4 section 6 3 scoring is a procedure of evaluates the performance of a financing mechanism for
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... 239 16 239 25 Takei Y, Kadomatsu K, Yuzawa Y, Matsuo S & Muramatsu T (20 04) A small interfering RNA targeting vascular endothelial growth factor as cancer therapeutics Cancer Res 64 , 3 36 5 33 70 Elbashir ... expression of the C-X-C chemokine receptor CXCR4 by human bronchial epithelial cells: regulation by proinflammatory mediators J Immunol 169 , 64 4 5– 64 5 1 Amara A, Lorthioir O, Valenzuana A, Magerus A, Thelen ... T-cell-line-adapted HIV-1 Nature 38 2, 833 – 835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, Virelizier JL & Arenzana-Seisdedos F (1999) Stromal-derived...
- 15
- 423
- 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
... Fukuda M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E: CRM1 is responsible for intracellular transport mediated by the nuclear export signal Nature 1997, 39 0 :30 8 -31 1 38 Askjaer ... A 5′GTCTCTCTGGTTAGACCAG -3 , Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC -3 and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG -3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC ... group of RNA HeLa cells were transfected with pNL4 -3 and Matrin for this analysis, and we analyzed 20 μg of total RNA by Northern blotting (Figure 5A) There was an increase, in the HA-Matrin transfected...
- 10
- 313
- 0
Giải bài 1,2,3, 4,5,6 trang 70,71 SGK Hóa 10: Tinh thể nguyên tử và tinh thể phân tử
... tính chất chung: dễ nóng chảy, dễ bay Tinh thể ion: tính chất chung: bền vững, hợp chất ion đề rắn, khó bay hơi, khó nóng chảy Bài (SGK H a 10 trang 71) a) Hãy đ a số thí dụ chất có mạng tinh thể ... bay Bài (SGK H a 10 trang 71) Vì hợp chất ion có nhiệt độ nóng chảy cao? Giải 5: Lực hút tĩnh điện ion ngược dấu tinh thể ion lớn Các hợp chất ion rắn, khó bay hơn, khó nóng chảy Bài (SGK H a ... H a 10 trang 71) Hãy nêu liên kết h a học chủ yếu loại mạng tinh thể biết Giải 6: Liên kết h a học chủ yếu loại mạng tinh thể biết: – Trong mạng tinh thể nguyên tử: liên kết cộng h a trị – Trong...
- 2
- 1,590
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... from a distance of 10 cm to convert cobalamins to a dicyano form The total amount of enzymebound cobalamin was calculated from the absorbance at 36 8 nm for dicyanocobalamin (eM, 36 8 , 30 .4 · 1 03 ... Hsc70 and ADP as well The residue corresponding to Glua459 of the DD reactivase is Alaa 461 in glycerol dehydratase reactivase Furthermore, 2¢-dATP retained half of the efficacy of ATP in the activation ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity...
- 13
- 620
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... 20 06 The Authors Journal compilation ª 20 06 FEBS 46 79 Nucleolin is a potential ligand for PTPr 33 34 35 36 37 38 39 40 41 42 43 44 45 D E Alete et al the development and maintenance of excitatory ... Journal 2 73 (20 06) 46 68 46 81 ª 20 06 The Authors Journal compilation ª 20 06 FEBS D E Alete et al 59 60 61 62 63 64 by vascular endothelial growth factor and nonmuscle myosin Blood 107, 35 64 35 71 Said ... Journal 2 73 (20 06) 46 68 46 81 ª 20 06 The Authors Journal compilation ª 20 06 FEBS 46 69 Nucleolin is a potential ligand for PTPr A D E Alete et al B D C E Fig Affinity chromatography isolation of protein...
