4 generating a wsdl and portable artifacts based on a java service endpoint implementation
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot
... paperand-pencil administration First, responses automatically went into a database that was available for analysis at all times This allowed for monitoring of survey progress and eliminated the ... nonOEM parts may contain incompatible materials Older pumps may also contain elastomer diaphragms, seals and o-rings These are usually made from viton but if they are made from nitrile or natural ... oxidation process Contact with these materials should be avoided, particularly in long-term storage Copper and copper-containing alloys such as brass and bronze should be avoided Lead, tin, and...
- 164
- 601
- 3
Báo cáo hóa học: "Research Article Stability and Convergence Results Based on Fixed Point Theory for a Generalized Viscosity Iterative Scheme" pot
... M Lau, H Miyake, and W Takahashi, “Approximation of fixed points for amenable semigroups of nonexpansive mappings in Banach spaces,” Nonlinear Analysis: Theory, Methods & Applications, vol 67, ... be nonexpansive, asymptotically nonexpansive, contractive and asymptotically contractive according to Definitions 3.3 and 3.4 which follow Definition 3.3 A representation S : {T s : s ∈ S} of a left ... arbitrarily small The constants K, K1 , and K2 are finite for sufficiently large k ∈ Z0 since lim supk → ∞ βk < Assumption , f is a contraction on C Assumption , and Q is a self-mapping on W satisfying...
- 19
- 350
- 0
Báo cáo hóa học: " Research Article Representation of 3D and 4D Objects Based on an Associated Curved Space and a General Coordinate Transformation Invariant Description" potx
... retrieval and that would facilitate and speed up the calculations REFERENCES [1] N Iyer, S Jayanti, K Lou, Y Kalyanaraman, and K Ramani, “Three-dimensional shape searching: state-of-the-art review and ... easier if one could associate and define an invariant scalar functional from which the equations could be derived Such an approach has been developed: the scalar functional is the Lagrangian and ... That means, for instance, that discrete coordinate transformations (reflections) are not allowed As we know, the covariant and contravariant components associated with a vector in an orthogonal...
- 10
- 349
- 0
Báo cáo khoa học: "Diffuse anorectal melanoma; review of the current diagnostic and treatment aspects based on a case report" doc
... the anal canal Pathologe 2004, 25:171-7 Ishizone S, Koide N, Karasawa F, Akita N, Muranaka F, Uhara H, Miyagawa S: Surgical treatment for anorectal malignant melanoma: report of five cases and ... efficacy comparable to dacarbazine in a randomized trial of cutaneous melanoma, a combination of temozolomide, cisplatin, and liposomal doxorubicin in one patient with metastatic anal melanoma was used ... contributions to conception and design CNS contributed to the analysis and interpretation of data All authors read and approved the final manuscript All authors contributed equally to the final...
- 4
- 311
- 0
A contrastive analysis of the utterances containing implicatures in english and vietnamese culture (based on utterances from funny stories)
... typologies (a C .A is always concerned with a pair of language), and founded on the assumption that languages can be compared.” James also claims that there are three branches of two-valued (two languages ... concrete context 1.3 Contrastive analysis Contrastive analysis (C .A. ) dates back to the 1950s when it was first developed and practiced as an application of structural linguistics to language teaching ... Graduation Paper DECLARATION A CONTRASTIVE ANALYSIS OF THE UTTERANCES CONTAINING IMPLICATURES IN ENGLISH AND VIETNAMESE CULTURE” (Based on utterances from funny stories) I certify that no part...
- 65
- 985
- 1
1 UNFIRED BRICK USING FLY ASH AND RED MUD BASED ON GEOPOLYMER TECHNOLOGY
... the alkali activation of materials primarily comprising silica and reactive alumina involved stages: destruction–coagulation, coagulation–condensation, condensation crystallization Afterthat, Glukhovsky ... Barbosa,V.F.F., Mackenzie,K J D and Thaumaturgo, C (2000) Synthesis and characterisation of materials based on inorganic polymers of alumina and silica:sodium polysialate polymers International ... The relationship between alkaline activator content and water absorption with fly ash content is 60% Figure 11 The relationship between alkaline activator content and water resistance factor with...
- 6
- 864
- 8
Báo cáo khoa học: Well-defined secondary structures Information-storing molecular duplexes and helical foldamers based on unnatural peptide backbones pot
... atoms act as H-bond donor and acceptor sites Various arrangements of the amide O and H atoms lead to Ôhydrogen bonding sequencesÕ that allow the specific association of two single strands carrying ... of the amide protons was detected upon dilution in CHCl3 to a concentration as low as lM Isothermal titration calorimetry was employed to determine the association constant via titration of with ... corresponding oligomers reasonably soluble in aqueous media If an oligoamide backbone could fold into well-defined and robust conformation based on backbone rigidification, could the same strategy...
