4 creating a web service client based on an existing soap envelope
Creating a Web Service
... SqlCommand mySqlCommand = mySqlConnection.CreateCommand(); mySqlCommand.CommandText = selectString; SqlDataAdapter mySqlDataAdapter = new SqlDataAdapter(); mySqlDataAdapter.SelectCommand = mySqlCommand; ... mySqlCommand; DataSet myDataSet = new DataSet(); mySqlConnection.Open(); mySqlDataAdapter.Fill(myDataSet, "Customers"); mySqlConnection.Close(); return myDataSet; } Note You'll need to change the ... by your organization The following example sets the namespace for the Web service to http://DbProgramming/NorthwindWebService: [WebService(Namespace="http://DbProgramming/NorthwindWebService")]...
- 5
- 361
- 0
A novel flow battery—A lead acid battery based on an electrolyte with soluble lead pptx
... Fe(III) and Bi(III)) in the electrolyte on the battery performance was also investigated Experimental All solutions were prepared with water from a Whatman Analyst Purifier, methanesulfonic acid (Aldrich) ... had shorted after h when a charge of 216 C cm−2 had passed and it had been dismantled for examination Some deposition of lead had occurred throughout the carbon foam but there was an accumulation ... ligninsulfonate led to a progressive increase in the overpotentials associated with both nucleation and deposition of lead dioxide as well as a slight decrease in charge balance in the deposition and...
- 9
- 625
- 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... organic phase was washed with water, followed by 1N-HCl and again water The organic layer was dried over Na2SO4 and evaporated The resulting residue was chromatographed on silicagel by elution ... (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon ... Hewlett-Packard instrument (series 1050), a linear combination of two analytical 4.6 × 250 mm Buckyprep columns (Nacalai Tesque, Japan) was applied with toluene as eluent The second-stage isolation was...
- 11
- 655
- 0
4 Creating a Configuration and Physical Standby Database by Using Enterprise Manager
... Standby Database Wizard to: – Create a broker configuration – Add a database to a broker configuration • Primary database must be started with an SPFILE 4-5 Copyright © 2006, Oracle All rights ... reserved Creating a Configuration Click “Add Standby Database” to start the wizard 4-6 Copyright © 2006, Oracle All rights reserved Using the Add Standby Database Wizard 4-8 Copyright © 2006, Oracle ... command on the primary database: SQL> ALTER DATABASE FORCE LOGGING; 4-3 Copyright © 2006, Oracle All rights reserved Using Enterprise Manager to Create a Broker Configuration • Use the Add Standby...
- 24
- 397
- 0
Lab 4.1.4 Creating a Network Map using CDP
... labs on configuring serial and Ethernet interfaces and making changes to configurations if you need help b What is the clock rate to be set to and which interface is it set on? ... possible combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN ... type of router as well as how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers...
- 4
- 505
- 0
Registering a Web Service
... email address, name, and phone number Read the Terms Of Use page and click Accept if you want to continue Figure 17.16: The terms of use page Enter your business name and an optional description ... and click Submit to continue Make sure your organization is selected, and click Submit to continue Next, enter the details for your Web service Enter a name for your Web service, along with a ... you create a really useful Web service that you believe other organizations will want to use, you can register your Web service with the production environment Figure 17.12: The UDDI Web Service...
- 5
- 301
- 0
Tài liệu Module 7: Building and Consuming a Web Service That Uses ADO.NET ppt
... the local DataSet with data other than by using a DataAdapter? ! What is the purpose of creating an empty, local instance of a DataSet? ! Why use a strongly typed DataSet? Transition to Practice ... system or programming language Web services can be implemented on any platform and are defined through public standards organizations Sharing data through Web services allows the Web services to ... outputs, and location Example A Web service can provide reusable functionality that many clients can share For example, a challenge faced by e-commerce applications is the need to calculate charges...
- 34
- 583
- 0
Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf
... 24 Activity 4.4: Creating a Future-State Usage Scenario Exercise 1: Creating a Future-State Use Case (30 minutes) ! Create a future-state use case Participate in small groups as assigned ... this space to create the future-state use cases Activity 4.4: Creating a Future-State Usage Scenario Exercise 2: Creating a Future-State Usage Scenario (30 minutes) ! Create a future-state usage ... Ferguson and Bardell, Inc case study Review the current-state use cases and usage scenarios Create future-state use cases for the client billing process by using the current-state use case as a template...
