2—summary of results of regression calculations using values in table a 1 and procedure in appendix a 2
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... Conflict of Interests The authors have declared that no conflict of interest exists 19 20 21 22 23 24 References Sabatini RME Mapping the brain Brain and Mind Magazine 19 97; Pritchard WS Psychophysiology ... potential? International Journal of Psychophysiology 19 98; 28 :11 - 21 63 Zenker F, Barajas JJ Age-Related variations in P300 elicited by active, passive and single-tone paradigms in children In: IERASG ... Brain Research 20 05; 22 (2) :2 21 - 2 31 80 Barabasz A, Barabasz M, Jensen S, et al Cortical event-related potentials show the structure of hypnotic suggestions is crucial The International Journal of...
- 8
- 563
- 0
summary of agriculture phd thesis research on identifying new varieties and cultivated techniques protocol to improve productivity and economic efficiency in tomato production in red river delta
... 67, 0a 11 , 8a 44, 5a 11 5, 7a 3, 2a 80, 0a 67, 9a TV7 (15 /10 ) 66, 2a 12 , 1a 44, 6a 11 6, 2a 3, 1a 77, 5a 68, 6a TV8 (25 /1) 66, 5a 12 , 1a 45, 2a 11 6, 0a 3, 2a 80, 0a 67, 2a The Spr.-Su TV9 (15 /1) 58,2b 10 ,4b 32, 6b 11 4,7ab ... 2, 29ab 3 ,1 7a 2, 53ab 63,4ab 79, 2a 70,2ab 53, 1a 64, 1a 50,3ab TAI786 2, 3 3a 3,4 2a 2, 7 0a 64, 5a 85, 5a 74, 8a 53, 1a 68, 7a 52, 4ab Savior 2, 3 3a 3 ,1 9a 2, 6 0a 65, 5a 79, 8a 72, 0ab 53, 8a 64, 7a 54, 6a TAT08 -10 72 ... 12 6,1b 66, 4a 63,1b 24 ,0 18 ,9 37, 5a 10 8,6b 2, 7c 10 6,6c 53,3c 2, 8 2, 4 2, 0 5 ,2 1, 9 0 ,1 1,6 4,3 1, 6 2, 2 38, 0a 37, 5a 11 3, 4a 11 1, 7a 2, 9a 3, 0a 12 7, 6a 13 1, 1a 63, 8a 65, 6a 34,4b 10 7, 8a 2, 7b 10 2, 1b 51, 1b...
- 27
- 396
- 0
Summary of doctorial (PH d) thesis in economics tourism economy in the north central region in international economic integration
... propaganda for and awareness of the whole society of climate change and sea water rising Reviewing and adjusting tourism development planning, particularly in the coastal and mountainous areas of ... 0.7% 1, 308 4 .1% 13 0.8% 1, 787 5 .2% 16 0.8% 2, 227 5.7% stars 0 .2% 423 1. 3% 0.3% 655 1. 9% 0 .2% 648 1. 7% Total 1, 525 10 0% 32 ,18 8 10 0% 1, 587 10 0% 34 ,2 51 100% 1, 915 10 0% 39 ,14 5 10 0% of Source: Institute ... panel of examining judges at Ho Chi Minh National Academy of Politics and Public Administration At date month 2 013 The thesis is available at: National Library and Library of the Ho Chi Minh National...
- 27
- 287
- 0
summary of agricultural doctoral thesis studying the growth, development capacities and technical measures to increase yields, qualities of some exotic orchid cultivars (cattleya, dendrobium, oncidium) for nort
... 11 .5 12 .2 13 .6 10 .3 6.0 1. 3 11 .5 14 .1 14.3 13 .7 12 .8 9.5 6.6 1. 5 3.3 3.0 3 .2 3.0 3.4 3.5 3.0 7 .2 0.4 2. 2 2. 3 2. 6 2. 4 2. 4 2 .1 11. 1 0.5 1. 2 1. 5 2 .1 1.9 1. 9 1. 1 13 .5 0.4 Soft rotten disease severity ... (flowers) No of buds / plant ( buds) 36.3 20 .6 38 .1 33.8 17 .5 56.7 21 . 0 1. 4 1. 2 1. 5 1. 2 1. 4 1. 4 1. 2 9.5 0 .2 1. 3 1. 1 1. 1 1. 2 1. 4 1. 1 9.4 0 .2 3.5 2. 3 5.6 2. 9 3.4 2. 0 7.6 0.4 3 .2 2.7 3.4 2. 4 2. 9 3.3 2. 4 ... Plant hight (cm) No of stems/ plant (stems) 51. 3 43.3 50.7 39.5 48.3 52. 8 50.3 16 .2 13 .7 15 .4 14 .1 13.3 16 .5 13 .3 2. 4 0.6 21 . 1 22 .3 20 .5 22 .8 22 .6 20 .3 6.8 2. 6 14 .1 16.8 16 .3 17 .5 16 .6 12 .0 6.2...