- 10
- 390
- 0
Báo cáo khoa học: "Unsupervised Topic Identification by Integrating Linguistic and Visual Information Based on Hidden Markov Models" potx
... Sasano, Daisuke Kawahara, and Sadao Kurohashi 2004 Automatic construction of nominal case frames and its application to indirect anaphora resolution In Proceedings of the 20th International Conference ... with the Japanese morphological analyzer, JUMAN (Kurohashi et al., 1994), and make syntactic/case analysis and anaphora resolution with the Japanese analyzer, KNP (Kurohashi and Nagao, 1994) ... International Joint Conference on Natural Language Processing, pages 334–341 Sadao Kurohashi and Makoto Nagao 1994 A syntactic analysis method of long japanese sentences based on the detection of...
- 8
- 354
- 0
Báo cáo hóa học: "Research Article Joint Signal Detection and Classification Based on First-Order Cyclostationarity For Cognitive Radios" pot
... the application of first-order signal cyclostationarity to the joint detection and classification of band-limited FSK and AM signals a ected by additive Gaussian noise and phase, frequency, and ... performance can An algorithm based on first-order cyclostationarity has been developed for the joint detection and classification of FSK and AM signals Theoretical analysis and simulation experiments ... with a performance benchmark, based on the assumption of additional a priori signal parameter information being available at the receive-side, demonstrates that the algorithm performs reasonably...
- 12
- 343
- 0
Báo cáo hóa học: " Bioconjugates of Glucose Oxidase and Gold Nanorods Based on Electrostatic Interaction with Enhanced Thermostability" ppt
... Schematic illustration of the fabrication of the GOD/GNR bioconjugates coating of the CTAB bilayer Because the free CTAB and the fixed CTAB on the substrate possess high cytotoxicity and cause denaturation ... easily be attached electrostatically on to the PDADMAC-coated GNRs, resulting in the formation of bioconjugates of GOD and GNRs The resultant GOD/GNR bioconjugates display dramatically enhanced thermostability, ... polyelectrolyte-coated GNRs via electrostatic interactions According to enzymatic catalysis examination, the GOD/GNRs bioconjugates have extraordinary stability at high temperature in contrast not only with the...
- 5
- 226
- 1
Báo cáo hóa học: " Research Article Bleimann, Butzer, and Hahn Operators Based on the q-Integers" pdf
... On uniform approximation by Bleimann, Butzer and Hahn operators on all positive semiaxis,” Transactions of Academy of Sciences of Azerbaijan Series of PhysicalTechnical and Mathematical Sciences, ... [11] O Agratini, “Approximation properties of a generalization of Bleimann, Butzer and Hahn operators,” Mathematica Pannonica, vol 9, no 2, pp 165–171, 1998 [12] O Agratini, A class of Bleimann, ... operator approximating continuous s ı functions on the semi-axis,” Koninklijke Nederlandse Akademie van Wetenschappen Indagationes Mathematicae, vol 42, no 3, pp 255–262, 1980 [9] F Altomare and...
- 12
- 383
- 0
Báo cáo hóa học: " Research Article Underwater Noise Modeling and Direction-Finding Based on Heteroscedastic Time Series" docx
... Gaussian distribution degrade in actual experiments The performance of the source localization and estimation of DOA in passive array applications such as sonar heavily rely upon the particular ... underwater acoustic channel is a time-varying and multipath channel specially in shallow water It varies due to different season, area, and situation of sea face The channel variations can be due ... minimization, the Newton approach These methods are based on multidimensional searching and minimization of log-likelihood function onto parameter space and have heavy computational burden Generally, we would...
- 10
- 296
- 0
Báo cáo hóa học: " Research Article Simulating Visual Pattern Detection and Brightness Perception Based on Implicit Masking" docx
... n and I0 are parameters that represent the exponent and the semisaturation constant of the Naka-Rushton equation, respectively, and w0 is a reference luminance value In conditions where Ic and ... three examples show that the current model can describe the effects of both local contrast and assimilation under a common theoretical framework As a same algorithm and a same set of parameter values ... De Valois, Spatial Vision, Oxford University Press, New York, NY, USA, 1988 [45] A B Watson and A J Ahumada Jr., A standard model for foveal detection of spatial contrast,” Journal of Vision,...
- 11
- 352
- 0
Báo cáo hóa học: " Segmentation of DNA into Coding and Noncoding Regions Based on Recursive Entropic Segmentation and Stop-Codon Statistics" ppt
... nucleotides are as for Ꮽ12 alphabet (Table 2) The symbols S1 , S2 , and S3 are the stop codons TAA, TAG, and TGA in the given DNA strand, and S1 , S2 , and S3 are the stop codons AGT, GAT, and AAT on ... stop codons TAA, TAG, and TGA are situated as TCA, CTA, and TTA When the codon CTA is met on a given DNA strand, it is known that it represents the stop codon TAG on the opposite DNA strand In ... this way, the stop-codon statistics in both DNA strands is the same with the statistics of the six codons TAA, TAG, TGA, TCA, CTA, and TAA along a single DNA strand used for DNA segmentation [5,...
