligo-1,6-glucosidase a- Glucosidase Pullulanase Trehalose synthase Isoamylase...

Báo cáo y học: "The S100A8/A9 heterodimer amplifies proinflammatory cytokine production by macrophages via activation of nuclear factor kappa B and p38 mitogen-activated protein kinase in rheumatoid arthritis" potx

Danh mục: Báo cáo khoa học

... activaS10 0A8 /A9 -induced nuclear factor kappa B (NF- B) activation and its independence of p38 mitogen-activated protein kinase (MAPK) activation (a) Activation of the transcriptional factor NF- B ... S10 0A8 /A9 heterodimer has been shown to be a reliable indicator of disease activity and joint inflammation in inflammatory rheumatic diseases, including RA [18,19], juvenile RA (JRA) [27-30], psoriatic ... 105:2955-2962 42 Kawanaka N, Yamamura M, Aita T, Morita Y, Okamoto A, Kawashima M, Iwahashi M, Ueno A, Ohmoto Y, Makino H: CD14+, CD16+ blood monocytes and joint inflammation in rheumatoid arthritis Arthritis...

Báo cáo y học: " Nontypeable Haemophilus influenzae induces COX-2 and PGE2 expression in lung epithelial cells via activation of p38 MAPK and NF-kappa B" pps

Danh mục: Báo cáo khoa học

... NTHi-induced NF- kappa B signaling pathway EMSA analysis showed that NFkappa B translocation and its DNA binding activity were markedly increased by NTHi within 90 mins, and DNA binding activity ... there are still increasing evidences that the blockade of MAPK inhibited NF- kappa B- dependent gene transcription without affecting IkappaBalpha phosphorylation and NF- kappa B- DNA binding ability ... JD: Activation of NF- kappa B by Nontypeable Haemophilus influenzae is mediated by TLR2-TAK1-dependent NIK-IKK alpha/beta-I kappa B alpha and MKK3/6-p38 MAP kinase signaling pathways in epithelial...

Báo cáo y học: "Potential role and mechanism of IFN-gamma inducible protein-10 on receptor activator of nuclear factor kappa-B ligand (RANKL) expression in rheumatoid arthritis" pptx

Danh mục: Báo cáo khoa học

... CXCL10-induced RANKL expression, we used PTX, a bacterial toxin that inhibits Gai activation by ADP-ribosylating Gai subunits, and the inhibition of Gai by PTX was confirmed by measuring CREB phosphorylation ... receptor activator of nuclear factor -kappa B; RANKL: receptor activator of nuclear factor -kappa B ligand; RT-PCR: reverse transcriptasepolymerase chain reaction; siRNA: small interfering RNA; TNF: tumor ... MO, USA) The nitrocellulose membrane was subsequently washed and incubated with a peroxidase-labeled rabbit anti-goat IgG antibody for hours at room temperature and then incubated with an enhanced...

Báo cáo y học: "Relationships between free radical levels during carotid endarterectomy and markers of arteriosclerotic disease"

Danh mục: Y học thưởng thức

... concentration in plasma that had been stored at –70ºC was measured by a sandwich ELISA (Mercodia, Uppsala, Sweden) utilizing the same specific murine monoclonal antibody, mAb-4E6, as in the assay ... hyperglycemia and hyperinsulinemia Circulation 2000;101:2247-51 Takahashi K, Mizuarai S, Araki H, Mashiko S, Ishihara A, Kanatani A, Itadani H, Kotani H Adiposity elevates plasma MCP-1 levels leading ... of all variables analysed Each subsequent component constitutes an independent linear combination of variables, capturing a maximum of the variance remaining in the data set, and is orthogonal...

Data Binding and Silverlight List Controls

Danh mục: Kỹ thuật lập trình

... to add a class to define a Book object Below the MainPage class, add the following class definition: namespace BasicDataBinding { public partial class MainPage : UserControl { public MainPage() ... elements Also, by using data binding, you are able to separate the UI from the data in your application, which allows for a cleaner UI and easier maintenance The Binding Class Data binding in Silverlight ... page is loaded, you want to call GetData() from the GridData class and bind that to the DataGrid’s ItemsSource property, as follows: public partial class MainPage : UserControl { public MainPage()...

Tài liệu Carrier-Class CATV Networks Maintaining Signal Connectivity During Configuration Changes and Maintenance docx

Danh mục: Phần cứng

... into racks, cabling concerns became paramount Rack-mounted combining networks (see Figure 3) were designed to ease the sudden onslaught of cables By maintaining all cabling within the rack lineup ... Maintenance All cabling was contained within the rack lineup, improving cable management functionality Subsequently, circuit access and routing was performed more easily and quickly than ever before ... including emergencies Service availability is critical Page Carrier-Class CATV Networks: Maintaining Signal Connectivity During Configuration Changes and Maintenance Reconfiguration with Minimal...

Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efﬁcacy pdf

Danh mục: Báo cáo khoa học

... believe that reduced TRBP binding is a probable reason for reduced silencing by mismatched siRNAs That said, it appears that Dicer binding can have an impact on the silencing efﬁciency of some siRNAs ... As with one terminal mismatch, binding by Dicer was improved for simultaneous single mismatches but reduced for double mismatches In all cases, terminal mismatches reduced TRBP binding, as above ... bars indicate siRNAs based on siRNA 396 and gray bars indicate siRNAs based on siRNA 306 silencing efﬁcacy of the mismatched siRNAs was reduced, with the exception of 396-AG (Fig 1) To conﬁrm that...