- 27
- 553
- 0
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Late capsular bag contraction and intraocular lens subluxation in retinitis pigmentosa: a case report" pdf
... http://www.jmedicalcasereports.com/content/5 /1/ 65 Page of Received: 10 July 2 010 Accepted: 14 February 2 011 Published: 14 February 2 011 References Sato H, Wada Y, Abe T, Kawamura M, Wakusawa R, Tamai M: Retinitis pigmentosa associated with ... retinitis pigmentosa Ophthalmology 19 98, 10 5 : 12 39 - 12 43 Hayashi K, Hirata A, Hayashi H: Possible predisposing factors for in- thebag and out -of- the-bag intraocular lens dislocation and outcomes of ... denied any history of trauma or fall At this time her BCVA was 20 /10 0 in the right eye and 20 /25 in the left eye On slit-lamp examination, the edge of the intraocular lens was displaced nasally and...
- 3
- 308
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; ... in children (two mixtures were used in the study: Mix A included E1 02/ E 110 /E 122 /E 124 /E 21 1 , and Mix B contained E104/E 110 /E 122 /E 129 /E 21 1 ); The second one, the “Liverpool study” performed by Lau ... mixture of C18H10NO5SNa and C18H9NO8S2Na2, its concentrations were displayed as both maximal and minimal possible values 27 In order to compare toxicities on a molar equivalence basis, LC504d and...
- 58
- 262
- 0
Structural damage assessment of building structures using dynamic experimental data (p 1 8)
... 11 12 13 14 15 16 17 18 19 10 20 1 004 1 0 32 1 0 1 0 0·799 1 015 0·8 1 0 0·9 91 1 13 5 1 0 1 0 0·993 1 006 1 0 1 0 0·997 1 026 1 0 1 0 0·986 1 055 1 0 1 0 0·9 81 1·000 1 0 1 0 0·999 0·998 1 0 1 0 ... 0·998 1 0 1 0 1 080 0·979 1 0 1 0 1 0 02 0·9 91 1·0 1 0 1 000 1 023 1 0 1 0 1 0 02 1 008 1 0 1 0 1 0 01 1·000 1 0 1 0 0·999 1 016 1 0 1 0 0· 811 0·808 0·8 0·8 0·998 0·999 1 0 1 0 0·999 0·999 1 0 1 0 ... 0·9 71 0·986 1 0 1 0 1 003 0·999 1 0 1 0 0·993 1 003 1 0 1 0 0·996 0·986 1 0 1 0 0·999 0·999 1 0 1 0 0·999 0·995 1 0 1 0 1 000 1 003 1 0 1 0 1 008 1 013 1 0 1 0 1 018 1 000 1 0 1 0 1 009 1 0 02 1 0...
- 8
- 368
- 0
Summary of factors contributing to falls in older adults and nursing implications
... Beauchet O Fear of falling and gait variability in older adults: a systematic review and meta-analysis J Am Med Dir Assoc 2 014 ;16 :14 e19 11 van Landingham SW, Massof RW, Chan E, Friedman DS, Ramulu ... epidemiology of falls and syncope Clin Geriatr Med 20 02 ;18 :14 1e158 14 2 Zagaria MA Syncope: medications as cause and contributing factors US Pharm 3e20 -2 0 12 ;37(3) :22 e27 Jobson Medical Information LLC Available ... www.stars-us.org/files/file / 12 0 416 -lc-FINAL %20 STARS-US %20 Common% 20 Causes %2 0and% 20 Preventative %20 Advice %20 on %20 Syncope %2 0in% 20 Older% 20 People %20 US %20 Sheet.pdf; 2 013 Cited March 11 , 2 015 14 6 Todd C, Skelton D What are...
