2the immune response to allergens is regulated by t cells
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt
... participates in the targeting [37] Therefore, the participation of LBR in the targeting of nuclear membranes to chromatin may vary a little from system to system and/or LBR acts together with other ... whereas it was suppressed by that with a mitotic phase extract (Fig 5) The binding of chromatin to LBR fragments on beads could be estimated semiquantitatively by this method The effects of enzymes, ... separated into cytosol, membrane and gelatinous pellet fractions by ultracentrifugation at 200 000 g for h in an RP55S rotor (Hitachi, Tokyo) The cytosol fraction was then re-centrifuged at 200...
- 11
- 563
- 0
Báo cáo y học: " Immune response to allergens in sheep sensitized to house dust mite" potx
... to control sheep (Fig 5) Dermal tissue sections stained for mast cell tryptase showed positive staining of mast cells throughout the dermis, with mast cells distributed sporadically in the stroma ... p proteolytic activity is thought to be a major contributor to its allergenicity Some of the reported actions of Der p include direct immunomodulatory effects through cleavage/down-regulation ... post-challenge, with the appearance of a DTH reaction to HDM and Der p The skin DTH observations were supported histologically with the recruitment of eosinophils into the dermis, a characteristic feature...
- 11
- 323
- 0
Báo cáo y học: "Modulation of humoral immune response to oral BCG vaccination by Mycobacterium bovis BCG Moreau Rio de Janeiro (RDJ) in healthy adults" ppsx
... "home" to lymphoid tissue at distant sites in gastrointestinal, respiratory, genitourinary and other mucosa-associated regions [17] In this context, the objective of this study was to analyse humoral ... Humoral response (ELISpot) Using the ELISpot technique it was possible to observe the quantity and isotype of antibody production by plasmablasts in response to oral immunisation with M bovis BCG ... that tuberculosis affects an important mucosal site, the respiratory tract, the potential use of oral booster vaccination in immunisation programmes is of interest Subjects who were not boosted...
- 6
- 302
- 0
Báo cáo y học: "Celastrus aculeatus Merr. suppresses the induction and progression of autoimmune arthritis by modulating immune response to heat-shock protein 65" pptx
... setting, and that this beneficial anti-arthritic effect of Celastrus is attributable in part to modulation both of the immune response to the disease-related antigen Bhsp65 [22-25] and one of the ... response to an anti-inflammatory type [26] This relative deviation of the cytokine response, caused either by decreased Th1-type cytokines and/or by enhanced Th2-type cytokines leading to the regression ... patients, it is critical that a potentially beneficial anti-arthritic product displays not only a preventive effect but also a therapeutic effect by suppressing ongoing (established) arthritis In this...
- 10
- 363
- 0
báo cáo khoa học: " Systemic acquired resistance in soybean is regulated by two proteins, Orthologous to Arabidopsis NPR1" ppt
... Reverse transcription (RT) was conducted using an oligo-dT primer (TTTTTTTTTTTTTTTTT) and M-MLV reverse transcriptase (Life Technologies, Rockville, MD) A touchdown program used for PCR amplification ... NPR1 protein interacts with TGA transcription factors in the nucleus to activate the expression of PR1 [34] Transportation of the NPR1 protein into nucleus is stimulated by SAR inducer [16] The Arabidopsis ... citation purposes) BMC Plant Biology 2009, 9:105 1_Reverse: CCAGCAAACTCAGATGTTGTCTCAGCATG and GmNPR1-2_Forward: GATGCTGACATCGTTGTGGAGGGAATTT, GmNPR1-2_Reverse: CCAGCAAACTCAGATGTTGTCTCAGCATG)...
- 14
- 189
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
... receptor type 2C [18,27] and the GABAB receptor [19] We postulated that MUPP1 could directly interact with the olfactory receptor itself We scanned the entire human olfactory receptor repertoire ... investigated We furthermore investigated the binding determinants in the C-terminus of hOR2AG1 by spotting peptides that correspond to mutated or shortened receptor C-termini Truncation of the ... MUPP1 and failed to interact with truncated mutant (Fig 3C) 7284 Consistent with this observation is the fact that other olfactory receptors showing interactions with PDZ domains + (hOR1D2, hOR3A1)...
- 12
- 543
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... component TFIID to DNA nucleates the transcription, whereas TFIIIB is normally recruited to the initiation site via interactions of one of its protein subunits with TFIIIC which is already bound to the ... supplementation of TFIIIB These observaGly tions lend support to the concept that tRNA1 -1 had a greater affinity for the transcription factor To confirm that the component responsible for sequestration ... due to sequestration of the whole TFIIIB rather than the TBP component alone We infer, therefore, that both weak binding to TFIIIB and the sequestration of TFIIIB contributed to lower transcription...
