3 3 2 format of the data type date and time

Chapter 3 - General Principles of the IMS Architecture pot

... IBCF; see Section 3. 7 .2. ) Figure 3. 3: The IMS-ALG and the TrGW Figure 3. 3 shows the relation of the IMS-ALG with the TrGW and the rest of the IMS nodes The IMS-ALG acts as a SIP B2BUA by maintaining ... migrate the conﬁguration and will locate the P-CSCF and the GGSN in the visited network 3. 4 .2 .3 The I-CSCF The I-CSCF is a SIP proxy located at the edge of an administrative domain The address of the ... establishment) the P-CSCF asserts the identity of the user to the rest of the nodes in the network This way, other nodes not need to further authenticate the user, because they trust the P-CSCF The rest of...

30
442
0

Báo cáo y học: "Association of the microsatellite in the 3'''' untranslated region of the CD154 gene with rheumatoid arthritis in females from a Spanish cohort: a case-control study" ppsx

Danh mục: Báo cáo khoa học

... ± 3. 01 0.018 CD3/CD8a 17 .24 ± 7.66 22 .37 ± 6.67 n.s CD3/CD4a 44.40 ± 14.79 41 .22 ± 13. 11 n.s CD4/CD69b 14.09 ± 19. 02 7.48 ± 10 .25 n.s CD4/CD25b 59.59 ± 18.04 41.19 ± 22 .84 0. 036 CD4/CD154b 4 .28 ... stratification Rheum Dis Clin North Am 20 02, 28 :17 -37 Page of 11 (page number not for citation purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Vol No Martin-Donaire et ... 0 .28 9 3. 03 (1. 72 5 .34 )

11
454
0

The JSP Files (Part 2) - Attack of the Killer Fortune Cookies

Danh mục: Quản trị mạng

... And here's the output: Adding It All Up The JSP Files (part 2) : Attack Of The Killer Fortune Cookies The The The The The sum of 25 and is 30 difference of 25 and is 20 product of 25 and is 125 ... integer And if the two strings are identical, the comparison will return Incidentally, the comparison is based on both the first character of the string, and the number of characters in Flavour Of The ... changing the values of the variables to match each other, and gasp in awe as the output changes In case the equals() method doesn't appeal to you, JSP offers you a choice in the form of the compareTo()...

18
325
0

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Danh mục: Báo cáo khoa học

... (wild -type) (Pyr1)-ONC (M23L) (Met1)-ONC (M23L) a DHTma (kJÆmol)1) DGU (25 °C) (kJÆmol)1) (CGdm/HCl)½b (M) 65.1 (0.4) 58.5 (0 .2) 52. 9 (0.08) 417 (47) 35 5 (29 ) 34 5 ( 32 ) 33 .8 26 .7 23 . 2 4.5 3. 4 ND ... conﬁrmed by the disappearance of the (Met1)-ONC (M23L) signal in the MALDI-TOF mass spectra h after the addition of AAP The pH was adjusted to 2. 5, 8.0 and 11.5 and the samples were incubated at 37 °C, ... other methods for the production and puriﬁcation of the enzyme [ 13] The molecular mass of each puriﬁed product, as measured by MALDI-TOF MS, was 11 947.87 2 for (Met1)-ONC (M23L) and 11 838 .21 ±2...

9
704
0

Báo cáo khoa họcRe-engineering the discrimination between the oxidized coenzymes NAD+ and NADP+ in clostridial glutamate dehydrogenase and a thorough reappraisal of the coenzyme speciﬁcity of the wild-type enzyme docx

Danh mục: Báo cáo khoa học

... ND, not determined NAD+ NADP+ pH Wild -type F 23 8 S P262S F 23 8 S P262S D263K Wild -type F 23 8 S P262S F 23 8 S P262S D263K Wild -type F 23 8 S P262S F 23 8 S P262S D263K kcat (s)1) Km (mM) 6.0 6.0 6.0 6.0 ... 2. 04 0.08 1.04 0 .30 2. 24 0.77 0 .33 6 0.05 0 .22 4 ND ND ND ND 2. 19 0.1 13 0 .37 1 0 .38 2 1.05 2. 70 0. 1 32 0 .33 9 0 .22 9 2. 85 1 73 81.7 125 62 3. 9 69 179 164 175 3. 1 36 .5 the height of this plateau for ... 0.01 2. 21 0.46 22 22 .7 0.5 19.5 1.9 10.0 0.8 20 6 8. 83 0.45 3. 2 0.4 1.65 0.11 3. 1 0 .3 8 .2 E )3 E)4 0. 030 0.001 0 .2 83 1 .3 E )2 0.0 026 0.018 0.091 79 20 0 491 4.9 FEBS Journal 27 8 (20 11) 24 6 024 68...