- 14
- 669
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... 870 pAM 9 16 pAM 917 pAM 920 pAM 921 pAM 922 pAM 932 pAM 9 34 pAM 961 pAM 962 pAM 9 63 pAM 9 64 pAM 965 pAM 966 pAM 967 pAM 969 pAM 9 74 pAM 975 pAM 977 pAM 982 pAM 987 pAM 988 pAM 989 pAM 998 pAM 999 ... [ 56] GE Healthcare Novagen Clontech Clontech Clontech [37 ] [ 46 ] [ 46 ] [ 46 ] [ 46 ] [ 46 ] [ 46 ] [ 34 ] [ 34 ] [ 34 ] [ 34 ] This study This study This study This study [ 34 ] [32 ] [32 ] This study This study This...
- 23
- 490
- 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... 5¢-GTGGAGCGCAGCTATGGGCAGCAG -3 Asp8 93 Glu 5¢-GTGGAGGAGAGCTATGGGCAGCAG -3 Asp8 93 Ala 5¢-GTGGAGGCCAGCTATGGGCAGCAG -3 Ser8 94 Asp 5¢-GTGGAGGACGACTATGGGCAGCAG -3 Ser8 94 Ile 5¢-GTGGAGGACATCTATGGGCAGCAG -3 Gly8 96 Arg 5¢-GTGGAGGACAGCTATAGGCAGCAG -3 ... 5¢-GTGGAGGACAGCTATAGGCAGCAG -3 Gly8 96 Ile 5¢-GTGGAGGACAGCTATATCCAGCAG -3 a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA -3 Primers used for mutations by PCR and the QuikChangeTM ... mutants The binding of [3H]ouabain to membrane preparations that have been preheated at 50 °C can serve as a measure for the stability of the a/ b heterodimer that forms the catalytically active...
- 11
- 318
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... or His 137 , residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... 21 22 23 24 25 26 27 28 29 30 31 32 33 34 cytotoxin a- sarcin behaves as a cyclizing ribonuclease FEBS Lett 42 4, 46 48 ´ ´ ˜ Perez-Canadillas, J.M., Campos-Olivas, R., Lacadena, J., Martınez ... the value of 1. 34 reported for the wild-type protein [37 ] The far-UV CD spectra of both mutant variants were indistinguishable from that already reported for the natural fungal a- sarcin [20 ,30 , 36 , 37 ]...
- 7
- 434
- 0
– THE SAT CRITICAL READING SECTION – Part 3: Paragraph-Length Critical Reading Out with the old pdf
... d e e e e e e e e e e e e e e e e e e e e 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 79 a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b c c c c ... that this ice cream parlor can make? a 72 b 36 c 30 d 26 e 13 10 a1 , a2 , a3 , a4 , a5 , an In the sequence of positive integers above, a1 = a2 = 1, a3 = 2, a4 = 3, and a5 = If each term after the ... • • • 29 / • / • • • 30 / • / • • • • 0 0 0 0 0 0 0 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 7...
- 28
- 493
- 0
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC PR3R GAACAGGATTCGCATGAGTACT D 4For TATTGGTCGCGCAGTCGTCC DNA-shift assay part of the simD4 gene D4Rev simD4 _for_ script TTGTCCTGCATCATGACGAG AAATCTAGAGGCGACCGACCCCG ... DNA-shift assay PSEx1 PEx1R simA7F CCATGTAGGCGGTGACGA TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay PA7 simA7R ATAAGCTTGTCGATACCGATCTTC DNA-shift assay PEx2 DNA-shift assay PSR3 PEx2F ACTTCCCAGAAGTA ... TAGAATTCATCGCCACGACCATG SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3 simX5D3R simEXX4F TAGAATTCGCGACAGGAGCCATA TAGAATTCGACGCCTTCCAGTC DNA-shift assay PX4 simEXX4R TAGAATTCTCAGAACATCGTCC...
