3 a gnb3 c825t and mmp 9 c 1562t polymorphisms in hsc cd34 from peripheral blood of patients with hematological malignancies
Báo cáo y học: "Early Inhibition of NF-κB activation and MMP-9 secretion by plasma of human volunteers after ingestion of maritime pine bark extract (Pycnogenol)" pot
... donate blood samples These blood samples should contain all bioavailable active principles of the extract and allow an ex vivo analysis in all kind of molecular pharmacological effects in cell culture ... metalloproteinase -9 in airway inflammation of patients with acute asthma Clin Exp Allergy 2001, 31 :16 23- 1 630 Kelly EA, Jarjour NN: Role of matrix metalloproteinases in asthma Curr Opin Pulm Med 20 03, 9: 28 -33 ... observed with increasing interest the elucidation of the molecular basis of biological or clinical effects remains a challenge Usually plant extracts comprise of a complex mixture of various components...
- 6
- 313
- 0
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... osteogenic sarcoma, DU 145 prostate carcinoma, CAKI-1 renal cell carcinoma, SKOV -3 ovarian carcinoma, and SW 608 and SW 732 colorectal adenocarcinoma cell lines), we analyzed expression of putative ... putative MDSC-inducing factors was measured in MDSC-inducing (bold) and non-inducing HNSCC cell lines by qRT-PCR Increased CD 33+ MDSC-induction capacity was associated with greater expression of IL-1b, ... exception of breast carcinoma (Table 1) Head and neck, cervical/ovarian, colorectal, and renal cell carcinoma cell lines frequently induced CD 33+ MDSC and are good models for further studies of...
- 20
- 575
- 0
Báo cáo y học: " A comparison of olanzapine and risperidone on the risk of psychiatric hospitalization in the naturalistic treatment of patients with schizophrenia" ppsx
... who account for nearly half of all admissions in NAPHS member hospitals Measures of patient characteristics The BDCF and MRAF provided information on patients' demographic and clinical characteristics ... treatment of schizophrenia: a comparison of costs among Texas Medicaid patients Pharmacoeconomics 20 03, 21:6 83- 697 Santarlasci B, Messori A: Clinical trial response and dropout rates with olanzapine ... inconsistent data, claim duplicates, and unexpected missing values The SCAP database is similar to other administrative and pharmacy claims database, as it provides detailed information about patients' ...
- 11
- 521
- 0
Báo cáo y học: "Food allergy management from the perspective of patients or caregivers, and allergists: a qualitative study" docx
... strategies included: giving patients auto-injector trainers to take home for additional practice and teaching, providing patients with videos on how to use auto-injectors, and practicing auto-injector ... efficiency of clinic visits were: using standardized check boxes in the chart as reminders to ensure all relevant topics are covered, incorporating electronic medical records into the practice, and ... L8N 3Z5, Canada 5Department of Xu et al Allergy, Asthma & Clinical Immunology 2010, 6 :30 http://www.aacijournal.com/content/6/1 /30 Page of Health Policy, Management and Evaluation, Faculty of...
- 5
- 552
- 0
Báo cáo y học: "Proteinase-3 as the major autoantigen of c-ANCA is strongly expressed in lung tissue of patients with Wegener’s granulomatosis" pptx
... PR -3 ‘sense’, 5′-ATCGTGGGCGGGCACGAGGCG (at the beginning of exon 2, corresponding to bases +82 to +101 of the cDNA); and PR -3 ‘antisense’, 5′-GCGGCCAGGGAACGAAAGTGCA (at the end of exon 4, corresponding ... vascular endothelial cells and renal epithelial cells are no longer only innocent bystanders but active participants in inflammatory reactions Available online http://arthritis-research.com/content/4 /3/ 220 ... Nathan CF, Gabay JE: Azurocidin and a homologous serine protease from neutrophils Differential antimicrobial and proteolytical properties J Clin Invest 199 0, 85 :90 4 -91 5 Gabay JE, Scott RW, Campanelli...
- 7
- 370
- 0
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
... designed by Applied Biosystems (Foster City, CA, USA) The forward primer was 5'-CAACTGCTCCAAGGATAGATGATGA -3' and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG -3' The probes were labelled at their ... the OR was calculated assuming one individual did, resulting in a value of 132 . 03, although the relative risk was actually infinite (Table 3) Carriage of the T variant combined with RFs gave the ... http://arthritis-research.com/content/8/1/R 19 in individuals with a combination of the PTPN22 1858T variant and anti-CCP antibodies This relative risk was much higher than with the combination of HLA-SE and anti-CCP antibodies,...
- 6
- 322
- 0
Báo cáo y học: " Cigarette smoking associates with body weight and muscle mass of patients with rheumatoid arthritis: a cross-sectional, observational study" potx
... difference: male: 3. 3, 95 % CI: 0.4 to 6 .3; female: 3. 9, 95 % CI: -0.4 to 8.1) In ANCOVA with gender and smoking as factors and age, DAS28, HAQ score, and disease duration as covariates, smoking was a ... contributions AS-K participated in patient recruitment, data collection and analysis, and the drafting of the manuscript GSM participated in patient recruitment and in data collection and analysis ... analysis VFP and KMJD participated in patient recruitment, rheumatological clinical assessments, and application of diagnostic/classification criteria AMN provided expert statistical advice and supervision...
- 7
- 400
- 0
Anxiety- and depressive-like responses and c-fos activity in preproenkephalin knockout mice: Oversensitivity hypothesis of enkephalin deficit-induced posttraumatic stress disorder ppt
... central nucleus of the amygdala (CeA), and basolateral nucleus of the amygdala (BLA) (p < 0.05) (Fig 7, Table 1) Additionally, activation of the paraventricular hypothalamic nucleus-lateral magnocellular ... involved in the activation of endogenous enkephalins during the reexperiencing of traumatic events and avoidance of traumatic stimuli that characterize PTSD Abbreviations AC: nucleus accumbens; ANOVA: ... Arch Gen Psychiatry 19 93 , 50: 295 -30 5 Rasmusson AM, Charney DS: Animal models of relevance to PTSD Ann N Y Acad Sci 199 7, 821 :33 2 -35 1 10 Harvey BH, Brand L, Jeeva Z, Stein DJ: Cortical/hippocampal...
- 14
- 203
- 0
Báo cáo y học: "The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese cardiovascular center" ppt
... tests of thoracic echocardiography (TTE) and transesophageal echocardiography (TEE) with the gold standards of surgical findings and pathological examination Materials and methods Patients and clinical ... diagnosing RMCT, it is unclear how its accuracy compares with surgical findings and pathological classification of RMCT Therefore, we evaluated echocardiographic, surgical and pathological examinations ... doi:10.1186/17 49- 8 090 -6 -94 Cite this article as: Wu et al.: The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese...
- 7
- 279
- 0
Báo cáo y học: "The impact of provider-initiated (opt-out) HIV testing and counseling of patients with sexually transmitted infection in Cape Town, South Africa: a controlled trial" pot
... testing data were collated from the counseling and Table Baseline comparison of intervention and control clinic demographics and service profile Caseload Intervention clinics (N = 7) Control clinics ... undertook a trial to evaluate the impact of PITC on the testing rates of STI patients, compared to the standard VCT approach at primary care level In order to evaluate PITC in as realistic a context as ... resource-constrained settings will require adaptation to the local context, including a flexible approach to the utilisation of clinical and lay staff Retraining of nurses and lay counselors may also be necessary...
- 11
- 397
- 0
Báo cáo khoa hoc:" Neurohumoral, immunoinflammatory and cardiovascular profile of patients with severe tetanus: a prospective study" docx
... symptomatic period), clinical characteristics, clinical and infectious complications and electrocardiogram (EKG) Evaluation of autonomic profile, catecholamine levels and TNF-α Autonomic instability ... vancomycin penicillin vancomycin cefuroxime penicillin penicillin vancomycin penicillin ofloxa, metro penicillin vancomycin cefipime ampisulbact penicillin ampisulbact ampisulbact vancomycin oxacillin ... may alternate with profound hypotension and bradycardia, suggesting intense sympathetic activity [3, 4] Accordingly, both increased urinary and plasmatic levels of catecholamines have been described...
- 7
- 311
- 0
Báo cáo y học: "A cross-sectional study of patients with and without substance use disorders in Community Mental Health Centres" pdf
... psychiatric in- patients Acta Psychiatr Scand 2000, 102: 432 - 438 12 Gogek EB: Prevalence of substance abuse in psychiatric patients Am J Psychiatry 199 1, 148:1086 13 Harris KM, Edlund MJ: Use of ... JL, Cohen J: The Equivalence of Weighted Kappa and the Intraclass Correlation Coefficient as Measures of Reliability Educational and Psychological Measurement 19 73, 33 :6 13- 6 19 24 SPSS for Windows, ... substance abuse in schizophrenia: demographic and clinical correlates Schizophr Bull 199 0, 16 :31 -56 28 Bonsack C, Camus D, Kaufmann N, Aubert AC, Besson J, Baumann P, Borgeat F, Gillet M, Eap CB:...
- 9
- 599
- 0
báo cáo khoa học: " The impact of provider-initiated (opt-out) HIV testing and counseling of patients with sexually transmitted infection in Cape Town, South Africa: a controlled trial" doc
... testing data were collated from the counseling and Table Baseline comparison of intervention and control clinic demographics and service profile Caseload Intervention clinics (N = 7) Control clinics ... undertook a trial to evaluate the impact of PITC on the testing rates of STI patients, compared to the standard VCT approach at primary care level In order to evaluate PITC in as realistic a context as ... resource-constrained settings will require adaptation to the local context, including a flexible approach to the utilisation of clinical and lay staff Retraining of nurses and lay counselors may also be necessary...
- 11
- 362
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
... methotrexate- and copperchelated antibiotic (Zeocin)-containing medium Methotrexate- and Zeocin-resistant cells were stained with fluorescein isothiocyanate-anti-CD8 and phycoerythrin-anti-CD4, and CD8 ... 35 6428, Seattle, WA 98 195 -6428, USA 3Division of Rheumatology, Department of Medicine, University of California, San Francisco, 533 Parnassus Avenue, Box 0 633 , San Francisco, CA 94 1 43- 0 633 , USA Authors’ ... Page 14 of 14 30 31 32 33 34 35 36 37 38 39 40 41 42 43 transmembrane activator and calcium modulator ligand interactor-Ig in murine systemic lupus erythematosus J Immunol 2004, 1 73: 3524 -35 34...
- 14
- 460
- 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx
... http://arthritis-research.com/content/ 13/ 4/R1 19 Abbreviations ACA: anticentromere antibodies; ACR: American College of Rheumatology; ANA: antinuclear antibodies; GAVE: gastric antral vascular ectasia; ILD: interstitial ... SSc and related conditions even in an unselected population from a rheumatology clinic In cases with atypical SSc, dominance of anti-RNAP I and strong nucleolar staining may be seen The unusual ... Board (IRB) This study meets and is in compliance with all ethical standards in Page of medicine Informed consent, including the publication of the study, was obtained from all patients according...
- 7
- 319
- 0
Báo cáo y học: " Aberrant splicing of the hRasGRP4 transcript and decreased levels of this signaling protein in the peripheral blood mononuclear cells in a subset of patients with rheumatoid arthritis" pdf
... using the forward 5'-AGCATGAACAGAAAAGACAGTAAG -3' and the reverse 5'-TGTCTAGGAATCCGGCTTGGA -3' primers which correspond to nucleotide sequences residing at the translation-initiation and -termination ... that human mast cells arise from a progenitor cell population that is CD34( +), c- kit(+), and expresses aminopeptidase N (CD 13) Blood 199 9, 94 : 233 3- 234 2 29 Akagawa KS: Functional heterogeneity of ... differentiated cells such as macrophage, DCs and osteoclasts, playing pathologic roles in a subset of RA patients Abbreviations BLAST: Basic Local Alignment Search Tool; DAS28: The Disease Activity Score...
- 37
- 421
- 0
Báo cáo y học: "Variations in autologous neutralization and CD4 dependence of b12 resistant HIV-1 clade C env clones obtained at different time points from antiretroviral naïve Indian patients with recent infection" doc
... 5’-CACCGGCTTAGGCATCTCCTATGGCAGGAAGAA -3 as forward and 5’-TATCGGTACCAGTCTTGAGACGCTGCTCCTACTC -3 as reverse primer in the second round by using Platinum Taq proof reading polymerase (Invitrogen Inc.) Plasma ... reverse-transcribed plasma viral RNA was carried out by nested PCR using 5’TAGAGCCCTGGAAGCATCCAGGAAG -3 as forward and 5’-TTGCTACTTGTGATTGCTCCATGT -3 as reverse primer in the first round and 5’-CACCGGCTTAGGCATCTCCTATGGCAGGAAGAA -3 ... NARI-IVC2 PLASMA 465 35 2 29 CCR5 3. J16/B PBMC 466 35 2 27 CCR5 3- 3.J9/F1 PLASMA 4 59 35 2 28 CCR5 3- 5.J25/F2 PLASMA 458 35 2 29 CCR5 3- 5.J38/F2 NARI-IVC3 PLASMA 4 63 352 31 CCR5 CCR5 4.J2/B 462 35 2...
- 15
- 332
- 0
Báo cáo y học: "Resource use and outcome in critically ill patients with hematological malignancy: a retrospective cohort study" pot
... Jarrett A: Intensive care, survival, and expense of treating critically ill cancer patients JAMA 19 93 , 2 69: 7 83- 786 Soares M, Salluh JI, Spector N, Rocco JR: Characteristics and outcomes of cancer ... model was applied including SAPS II and the presence or absence of hematological malignancy as predictors To compare ICU mortality in nononcological patients and in hemato-oncological ICU patients, ... Scand 20 03, 47:508-515 Kongsgaard UE, Meidell NK: Mechanical ventilation in critically ill cancer patients: outcome and utilisation of resources Support Care Cancer 199 9, 7 :95 -99 Hinds CJ, Martin...
- 9
- 192
- 0
Báo cáo y học: "Circulating immune complexes and complement C3 and C4 levels in a selected group of patients with rhinitis in Lebanon" pot
... history, nasal obstruction, rhinorrhea and nasal itchiness Blood was collected from each patient in a plain vacutainer, allowed to clot, the serum separated and stored at -20 C till performance of tests ... to activate the alternate and classical pathways of the complement system [16] Endotoxin is a lipopolysaccharide component of the cell wall of Gram FK was a research assistant He participated in ... presence of CIC and the activation of the complement system in patients with atopic rhinitis Had the results indicated that complement was activated, blocking the complement pathway using agents...
- 4
- 221
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25