- 4
- 417
- 0
Tài liệu Using a Web Service doc
... customersDataGrid.DataSource = myCustomersService.RetrieveCustomers(whereClauseTextBox.Text); customersDataGrid.DataMember = "Customers"; Note Once again, if your Web service is not deployed on the ... Northwind Web Service You can view the WSDL file for your Web service by clicking the Service Description link, and you can test your Web service by clicking the Retrieve Customers link Click the Add ... on the local computer, then replace localhost in this code with the name of your remote computer This code creates an object named myCustomersService to call your Web service, and displays the...
- 3
- 384
- 0
Tài liệu What Is a Web Service? ppt
... an organization that later became known as the Organization for the Advancement of Structured Information Standards, or OASIS As the shortcomings of the early Web services infrastructure became ... tools that can parse the WSDL for a Web service in a mechanical manner, and then use it to create a proxy object that a client can use to convert method calls into SOAP requests You will this later ... implement varying degrees of security, quality of service, and reliability, and charge the client application accordingly The client application and the Web service can negotiate which level of service...
- 6
- 523
- 0
Tài liệu Updating Server Data Using a Web Service pptx
... table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, ... SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); SqlDataAdapter daOrderDetails = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); ... create a copy of the DataSet containing only the changes This DataSet is passed to the web service instead of the entire DataSet to minimize the bandwidth required to transmit data to the web service...
- 6
- 414
- 0
Tài liệu Using a Web Service as a Data Source pdf
... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable ... Orders", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable);...
- 4
- 369
- 0
Tài liệu Updating Server Data Using a Web Service ppt
... table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, ... SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); SqlDataAdapter daOrderDetails = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); ... create a copy of the DataSet containing only the changes This DataSet is passed to the web service instead of the entire DataSet to minimize the bandwidth required to transmit data to the web service...
- 6
- 318
- 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
... accuracy as the beam is narrowed DARPA Speech and Natural Language Workshop T Briscoe and J Carroll 1993 Generalized LR Parsing of Natural Language (Corpora) with Unification -Based Grammars Computational ... 33rd Annual Acknowledgements 128-135 L Ramshaw and M Marcus 1995 Text Chunking using Transformation -Based Learning Pro- I would like to thank Mitch Marcus, Jason Eisner, Dan Melamed and Adwait Ratnaparkhi ... Dalton, Ga., has annual sales of about $1.18 billion, and has economies o f scale and lower raw-material costs that are expected to boost the profitability o f Armstrong's brands, sold under the Armstrong...
- 8
- 320
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like box (CATAAAA) 270 bp upstream from the ATG translation initiation codon, as found...
- 10
- 451
- 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx
... gold standard) Standard performance indicators for such a task are precision, recall and F-score as measured by the PARSEVAL metrics (Black et al., 1991), with the specific adaptations to the case ... discourse-signaling cuephrases (Oberlander et al., 1999): performance when using the list of cue-phrases alone was substantially lower than n-grams 3.3 E LABORATION © ATTRIBUTION 1C 1A E LABORATION 1A © 1B ... impact of using homogeneous newspaper articles that could carry important biases in prose style and lexical 2.3 Input Data and Feature Extraction Both S and L classifiers are trained using manually...
- 9
- 390
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y:...
- 13
- 456
- 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
... MG, Balasubramanian CK, Behrman AL, Kautz SA: Validation of a speed -based classification system using quantitative measures of walking performance poststroke Neurorehabilitation and Neural Repair ... walking share a similar kinematic pattern: both tasks are cyclical, require reciprocal flexion and extension movements of hip, knee, and ankle, and have an alternating activation of agonist/antagonist ... intervention, thanks to its safety and low price, could really have an impact also as a home-rehabilitation treatment for chronic stroke patients Abbreviations ANOVA: analysis of variance; BF:...
- 13
- 443
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y:...
- 13
- 431
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25