- 12
- 454
- 0
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps
... Sweden and Australia Schizophr Res 20 04, 67 :227-2 36 23 Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for ... Significance Lower bound Upper bound 0 .45 8 0. 268 2.921 0.087 0 .38 7 1.702 01 sFebruary 0.281 0 .35 5 0 .62 6 0 .42 9 0.9 84 0.9 84 3. 3+ 0.2 86 0 .31 7 0.817 36 6 0 .41 5 0 .41 5 Paternal age 32 + 1 .42 5 0 .39 13. 3 36 0 .3 34 ... 0 .3 04 1 .47 3 -0.599 0.297 0. 044 0.550 Birth rank -0.115 0. 169 0 .49 6 0.891 Family history 0 .44 4 0. 268 0.098 1.559 0.922 2 . 63 8 Maternal age Step 0 .38 7 Constant -0 .3 74 0 . 43 1 0 .3 86 0 .68 8 0.2 96 1 .60 2 1.955...
- 6
- 405
- 0
Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
... 4 13 15 18 1 868 23 64 6 69 717 060 1 46 67 22 23 40 95 232 3 40 90 745 6 46 95 731 0 22 76 3 46 5 192715 568 89279 933 182010 64 2 47 0595 34 470 64 7 83 519 8 46 19 33 89 868 5 5891922 33 212 166 35 83 842 0 61 07211 61 5 732 7 502 730 9 ... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... 11 135 220 q31.1-q31 .3 q 13. 2-q 24 q31.21-q 34 . 3 p 14. 1-p12 .3 q 14. 11-q 14. 2 q21.1-q21 .3 q11.2-q12.2 # of Markers 1 533 >8000 862 6 23 24 2 46 1 1792 41 07 Genes in region 13 >200 >100 47 35 41 45 Table 3: ...
- 36
- 446
- 0
Báo cáo y học: "Chromothripsis is a common mechanism driving genomic rearrangements in primary and metastatic colorectal cancer" pdf
... (10:1 232 747 23) H1 64 7 D (11 :37 044 60 ) V104M (12:5 64 7 88 54) ERBB3 RASA3 H1 64 7 D (11 :37 044 60 ) V104M (12:5 64 7 88 54) V117M ( 13: 1 148 0 64 9 9) R4106H (17:11 837 2 16) DNAH9 TAOK1 K484M (17:27 835 0 26) ATRX TTN K 133 50N ... (7:152012 34 9 ) Q 133 2P (3: 12 2 43 72 36 ) Q 133 2P (3: 12 2 43 72 36 ) E 545 K E 545 K E 545 K R1 032 * (4: 559 562 21) T419I (3: 532 2 035 2) 4: 39 29 0 43 2 T/C K 765 R (7: 13 36 8 233 2) R288C (9: 135 787720) R399* (10:1 232 747 23) R399* ... contributed patient material MR performed analysis of mate-pair sequencing data SL performed analysis of targeted-exome sequencing data IN performed analysis of targeted-exome sequencing data and designed...
- 29
- 405
- 0
Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt
... decline among persons on HIV protease inhibitors J Acquir Immune Defic Syndr 2000, 23 (4) :295 -30 1 http://www.aidsrestherapy.com/content /3/ 1/ 14 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Acquired ... 41 0 0 .65 51 89 ,35 0 21, 750 – 185,000 140 ,000 45 ,000 – 34 0 , 000 < 0.001 58 (66 ) 30 ( 34 ) 38 1 (71) 1 53 (29) 0.2995 29 – 1 16 60 – 166 0.0 133 52 (59) 36 (41 ) 161 (30 ) 37 3 (70) < 0.001 38 ( 43 ) 43 (49 ) ... start of antiretroviral therapy or having initiated therapy as part of a clini- Page of (page number not for citation purposes) AIDS Research and Therapy 20 06, 3: 14 cal trial Among the remaining...
- 9
- 498
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... of asthma was lacking, the history gleaned from the medical records supported an asthma diagnosis Most patients with asthma are not cared for by asthma specialists and frequently the diagnosis ... Despite the high prevalence of these two diseases that affect the African American population, there is paucity of research investigating patients with concomitant asthma and sickle cell disease Table ... hypoxemia, and a new infiltrate on chest x-ray that required hospitalization and a transfusion of packed red blood cells A cerebral vascular accident diagnosis was based on the new onset of an acute...