- 15
- 484
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... were the luciferase gene internal primer 5¢-GGCGTCTTCCATTTTACC-3¢ and the oligonucleotide 5¢-CCGTCGACATTAATTTAATTT ccccAATTATATTGCGTCG-3¢ in which the SalI recognition site is in bold and the ... on the promoter context (Fig 5) In contrast, cotransfection of the GAGA factor stimulated the activity of the constructs containing the 56 bp activator region linked to both heterologous promoters ... reporter gene is shown as a solid arrow The numbers to the left of each construct indicate the limit of the promoter fragment with reference to the transcription start point as established in this...
- 11
- 532
- 0
Báo cáo khoa học: Kinetics of violaxanthin de-epoxidation by violaxanthin de-epoxidase, a xanthophyll cycle enzyme, is regulated by membrane fluidity in model lipid bilayers pptx
... violaxanthin to antheraxanthin is much slower and more sensitive to temperature than transition from the antheraxanthin to zeaxanthin On the basis of our results and literature data [15,22], we postulate ... violaxanthin to antheraxanthin is more sensitive to monogalactosyldiacylglycerol concentration than the conversion of antheraxanthin to zeaxanthin is supported by relatively high value of the AZ0 ... in contrast to the de-epoxidation of violaxanthin to antheraxanthin, the conversion of antheraxanthin to zeaxanthin seems to be not limited by diffusion process The conclusion that the conversion...
- 10
- 419
- 0
Báo cáo khoa học: Chinese hamster apurinic⁄apyrimidinic endonuclease (chAPE1) expressed in sf9 cells reveals that its endonuclease activity is regulated by phosphorylation docx
... several time points (A) APE catalytic activity was shown at the designated time points of the reaction The top bands are the substrate and the bottom bands are the product (B) The batches at the ... at time point t, [So] is the initial (or total) substrate concentration The quantitation proceeded through measuring the intensity of both bands and normalizing them by adding both bands and taking ... accurate analytical tool We were fortunate to have access to state of the art equipment, an ICP spectrometer, an instrument with pico to nanomolar sensitivity in measuring trace elements from...
- 9
- 318
- 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx
... 5¢-CTTGATCAGTGCTCGGGAATG-3¢); PIASxa (sense, 5¢-TGCACCTCATTCACCGTCAT-3¢ and antisense, 5¢-CTCAAACGTGGGCTTAGTGTCTT-3¢); PIASxb (sense, 5¢-CCTTCTACTTCCATTGCACCTCAT-3¢ and antisense, 5¢-AAACGTGGGCTTAGTGTCTTGAA-3¢); ... 5¢-GAGAATCCAGCTTCTTTCCC-3¢ and antisense, 5¢-GGCGACACTGTATGAATTGC-3¢); SENP2 (sense, 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢); SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ ... wild-type (Fig 2) This result is consistent with the earlier notion that sumoylation mutants have higher transcriptional activities [32,33] These results suggest that the region around the SUMO...
- 12
- 443
- 0
Báo cáo khoa học: Subunit S5a of the 26S proteasome is regulated by antiapoptotic signals pot
... 5¢-CCGGAATCGACACAGCACTTTGCT AGGTTCCTCC-3¢, antisense 5¢-AGCTATGGAGGAACC TAGCAAAGTGCTGTGTCG-3¢) substitution of nucleotides )242 to )240 CAA to GCT The wild-type and mutated Lef-1 binding sites are underlined The ... Analysis of the sequence for transcription factors binding sites (using matinspector, at GenomatixSuite, http://www.genomatix.de/products/MatInspector/ MatInspector2.html) led to the identification ... the decreased levels, and therefore rescue these cells from apoptosis It is likely therefore that Src and perhaps other antiapoptotic proteins, confer their antiapoptotic effect by inducing the...
- 17
- 321
- 0
Báo cáo khoa học: A novel glycogen-targeting subunit of protein phosphatase 1 that is regulated by insulin and shows differential tissue distribution in humans and rodents pdf
... motif that mediates interaction with PP1, as well as putative modules for targeting to glycogen and facilitating interaction with PP1 substrates such as GS Here we show that the phosphatase activity ... that R3E does indeed interact with PP1c and suggests that the interaction of R3E with PP1 inhibits its activity substantially with phosphorylase a as a substrate (Fig 5B) In contrast, the activity ... identity to any of the other glycogen-targeting subunits, but is highly conserved from rodents to humans (> 86% identity), suggesting that it may serve an important nonredundant function The...