Tài liệu Báo cáo khoa học: Autophagy inhibits reactive oxygen species-mediated apoptosis via activating p38-nuclear factor-kappa B survival pathways in oridonin-treated murine ﬁbrosarcoma L929 cells doc

Danh mục: Báo cáo khoa học

... or NF- jBp65 siRNA As shown in Fig 1 1A ,B, PDTC or p65 siRNA signiﬁcantly reduced oridonin-induced autophagy, and oridonin-induced Beclin activation was inhibited by p65 siRNA, indicating that NF- jB ... suggest that the L929 cells induced by oridonin exhibit both autophagic and apoptotic characteristics Inhibition of autophagy increased apoptotic cell death, suggesting that autophagy has an anti-apoptotic ... (2005) Apoptosis in the development and treatment of cancer Carcinogenesis 26, 263–270 1304 Ohsawa I, Ishikawa M, Takahashi K, Watanabe M, Nishimaki K, Yamagata K, Katsura K, Katayama Y, Asoh S...

Tài liệu Báo cáo khoa học:Insulin-like growth factor 1 signaling regulates cytosolic sialidase Neu2 expression during myoblast differentiation and hypertrophy doc

Danh mục: Báo cáo khoa học

... transfectants was obtained after 10 days of selection in puromycin antibiotic (2 lgÆmL)1, Sigma) and used for a few passages RNA extraction and RT-PCR analysis Total RNA was obtained by Tri-reagent ... (1998) Evidence of insulin-stimulated phosphorylation and activation of the mammalian target of rapamycin mediated by a protein kinase B signaling pathway Proc Natl Acad Sci USA 95, 7772–7777 12 Nave ... Tokuyama S, Moriya S, Taniguchi S, Yasui A, Miyazaki J, Orikasa S & Miyagi T (1997) Suppression of pulmonary metastasis in murine B1 6 melanoma cells by transfection of a sialidase cDNA Int J Cancer...

Tài liệu Age-related changes of the dental aesthetic zone at rest and during spontaneous smiling and speech pptx

Danh mục: Chụp ảnh - Quay phim

... smiling and speech records, the display of teeth and gingiva was measured In the maxilla and mandible, a central and lateral incisor, a canine, a ﬁrst and second premolar, and a ﬁrst molar were measured ... An interesting ﬁnding was that the age-related decrease in lip line height during spontaneous smiling was considerably less than in the natural rest position It was also interesting to note that ... Gosain A K, Amarante M T, Hyde J S, Yousif N J 1996 A dynamic analysis of changes in the nasolabial fold using magnetic resonance imaging: implications for facial rejuvenation and facial animation...

Tài liệu Báo cáo khoa học: Tet repressor mutants with altered effector binding and allostery docx

Danh mục: Báo cáo khoa học

... as a negative control (5¢-ctaataaaattaatcatttatggcataggcaacaag-3¢) All samples were incubated in complex buffer containing 0.02 m Tris ⁄ HCl (pH 8.0) and mm MgCl2 Atc and 4-ddma-atc were added ... is increased, leading to loss of DNA binding Helices a1 , a4 and a6 forming this interface are involved in signal transduction, but there is no structural hint for an in uence on effector binding ... location-function relationships, the data presented here establish that alterations of residues in that interface built by helices a1 , a4 and a6 (Fig 1A) also affect both substrate FEBS Journal...

Báo cáo khoa học: Temporal expression of heat shock genes during cold stress and recovery from chill coma in adult Drosophila melanogaster pdf

Danh mục: Báo cáo khoa học

... GTCACATCATGCGCCACTTTG TTGTAGCCATCGGGAACCTTGTAG GGCCACCACAATCAAATGTCAC CTCCTCGTGCTTCCCCTCTACC GAGATCATCAAGCCCACCACAAC CGGGAAACTTAATGTCGAAGGAGAC ACATCTCGCCGTACTTCATCAACTC GGAGGAGGGCATCTTGGAACTC ... TGGATGAACCCACACCCAATC CGAGGCAACGGGCACTTC GAAGGCACTCAAGGACGCTAAAATG CTGAACCTTGGGAATACGAGTG TCGATGGTACTGACCAAGATGAAGG GAGTCGTTGAAGTAGGCTGGAACTG TGCTGGATGTCACTCCTCTGTCTC TGGGTATGGTGGTGTTCCTCTTAATC ... RA a a a a a a a a a a a b b b b b a a b b a b b b b b b a a b b a b FEBS Journal 277 (2010) 174185 ê 2009 The Authors Journal compilation ê 2009 FEBS H Colinet et al Other Hsp genes The mRNA...

Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot

Danh mục: Báo cáo khoa học

... 12 base RNA (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 ... degÆcm)2Ædmol)1, was calculated by using an average amino acid molecular weight of 110 Binding analysis to substrate Binding of proteins to the substrate was analyzed using the Biacore X instrument (Biacore, ... primers are 5¢- TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ for primer 1, 5¢- CGCATATG GAGACGATGATCGCCTACGTCGATG-3¢ for primer 2, 5¢-ACCGTTAAGCTTTCATAAACATCCTCCTTT-3¢ for primer 3, and 5¢- CGGAATTCTCATGTGTCCAGTTCTG...

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008

4mouse model based evidence that nf kappa b functions as a tumor suppressor in hcc