- 5
- 288
- 0
Báo cáo y học: " Basophil sensitivity through CD63 or CD203c is a functional measure for specific immunotherapy" doc
... CD1 23 PE (BD Catalog Nr 34 0 545 ), CD45 PE Cy7 (BD Catalog Nr 55 548 4) and HLA DR APC (BD Catalog Nr 559 866 ) for 15 at room temp, and lysed with FACS Lyse (BD Catalog Nr 34 9 202) Data was acquired for ... http://www.clinicalmolecularallergy.com/content/8/1/2 Page of Figure Comparison of CD 63 and CD203c as readout (a) the ROCs for CD 63 and CD203c at the optimal concentration of allergen, 0,1 μg/ ml, were indistinguishable (b) Bland Altman plot of ... For SCIT patients, baseline visits were used for this analysis Bland Altman Analysis The difference in basophil activation as measured by upregulation of CD 63 and CD203c was investigated by a...
- 9
- 227
- 0
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA
... melanoma brain metastases [31 ] Their unique capability to cross the blood brain barrier provides an additional advantage in treating CNS related cancer [33 ] Researchers have been using NSCs as a ... status, advanced age of the patients, and involvement of other parts of the brain [20] The combination of RT and TMZ is most efficacious after the primary resection Treatment after surgery usually ... weeks of RT to the surgical cavity and TMZ, and after that, cycles of TMZ [19] RT of glioblastoma multiforme (GBM) is focal, fractionated external beam radiation therapy to the surgical resection...
- 128
- 211
- 0
Lanosterol is a survival factor for dopaminergic neurons
... linked fatty acyls (B) and plasmalogens (C) are found in high levels in the brain Ethanolamine plasmalogen has an ether linkage A major fatty acyl brain PE is arachidonic acid (AA, 20 :4) , with ... reductase *p-value 1.89E-11 2 .44 E-10 6. 24E-08 1 .66 E-07 2.26E- 06 5.86E- 06 1.08E-05 2 .44 E-05 ** Expression in SNpc ++ ++ ++ + ++ + +++ 8.27E-05 - 1.99E- 04 ++ 2 .66 E- 04 +++ 3. 33E- 04 3. 75E- 04 1.03E- 03 3.27E- 03 ... started to biochemically screen a number of pathways (chapter 3) Page 43 Lynette Lim Lanosterol is a survival factor for dopaminergic neruons Chapter 3: Biochemical analyses of metabolic pathways...
- 102
- 399
- 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... used for different purposes 83 Table 2.2 Primers for 5’- and 3 -RACE 83 Table 2 .3 Preparation of denaturing agarose gel for northern blot analysis 84 Table 2 .4 Preparation of SDS PAGE gel 84 Table ... liver organogenesis 1 .3 .4 Pancreas morphogenesis in zebrafish 1 .3 .4. 1 Exocrine and endocrine pancreas in zebrafish Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, ... revealed by studing has mutant embryos (Field et al., 200 3a) 34 All the data indicate that developments of endocrine and exocrine pancreas are at least partially independent of each other 1 .3 .4. 3. 1...
- 199
- 296
- 0
Tài liệu Báo cáo khoa học: "A COMPUTATIONAL MECHANISM FOR PRONOMINAL REFERENCE" pot
... those that are internal to the current minimal domain and those that are external As each node is processed, a subroutine is called that dispatches on the category of the node and performs any actions ... characterize bound anaphors and pronouns: the feature +short-distance indicates whether a pronominal can be used as a short-distance anaphor while the feature :l:long-distance indicates whether ... reference with it The algorithm also uses two global variablesB*table -of- proforms* and *table -of- antecedents*rain a "blackboard" fashion The algorithm uses two major procedures The first, p a s s - d...
- 10
- 513
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25