- 11
- 335
- 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
... the conserved regions of Ehrlichia spp 16S rRNA gene were used [10] For the second round nested-PCR, primers HE1 (5'-caattgcttataaccttttggttataaat-3') and HE3 (5'-tataggta ccgtcattatcttccctat-3') ... genus-specific amplification of 116 bp fragment of 16S rRNA of Ehrlichia spp or Anaplasma spp (Table 1) Of these more than 80% ticks collected from Gyeonggi province alone and at least one sample from each ... Sequencing was performed by dideoxy termination using an ABI PRISM 3700 DNA Analyzer (Applied Biosystems, USA) Sequence data was analyzed using Chromas software version 1.51 (Technelysium, Australia)...
- 5
- 353
- 0
báo cáo khoa học: " Transcriptomic identification of candidate genes involved in sunflower responses to chilling and salt stresses based on cDNA microarray analysis" pps
... TGATCCATCAATCTCCGTCTT AAAGGATCAGTCGCTGCTGT CAAAATGCAACGACCCATTA CAACAAAAGCAGACGCTGAA CAGCCCGGAGAGGTTTAACT AATCCCATCAATCCCCACTT GCCGAGGTACAAACTGGAGA ACGGAAGCGTTGTTTGGTAA CAGAGACGTTCTTGCGTTGA CGCAATTGCTATTGATGGAA ACGCGAGTCGGTTGTTTTAT ... TGAGCATGATCTGAATATCTTGAA TCAACATCCCACAGAAACGA CGCACACAACAAAGAAATGG ACACCGGTATGGTTGATGCT TCATTTTCTCCACCCATGGTA GAGGTTCATTCCGTCGTTGT GTGACCCGAACTCCTTGGTA CGACTCCGCCAAATACAGAT AACTTTGCAGTGGGACCATC GGCAGGTACATCTTGGCCAAT ... ACGCGAGTCGGTTGTTTTAT GGCAGGTACCAGGGGTTATT TTTGCAAGGATGAATGGTGA GGCAGCCAATCCTCTTGATA TTCAGCCCGGAAAGAATATG GGAACACCGTGAAGGATGAG CTCACGAAAGCTTCCTGCTT AAGACGGTGGATTTGAGGTG GGCAAGGGAAAACACCACTA AGGGCGGTCTTTCCAAGTAT...
- 18
- 493
- 0
approaches to visual feature extraction and fire detection based on digital images
... Classification techniques Some popular approaches to the classification of the multidimensional feature vectors obtained from each candidate flame region are Bayes classification and SVM classification ... within a small area since spatial color difference analysis focuses on this characteristic Using range filters, variance/histogram analysis, or spatial wavelet analysis, the spatial color variations ... fire detection at the early state of fire Main question and also be motivation for this research is can vision -based fire detection give a fire alarm as soon as possible at the early state of fire?...
- 27
- 336
- 0
Muscle force estimation and fatigue detection based on sEMG signals
... With his valuable supervision and personal concerns, I had a meaningful and fruitful academic journey I also want to thank Mrs Ooi, Mdm Hamidah and Mr Sakthi, in Control and Mechatronics Lab for ... isometric contraction and varying force contraction Implement the force estimation method and fatigue detection approach in realtime and test with online sEMG signals The CWT -based force estimation ... in Chapter 4, one is based on sEMG-force relationship, and another is based on the CWT and ANN In addition, a novel fatigue detection method will be presented for isometric contractions and force-varying...
- 176
- 361
- 0
Ultra sensitive and selective detection based on oligonucleotide nanoparticle biosensors
... collaborators in the Liu group, Feng Wang, Changlong Jiang, Zhongyu Duan, Qian Zhang, Hong Deng, Sekhar Rout Chandra, Banerjee Debapriya, Ranjit Sadananda, Juan Wang, Wei Xu, Wenhui Zhang, Hongbo Wang, ... 110 5.1 Backgrounds and Motivation 110 5.2 Materials and Methods 111 5.2.1 Reagents and characterization 111 5.2.2 Functionalization of Au nanoparticles and nanogap electrodes ... mismatched target DNA strands (5’GCGACGATCAGCAGTACGCCATGG3’) (b) Au NP assembly with complementary Target (5’ATTAGGCACAGCCGA CTAGCATAT3’) Scale bar: 100 nm .120 Figure 6.1 Typical...
- 159
- 398
- 0
esign and fabrication of polarized ingan light emitting diodes and THz polarizer based on subwavelength metallic nanogratings
... Nd:YAGs are highly linearly polarized Diode lasers are much less and may even be elliptically polarized VCSELs can have very non-classical states, like radial and tangential polarization As a part ... exhibits polarization, while acoustic waves in a gas or liquid not have polarization, since the direction of vibration is same as the direction of propagation By convention, the polarization of light ... has been breathtaking The InGaN material system was developed in the early 1990s and has become commercially available in the late 1990s A name that is closely associated with GaN LEDs and lasers...
- 156
- 222
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25