- 12
- 381
- 0
báo cáo hóa học: " Wallerian degeneration: the innate-immune response to traumatic nerve injury" potx
... events of Wallerian degeneration that injury induces distal to the lesion site, the domain through which severed axons regenerate back to their target tissues Innate-immunity is central to Wallerian ... recruitment of macrophages, phagocytosis of degenerated myelin, and production of cytokines and chemokines) Special attention is given to the orchestration of these events with respect to their timing ... binding sites on myelin Altogether, CR3 contributes to folds more to myelin phagocytosis than SRA Apart from complement, inflammatory cytokines TNFa (tumor necrosis factor-a) and IL (interleukin)-1b,...
- 15
- 353
- 0
báo cáo hóa học: " Increased circulating leukocyte numbers and altered macrophage phenotype correlate with the altered immune response to brain injury in metallothionein (MT) -I/II null mutant mice" doc
... GAPDH TCTGTGGTGTTCTTCGTTGC ACAATTTAGGAGGTGCCGTG Rev MT-I Fwd NM_021283.2 CCAGCTGGTACAGCAGACAA Fwd GCTGTCCTCTAAGCGTCACC Rev MT-II NM_008337.3 NM_009892.2 AGGAGCAGCAGCTCTTCTTG Fwd CAAACCGATCTCTCGTCGAT ... to M Cozens for assistance with flow cytometry Thanks also to S Ray and C Butler for their assistance in collection of animal tissues Thank you to K Lewis for assistance with immunostaining This ... injured patients despite the fact that MTI/II protein has no secretory signal sequence [35] However, the concentration of MT-I/II required to modulate the activity of immune cells in vitro is often...
- 11
- 460
- 0
Báo cáo y học: " Characterisation of the immune response to type I collagen in scleroderma" pps
... Arthritis Research & Therapy Vol No Warrington et al implies that the putative driving antigen is persistently present and widely distributed [11] Putative antigens in SSc include DNA topoisomerase ... of 19 healthy individuals demonstrated significant T- cell proliferation to CI, and none of the patients with rheumatoid arthritis reacted to CI in vitro Available online http://arthritis-research.com/content/8/4/R136 ... in agreement with the work of Goldstein et al demonstrating that CD49a+ T cells are a subset of Th1-polarised memory T cells that proliferate in response to recall antigens [33] The cytokine profile...
- 9
- 341
- 0
Báo cáo khoa học: "Tumor response to radiotherapy is dependent on genotype-associated mechanisms in vitro and in vivo" ppsx
... dotted line representing the response of the tumors that did regrow but constituted less than half the total tumors in the cohort To indicate the effect of dichotomous response, wherein all tumors ... and total dose as indicated by subscripts Calculating coefficients that relate tumor response and total dose on the basis of phenotype We calculated the coefficient τ in equation as totalcells-killed ... genotypes that segregate with tumor radiosensitivity Critical to interpreting our data is confidence that xenograft tumors reflect relevant properties of cellular radiosensitivity Xenograft tumors...
- 14
- 428
- 0
báo cáo khoa học: " Response to dexamethasone is glucose-sensitive in multiple myeloma cell lines" pps
... cells and compared to mM as baseline glucose in those cells independently from TXNIP expression We then decided to test the hypothesis of TXNIP-independent effect by assessing the cytotoxicity ... directly by DEX activates the TRX system to scavenger the excess of ROS that would have otherwise occurred, particularly when TXNIP is downregulated Obviously, this point needs to be proven in future ... glucose metabolism to lactate in conditions of hypoxia [17] We have shown that the shift to lactate metabolism in excess of glucose is associated with increased levels of TXNIP protein that increases...
- 7
- 229
- 0
Báo cáo y học: "Assessment of immune response to repeat stimulation with BCG vaccine using in vitro PBMC model" pdf
... 8:3 http://www.jibtherapies.com/content/8/1/3 Page of tion at room temperature, supernatant followed by biotin-conjugated anti-cytokine antibody was added to the coated wells After another two ... models with respect to repeat BCG vaccination Competing interests The authors declare that they have no competing interests Authors' contributions RSK carried out the study planning, data collection, ... collection, statistical analysis, data interpretation, literature search and manuscript preparation AAH participated in the literature search, preparation of the manuscript and data interpretation SHM...
- 7
- 300
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose