2 enter source document data in a chronological journal data entry on the computer
Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot
... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes The following primers were used: bcl -2 forward 5’-GTGAACTGGGGGAGGATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’; GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and ... procedures involving animals and their care were approved by the responsible for the Animal Facility at the Regina Elena Cancer Institute and were conducted in accordance with institutional guidelines, ... evaluated the therapeutic efficacy of a multicomponent strategy based on Spugnini et al Journal of Translational Medicine 20 11, 9: 125 http://www.translational-medicine.com/content/9/1/ 125 Page...
- 10
- 483
- 0
báo cáo hóa học:" Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" ppt
... glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes The following primers were used: bcl -2 forward 5’-GTGAACTGGGGGAGGATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’; GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and ... procedures involving animals and their care were approved by the responsible for the Animal Facility at the Regina Elena Cancer Institute and were conducted in accordance with institutional guidelines, ... evaluated the therapeutic efficacy of a multicomponent strategy based on Spugnini et al Journal of Translational Medicine 20 11, 9: 125 http://www.translational-medicine.com/content/9/1/ 125 Page...
- 10
- 474
- 0
Báo cáo sinh học: "Effects of data structure on the estimation of covariance functions to describe genotype by environment interactions in a reaction norm model" potx
... be partly solved by calculating EP based on for instance 50 animals that calved consecutively in one herd, rather than based on herd-year Changing the data structure from the default situation ... 0.7830. 020 0. 628 0. 029 0.9 120 .005 b b a Standard deviations are given as a subscript Environmental parameters used in models and are calculated in the same way, leading to the same correlation between ... functions modelling reaction norms 495 and slope on the diagonal and covariances between those on the off-diagonals The estimated genetic variance in an environment with EP equal to EP1 was calculated...
- 19
- 260
- 0
lab meetings accordion lite 1 PDF 2 27 15 evaluating classifiers in a bag of visual words classification
... testing data Subsequently, we have trained models for each category using the machine learning approaches presented in Section Each model was trained in a binary setting taking the training images ... Duchesnay Scikit-learn: Machine Learning in Python Journal of Machine Learning Research, 12: 2 825 28 30, 20 12 [20 ] F Perronnin and C Dance Fisher Kernels on Visual Vocabularies for Image Categorization ... variance data such as BoVW models While in general the classification performance based on comparatively few training data points varies strongly a few outliers featuring considerably high mAP...
- 8
- 420
- 0
Slides 2 2 determine unit of measure in a multivariate equat
... expression have the same unit of measure, they may be added together • Example: Smoky Mountain Inn Depreciation on building Maintenance person’s salary Cleaning person’s salary Real estate taxes ... for the unknown • The beginning balance on your credit card is $950 During the month you charge $300 and make a payment of $ 325 At the end of the month your balance is $940 What was the finance ... for the unknown • The beginning balance on your credit card is $950 During the month you charge $300 and make a payment of $ 325 At the end of the month your balance is $940 What was the finance...
- 41
- 115
- 0
A study of opening conversation on the phone in english and vietnamese
... quantitative and qualitative methods in which qualitative one takes questionnaire These questions are concerned about factors such as: priority so as to analyze data and make them more reliable Data ... questionnaire Usually after the identification, there comes a self-naming as an • Analyzing to compare telephone conversation openings in introduction 4.1.1 .2 Interrogatives English and Vietnamese ... Telephone Conversation Openings Gender, Age and Interlocutor’s Relationship factors affect on the use of telephone conversation openings [31], [24 ], [10], [21 ] Organization of Conversation [23 ], [25 ],...
- 13
- 1,052
- 2
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... glycosylation and that the thermodynamic stability of the conjugates was increased with increasing glycosylation [36,37] Changes in a- CT’s structural dynamics upon chemical glycosylation Determination ... enzyme acylation (k2) and deacylation (k3) are reduced by chemical glycosylation, also as a function of the glycan molar content of the conjugates (Table 4) In contrast, the substrate binding step ... conjugates there was also an increase in these internal hydrogen bonds formed due to glycosylation (Table S2) However, they are too small to sustain the observed changes in the bond and angle parameters...
- 17
- 531
- 0
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... 5’-GGAATTCCATATGCAACT CAAAGATGCCAAGCTG)3’ and 5’-CCCAAGCTTGA TACCGCCCAGGCAGAGGTACTTG-3’ The primers used for the PCR cloning of PA 026 6 were as follows: 5’-GGAATTCCATATGAGCAAGACCAACG AATCCC-3’ and 5’-CCGCTCGAGAGCGAGTTCGTCG ... cadaverine, 1-piperideine and 5-amino pentanoate have not been assigned an EC number in the International FEBS Journal 27 4 (20 07) 22 62 22 73 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 22 65 ... of PA 026 6 and PA 026 5 (a) , PA 026 6 (b), PA 026 5 (c), or in the absence of the enzymes (d) FEBS Journal 27 4 (20 07) 22 62 22 73 ª 20 07 The Authors Journal compilation ª 20 07 FEBS Y Yamanishi et al pathways...
- 12
- 441
- 0
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... separation w = π A multi-valued minimal graph is a multi-valued graph of a function u satisfying the minimal surface equation GRAPHICAL OFF THE AXIS 29 x3 -axis One half rotation Figure 2: The ... − |A |2 |∇w |2 (II .2. 9) ≥ 2 |∇w|4 − |A |2 |∇w |2 − | A |2 Since the Jacobi equation is the linearization of the minimal graph equation over Σ, analogs of (II .2. 8) and (II .2. 9) hold for solutions ... get a solution < u < δp R2 of the minimal graph equation on an Ng -valued graph over DeNg R2 \ De−Ng R2 Applying Proposition II .2. 12 to u gives the last claim The next lemma uses the Harnack inequality...
- 43
- 410
- 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... These included the insects D melanogaster (AAB6 021 7), A gambiae (EAA0 626 4), A aegypti (AAK15810), S invicta (AAP 924 50) and P americana (BAC 027 25), and the vertebrates Anguila japonica (BAB64337), ... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... developmental stages using the General Elute Mammalian TotalRNA kit (Sigma, Madrid, Spain) A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madison, WI, USA) and reverse transcribed...
- 11
- 414
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG GCCGGGATCCTAGGGCGAATTGGGTACC Ó FEBS 20 04 Analysis of the N-myristoylation ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC ... AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC...
- 12
- 512
- 0
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... war1- 42 MATa ura3- 52 his3-D200 leu2-D1 MATa ura3- 52 his3-D200 MATa ura3- 52 his3-D200 leu2-D1 trp1-D63 MATa ura3- 52 his3-D200 leu2-D1 trp1-D63 Dpdr 12: :hisG MATa ura3- 52 his3-D200 leu2-D1 Dpdr 12: :hisG ... MATa ura3- 52 his3-D200 leu2-D1 Dazr1::kanMX4 MATa ura3- 52 his3-D200 leu2-D1 Dpdr 12: :hisG, Dazr1::kanMX4 MATa ura3- 52 his3-D200 leu2-D1 trp1-D63 PDR 12: :kanMX4-proGAL1 MATa ura3-0 his3-D1 leu2-D0 ... Pdr12p or Azr1p increases acetate resistance in prototrophic backgrounds This investigation into the in uences of aromatic amino acid auxotrophy on weak acid resistance was initiated in response...
- 7
- 391
- 0
CHILD HEALTH CARE DEMAND IN A DEVELOPING COUNTRY: UNCONDITIONAL ESTIMATES FROM THE PHILIPPINES doc
... estimator is applied to the data and the resulting parameter estimates are saved as a data set Using the collection of estimated parameter sets from these replications, one can calculate the standard ... this variable to construct hedonic prices for each individual However, because the facility data are a sample and not a census of facilities in the area, the extent of information available in the ... health care utilization for the index child Data were also gathered on characteristics of each barangay (i.e., community), such as population, water, sanitation, and other infrastructure, the agroecological...
- 101
- 298
- 0
báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
... is based upon an examination of the patterning in the residuals and the magnitude of the fist residual component in a Principal Component Analysis of the residuals This analytical strategy has ... comparative purposes The implementation of such an approach has limitations in that it requires a substantial (and continuing) investment in quality control, training and access to a central facility ... a change in the sum score reflects the gain in independence The Uniform Data System (UDS) is a central databank facility in Buffalo to which individual rehabilitation units submit their data for...
- 8
- 301
- 1
a return to love reflections on the principles of a course in miracles
... I once read a delightful book called The Mists of Avalon The mists of Avalon are a mythical allusion to the tales of King Arthur Avalon is a magical island that is hidden behind huge impenetrable ... completely The mess got so thick that all the king’s horses and all the king’s men couldn’t make Marianne function again The hysterical woman inside me was in a maniacal rage, and the innocent child was ... have rejected the material offhand based on its language They have fallen into a mental trap which in Alcoholics Anonymous is called “contempt prior to investigation.” Years ago, I was attending...
- 169
- 1,107
- 0
Báo cáo y học: "Association of PTPN22 1858 single-nucleotide polymorphism with rheumatoid arthritis in a German cohort: higher frequency of the risk allele in male compared to female patients" potx
... median age at onset of RA was 47.0 years (interquartile range 37 to 59 years), the median disease duration was 12. 5 years (interquartile range to 22 years) and 76.1% of the RA patients were female ... van der Helm-van Mil AH, Toes RE, Chokkalingam AP, Carlton VE, Begovich AB, Huizinga TW: Association of the Page of (page number not for citation purposes) 17 18 19 20 21 22 23 24 25 26 PTPN 22 ... factor is linked to the protein tyrosine phosphatase nonreceptor 22 – 620 W allele Arthritis Res Ther 20 05, 7:R 120 0-R 120 7 Gomez LM, Anaya JM, Gonzalez CI, Pineda-Tamayo R, Otero W, Arango A, Martin J:...
- 7
- 420
- 0
Báo cáo khoa hoc:" Simulation analysis to test the influence of model adequacy and data structure on the estimation of genetic parameters for traits with direct and maternal effects" ppsx
... Table I Models used to simulate and analyse data Simulation models (Co)variances fitted A AMR0 AMRi∗ AMR0C AMRi∗ C 2 σe σAo 2 σe σAo σAm 2 σe σAo σAm σAoAm 2 2 σe σAo σAm σC 2 2 σe σAo σAm σAoAm ... done on a national scale and artificial insemination is organised into regions, as is the case for instance for the Montbéliarde and Holstein cattle breeds in France [19 ,20 ] or in North-American breeds ... simulation Variances, covariances and parameters A AMR0 AMR25 AMR50 AMR0C AMR25C AMR50C Population σP hAo h2 Am rAoAm σAoAm /σP c2 20 0.0 0 .2 0.3 – – – 356.3 0 .2 0.3 – – 354.4 0 .2 0.3 −0 .25 −0.06...
- 27
- 431
- 0
báo cáo khoa học: " A critical synthesis of literature on the promoting action on research implementation in health services (PARIHS) framework" potx
... knowledge translation intervention in pain management Canadian Journal of Nursing Research 20 08, 40 (2) :40-56 21 Kavanagh T, Watt-Watson J, Stevens B: An examination of the factors enabling the successful ... continue recalling and adding to the richness of the qualitative data while further commenting, affirming or challenging the analysis Issues: • Authors noted the evaluation was ‘both small scale ... (dependent variable) also calculated based, in part, on contextual variables (e.g., autonomy, organizational slack) Authors note that perhaps facilitation was ‘ not operationalized ideally.’(p...
- 20
- 336
- 0
báo cáo khoa học: " Validity and usefulness of members reports of implementation progress in a quality improvement initiative: findings from the Team Check-up Tool (TCT)" pot
... the analytic plan and data interpretation, and drafted the manuscript YJH acquired the data, performed all statistical analysis, and participated in data interpretation and drafting of the paper ... intervention spreads to additional hospitals and other settings Finally, the TCT can serve as a model for developing comparable measures for other team-based QI interventions Methods Data source Data ... Organizational support -0.43* Staffing/resource adequacy 0.05 Team autonomy -0.61** Staffing/resource adequacy -0 .23 Participation and goal agreement -0.45* Staffing/resource adequacy 0 .23 Insufficient...
- 13
- 312
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25