9
526
0

Báo cáo khoa học: Structural ﬂexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for speciﬁc substrate recognition pptx

Danh mục: Báo cáo khoa học

... Kmrela 2. 99 ± 0 .31 0.454 ± 0.018 0.151 839 5 151 839 .5 3. 07 ± 0. 52 0.467 ± 0. 038 0.1 521 1 73 1 521 17 .3 0.998 10.10 ± 1.67 0. 439 ± 0.111 0.0 434 6 53 434 65 .3 3.49 3. 316 ± 0. 129 0.079 ± 0. 027 0.0 23 8 23 9 23 8 2 .39 ... Wild -type W396A N 435 A S 437 A N 435 A ⁄ S 437 A N 435 A ⁄ S 437 A ⁄ W396A 11. 13 760 .2 2 83. 1 4 12. 9 509.9 1191 kcat (s)1) Km (lM) a ± ± ± ± ± ± 1 .31 0 92. 74 14.91 75.04 48.49 29 9 .2 0.4 73 0. 23 9 0. 435 0 .39 6 0 .36 1 ... Wild -type W396A N 435 A S 437 A N 435 A S 437 A N 435 A ⁄ S 437 A ⁄ W396A 6.61 26 4.5 70 .28 5 73. 8 689.5 28 79 kcat (s)1) Km (lM) a ± ± ± ± ± ± 1 . 32 5 12. 55 0 .28 0 69.50 15 .25 30 3.5 2. 06 0 .28 7 0.1 72 0. 729 0.576...

14
357
0

Báo cáo khoa học: Interaction of the P-type cardiotoxin with phospholipid membranes pptx

Danh mục: Báo cáo khoa học

... c/a of Pam2Gro-PGro MLV with an amount of CTII (L/P and L/2H2O) or buﬀer (L/2H2O) added (A) and the amount of isotropic signal in the 31 P-NMR spectra of Pam2GroPGro/CTII dispersions (B) The experiments ... °C 20 42 P V Dubovskii et al (Eur J Biochem 27 0) Ó FEBS 20 03 Fig Temperature dependence of the 31 P-NMR spectra of Pam2GroPGro (molar ratio of water/Pam2Gro-PGro is 20 0 : 1) in the presence of ... encompassing the gel-to-liquid crystal transition of Pam2Gro-PGro bilayers ( 41 °C), while the L/P ratio varied from to 20 0 In Fig 3, the 31 P-NMR spectra of the MLV of pure Pam2Gro-PGro and in the presence...

9
349
0

Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebraﬁsh (Danio rerio) potx

Danh mục: Báo cáo khoa học

... Otx2 Bmp4 Snap25b Bmp2a 17 17 17 17 17 17 17 17 17 FABP7 MACS GNMT PAX9 FAXA1 OTX2 BMP4 SNAP25 BMP2 q 22- q 23 q 22. 2 p 12 14 q 12- q 13 14 q 12- q 13 14 q21-q 22 14 q 22- q 23 20 p 12- p11 .2 20 p 12 Fabp7 Macs ... Gnmt Pax9 Faxa1 Otx2 Bmp4 Snap25 Bmp2 10 10 22 cM 17 12 26 cM 12 26 cM 14 19 cM 14 15 cM 78 .2 cM 76.1 cM 40.9 cM 40.9 cM 57 .2- 62. 1 cM 37 .2- 49.8 37 .2- 49.8 cM 54 .3- 56 .2 cM 67.7 cM 73. 7 cM 18.4 cM a ... 5¢-TGCGCACATACGA GAAGGC -3 ; nucleotides 21 08 21 27; reverse: 5¢-CAC CACCATCCATCATTGAC -3 ; nucleotides 23 1 0 22 91, (Fig 1)] which amplify part of the coding and 3 UTR sequence of the fourth exon of the zebraﬁsh...

11
366
0

Báo cáo khoa học: Structure, linkage mapping and expression of the heart-type fatty acid-binding protein gene (fabp3 ) from zebraﬁsh (Danio rerio) pot

Danh mục: Báo cáo khoa học

... & Wright, J.M (20 02) Cellular retinol-binding protein type II (CRBPII) in adult zebraﬁsh (Danio rerio) cDNA sequence, tissue- 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 32 34 R.-Z Liu et ... 19 19 19 FABP3 OPRD1 RPL11 FUCA1 MYCL1 IFL2 BING1 DAXX PSMB9 RXRB 1p 33- p 32 1p36.1-p34 .3 1p36.1 -35 1p34 1p34 .3 1q21.1 6p21 .3 6p21 .3 6p21 .3 6p21 .3 Fabp3 Oprd1 Rpl11 Fuca1 Mycl1 I 2 Bing1 Daxx Psmb9 ... abundant in the oocytes of mouse [ 32 ] and Xenopus [33 ] Fabp3 might be one of the targeted genes of YY1 in zebraﬁsh oocytes Two additional types of cis elements for the transcription factors E2F and GATA-2...

12
505
0

Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx

Danh mục: Điện - Điện tử

... 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 3 13 82 736 84.0 7.44 84 105 23 0 4 13 83 736 83. 3 6.98 85 1 02 23 0 4 13 83 736 83. 2 6.89 85 101 23 0 4 13 83 736 83. 2 7.10 84 1 03 23 0 4 13 83 736 83. 3 7.09 84 1 03 23 0 4 ... 23 0 4 13 83 736 83. 4 6.98 85 1 02 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 4 13 83 736 83. 5 6.96 84 100 23 0 4 13 83 736 83. 2 6.89 85 101 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 4 13 83 736 83. 3 7.09 84 1 03 23 0 4 ... GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 23 0 4 23 0 4 23 0 3 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 Figure Sequences near the 5' (A) and 3' (B) ends of the M1 plus strands of 14 reovirus isolates Sequences near the 5'...

17
379
0

báo cáo hóa học:" Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" doc

Danh mục: Hóa học - Dầu khí

... 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 3 13 82 736 84.0 7.44 84 105 23 0 4 13 83 736 83. 3 6.98 85 1 02 23 0 4 13 83 736 83. 2 6.89 85 101 23 0 4 13 83 736 83. 2 7.10 84 1 03 23 0 4 13 83 736 83. 3 7.09 84 1 03 23 0 4 ... 23 0 4 13 83 736 83. 4 6.98 85 1 02 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 4 13 83 736 83. 5 6.96 84 100 23 0 4 13 83 736 83. 2 6.89 85 101 23 0 4 13 83 736 83. 3 6. 92 85 1 02 23 0 4 13 83 736 83. 3 7.09 84 1 03 23 0 4 ... GCGUGAUCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 23 0 4 23 0 4 23 0 3 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 23 0 4 Figure Sequences near the 5' (A) and 3' (B) ends of the M1 plus strands of 14 reovirus isolates Sequences near the 5'...

17
282
0

Báo cáo hóa học: " New potential antitumoral fluorescent tetracyclic thieno[3,2-b]pyridine derivatives: interaction with DNA and nanosized liposomes" pptx

Danh mục: Hóa học - Dầu khí

... (0. 93) ; 30 5 (0.97); 25 9 (2. 70) 410 sh (0.55); 35 7 (4 .37 ); 31 1 (2. 28); 29 0 (2. 29); 2 73 (2. 78) 408; 429 427 ; 448 0 .26 0. 022 Acetonitrile 39 5 (0.68); 37 6 (1.06); 35 8 (1.06); 30 4 (1.09); 25 6 (3. 32) ... (2. 80); 27 2 (3. 41) 4 13; 433 4 53 0 .26 0.040 Water 39 4 (0.41); 37 4 (0.57); 36 1 (0.58); 30 3 (0. 93) ; 25 6 (2. 07) 420 sh (0 .26 ); 35 8 (0.87); 31 4 (0.94); 27 8 (0.97) 4 13 sh; 433 505 0 .22 0.0 12 Solvent cut-offs: ... 39 8 (0.84); 37 7 (1 .24 ); 36 0 (1 .27 ); 30 5 (0.95); 25 8 (3. 93) 411 sh (0 .33 ); 35 4 (2. 19); 34 7 (2 .37 ); 30 8 (1 .25 ); 29 1 (1. 12) ; 27 0 (1.40) 4 02; 426 ; 4 52 sh 417; 441 0 .20 0.047 Dioxane 39 8 (0.76); 37 7...

8
286
0

Báo cáo hóa học: " Research Article Cauchy Means of the Popoviciu Type" pot

Danh mục: Hóa học - Dầu khí

... where r s u2 ϕs x 2uwϕr x w2 ϕt x , 2 .3 t /2, ϕs is deﬁned by 1. 13 and u, w ∈ R We have ω x u2 xs 2 uxs /2 1 2uwxr 2 wxt /2 1 w2 xt 2 2.4 > 0, x > Journal of Inequalities and Applications Therefore, ... a2 − μas dx − 3/ 2 ν b2 log b − a2 log a ν /2 b2 log b − a2 log a − ν/4 b2 − a2 − μas − as log f x dx − 2 log a − 2 b log b − a log a 2 a log a ν b2 log b−a2 log a − ν /2 b2 − a2 2 M1,0 f log ... a b ba b−a 2 a − f x dx By combining 3. 4 and 3. 5 and using the fact that for m ≤ ρ ≤ M there exists ξ ∈ I1 such ρ we get 3. 2 that h ξ Theorem 3. 3 Let k, l ∈ C2 I1 and satisfy 3. 2 , f be a continuous,...

16
170
0

Báo cáo hóa học: "Research Article Some Multiplicative Inequalities for Inner Products and of the Carlson Type" doc

Danh mục: Hóa học - Dầu khí

... ∈ L2 Ω, dμ w L2 Ω, dμ and |λ |2 w1 w 2 1/|λ |2 w2 > 0, where p ± pi, λ p2 Ω 1 /2 w2 x f x dμ w2 x f x dμ Ω 3. 2 Then Ω dμ f x dμ ≤ Ω λw1 x 1/λ w2 x Ω w1 x f x dμ Ω w2 x f x dμ 3. 3 Proof In the ... proof of Lemma 2. 1 we ﬁnd that λ p ± pi, where p2 1 /2 w2 x |f x |2 dμ/ Ω w1 x |f x |2 dμ fulﬁlls the conditions of Theorem 2 .3, so the Ω inequality 3. 3 follows from the inequality 2. 1 by taking ... ⎟ ⎠ ∞ 2 w2 x f x dx a ∞ dx a x f x 2 2 w2 x f x dx 3. 4 Journal of Inequalities and Applications Remark 3. 3 For the special case when a ∞ f x dx ∞ ≤ 2 0 0, w2 0, and m 2 w1 x f x ∞ 1, the inequality...

7
291
0

Báo cáo hóa học: " STRONG CONVERGENCE BOUNDS OF THE HILL-TYPE ESTIMATOR UNDER SECOND-ORDER REGULARLY VARYING CONDITIONS" docx

Danh mục: Báo cáo khoa học

... pp 21 35 [4] P Deheuvels and D M Mason, The asymptotic behavior of sums of exponential extreme values, Bulletin des Sciences Mathematiques, Series 1 12 (1988), no 2, 21 1– 23 3 [5] A L M Dekkers and ... k(n) − k(n) − k(n)logYn−k(n),n ≤ √ 2+ 1 γ (2. 15) almost surely The result of the theorem follows by combining (2. 13) – (2. 15) Now, we provide an analogue of Theorem 2. 5 when U(tx)/U(t) converges to ... that of Theorem 2. 5 Theorem 2. 6 If (2. 16) holds with k(n) and A(n/k(n)) satisfying k(n)/n ∼ βn ↓ and k(n)/(2loglog n) A(n/k(n)) → β ∈ [0, ∞) as n → ∞ then limsup ± n→∞ √ k(n) Hn − γ ≤ + γ 2loglog...

7
171
0

Chemistry of the lichen type common in southern Vietnam pptx

Danh mục: Báo cáo khoa học

... 159 .2 33 .3 26 .5 31 .2 22. 4 14.0 42. 6 20 7.1 42. 1 23 . 4 31 .1 22 .4 14.0 3. 88 s 6. 52 s 3. 82 s 56.5 96.4 154.1 56.1 134 .8 129 .7 167 .3 52. 1 6.09 s 1 02. 7 3. 78 s 2. 47 1.70 1 .36 1 .36 0.91 3. 68 3. 86 2 . 32 2 .36 ... CD3OD 20 1 12. 5 1 62. 1 106.5 161.4 21 a 1 02. 2 1 62. 2 1 02. 0 166.1 117.7 141.0 1 62. 4 104.9 160 .2 107.7 150.4 139 .8 129 .8 168 .2 48.1 20 9.7 42. 8 23 . 2 31 .3 22 .4 13. 9 33 .3 104 .2 33 .6 18.1 31 .7 68.9 21 .5 ... 156.8 133 .9 131 .1 168.4 1 03. 3 159.5 33 .3 26 .5 31 .2 22. 4 14.0 34 .3 1 03. 6 33 .6 18.0 31 .8 68.7 21 .5 -22 - 24 1 12. 9 1 62. 1 106 .3 161 .2 25 1 13. 4 1 62. 1 106.1 160.8 117.7 141.0 1 62 .3 104.9 160 .2 108.0...

147
418
0

the study the reality of practicing listening skill of the third year major english students at dong thap university basing on the format of the ielts listening tests

Danh mục: Báo cáo khoa học

... 2. 2.1 Requirements vi 2. 2 .2 Situation types 2. 2 .3 Question types 2 .3 Format of IELTS Listening 2 .3. 1 Section 2 .3. 2 Section 2 .3. 3 ... thesis 31 Limitations of the thesis 31 Suggestions 32 3. 1 Further research 32 3. 2 Practicing listening skill 32 REFERENCES 34 APPENDIX ... minutes There will be time to read the questions during the test and time to transfer their answers on to the answer sheet at the end of the test The level of difficulty of the texts and tasks...

58
836
0

BỆNH TUYẾN YÊN – PHẦN 2 (Diseases of the pituitary) pdf

Danh mục: Cao đẳng - Đại học

... (0,1ml)  12h mũi 15g (0,15ml)  16h - Diapid 185g/ml Tiêm da tĩnh mạch 20 g (0,2ml)  16h (50 USP) 2- 4g  - 6h - Pitressin Tiêm da 50g (20 UI/ml) 0,5g  10 h 2, 0g  18 h 4,0g  22 h 12, 5g ... 4h Thuốc hormon: Chlopropamid Uống 100 -25 0mg/viên 20 0 - 500mg  12- Clofibrate Uống 500mg/nang Carbamazepine Uống 20 0mg/viên 24 h 500mg  24 h 400 - 600mg  24 h ... thường bệnh nhân với type đái tháo nhạt + Type 1: áp lực thẩm thấu huyết tương tăng, áp lực thẩm thấu niệu tăng ít, biểu tăng tiết ADH trình truyền muối ưu trương + Type 2: tăng đột ngột áp lực...

24
350
0

Báo cáo toán học: " Short and Easy Computer Proofs of the Rogers-Ramanujan Identities and of Identities of Similar Type" pdf

Danh mục: Báo cáo khoa học

... = and n → 2n − 1, or, α = −1 and n → 2n in the theorem of [2] , cf also (3. 10) and (3. 12) in Andrews [8].) As pointed out by Andrews [2] , this ﬁnite version of (1) has its origin in the work of ... −q 2n+2a−1 [n − k] [n + k + a] (17) and certR(a) (n, k) = −q 2n +20 k+6(a+1) [n − 5k − 4][n − 5k − 3] [n − 5k − 2] [n − 5k − 1][n − 5k] [10k + 2a + 2] [2n + 2a − 2] [2n + 2a − 1][2n + 2a][2n + 2a ... k=− (n+2a +2) /5 2n + 2a + [10k + 2a + 2] (14) n − 5k [2n + 2a + 2] Proof: Denote the left hand side of (14) by L(a) (n), the right hand side by R(a) (n) In view of L(a) (0) = R(a) (0) = and L(a)...

9
343
2

Báo cáo y học: " Antigenic analysis of classical swine fever virus E2 glycoprotein using pig antibodies identifies residues contributing to antigenic variation of the vaccine C-strain and group 2 strains circulating in China" ppt

Danh mục: Báo cáo khoa học

... C-E2-f 5-TTTGGATCCGCCACCATGGTATTAA GGGGA CAGATCG 5-ATTCTCGAGTCAACCAGCGGCGA GTTGTTCTG 24 42- 2465 C-E2-r 28 04 -28 16 Vaccine C-strain 24 42- 2456 29 55 -29 69 Full-size E2 23 7 9- 23 9 7 Full-size E2 35 41 -35 60 ... serum [24 ] The other protein, rE2-AD (aa 690-865), contained both antigenic units B/C and A/ D [22 , 23 ] Western blotting indicated that rE2-BC and rE2-AD proteins of the vaccine C-strain had the ... 1.1 AY259 122 A D E L G N D N S V LPC China 1.1 AY 526 7 32 A D E L G T D N T GXBB1 China 2. 1 AY45 027 2 T N E P E N G D 83- s106 China 2. 1 AY 526 727 S N E P E N G Paderborn GXNN1 Germany China 2. 1 2. 1...

14
626
0