- 10
- 606
- 0
Đề tài " Extension properties of meromorphic mappings with values in non-K¨ahler complex manifolds " pot
... ∂z2 ∂ z2 ∂z1 ∂ z1 ∂z2 ∂ z1 ∂z1 ∂ z2 ¯ ¯ ¯ ¯ (2. 2.4) on HW (1 − r) Now we can estimate the Laplacian of a: ¯ ∂ t 22 (2. 2.5) a( z1 ) = i dz2 ∧ d 2 z ¯ |z2 | 1 ∂z1 ∂ z1 ¯ ≤i |z2 | 1 ¯ ¯ ∂ t1 ∂ t 12 ... t 12 ∂ t2 − + + ∂z2 ∂ z2 ∂z2 ∂ z1 ∂z1 ∂ z2 ¯ ¯ ¯ ¯ ∂t 11 =i dz2 + i |z2 | =1 ∂z2 ¯ ∂t 12 d 2 − i z ¯ |z2 | =1 ∂ z1 dz2 ∧ d 2 z ¯ ∂t 21 dz2 = ψ(z1 ) |z2 | =1 ∂z1 Inequality (2. 2.5) holds for z1 ∈ V ∩W ... coordinates in C2 and repeating Step 1, we see that f holomorphically extends onto 2 \ (S1 × S2 ), where S1 and S2 are compacts (after shrinking) of harmonic measure zero We can use shrinking...
- 44
- 283
- 0
Báo cáo hóa học: "Research Article Schur-Convexity of Two Types of One-Parameter Mean Values in n Variables" ppt
... mean values, ” The Rocky Mountain Journal of Mathematics, vol 35, no 5, pp 17 87 17 93, 20 05 [ 12 ] A W Marshall and I Olkin, Inequalities: Theory of Majorization and Its Applications, vol 14 3 of Mathematics ... 1, x1 =x2 , ⎫ ⎞ x2 ⎠ ⎬ 1 , ⎭ x1 ⎛ ⎞ r x2 ⎠ ⎝(r + 1) , r x1 x2 , x1 ln x2 , ln x1 x1 , r = − 1, 0, x1 =x2 , , x2 ln x2 x1 ln x1 ⎞ 1/ r x2 ⎠ , x1 r = 0, x1 =x2 , x1 = x2 , (1. 7) r = − 1, 0, x1 ... )/x1 and (u2 x1 + n=3 ui xir )/x2 , θ is between x1 and i i n 2r 1 r 1 r r r x2 , and T(x,u;θ ) = (2u2 θ + θ i=3 ui xi )/x1 x2 ≥ From (3 . 12 ) and (3 .13 ), we have x1 − x2 ∂Fr ∂Fr − ∂x1 ∂x2 (3 .14 )...
- 10
- 311
- 0
Báo cáo toán học: "nX-Complementary Generations of the Rudvalis Group Ru Ali Reza Ashrafi1 and Ali Iranmanesh2" docx
... Δ( 2A, 3A, pX) Δ( 2A, 3B, pX) Δ( 2A, 5A, pX) Δ( 2A, 5B, pX) 7A 25 2 56 504 19 11 1 3A 2 9A 364 20 3 26 0 29 14 56 5 51 24 05 19 14 pX 7A 1 3A 2 9A pX Δ( 2A, 7A, pX) Δ( 2A, 1 3A, pX) Δ(2B, 3A, pX) 19 695 - 21 4 89 10 904 ... 67704 22 5036 - - 1 3A 2 9A 716 56 67 5 12 22 6460 22 7679 2 414 620 2 411 669 12 98997 pX Δ( 3A, 7A, pX) Δ( 3A, 1 3A, pX) Δ( 5A, 7A, pX) Δ( 5A, 1 3A, pX) Δ(5B, 7A, pX) Δ(5B, 1 3A, pX) 1 3A 2 9A 50505 52 5 21 2 025 28 50 613 ... 3.5.7 .29 A8 52 : 4S5 26 32 5.7 25 3.53 3 .A6 22 25 33 51+ 2 : 25 25 53 3.7 .13 24 3. 52 Order 13 3 Group 2F4 (2) L2 (13 ) .2 : (4 × A5 ) 12 A6 2 12 25 32 In [25 ], Woldar proved that every sporadic simple...
- 7
- 339
- 0
Báo cáo y học: "Resolution of cell-mediated airways diseases Carl G Persson*1 and Lena Uller2" pps
... Opin Pulm Med 20 03, 9 (2) :11 1 -11 6 10 1 Norman P: AZD-4 818 , a chemokine CCR1 antagonist: WO200 810 3 12 6 and WO2009 011 653 Expert Opin Ther Pat 20 09, 19 (11 ) :16 29 -16 33 10 2 Leckie MJ, ten Brinke A, Khan ... Care Med 20 03, 16 8(8):968-975 Page 11 of 12 87 Yoshihara S, Yamada Y, Abe T, Linden A, Arisaka O: Association of epithelial damage and signs of neutrophil mobilization in the airways during acute ... study of role of viral infections in exacerbations of asthma in 9 -11 year old children BMJ 19 95, 310 (6989) : 12 25 - 12 29 10 0 Seemungal TA, Wedzicha JA: Viral infections in obstructive airway diseases...
- 12
- 276
- 0
Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps
... signaling via the janus kinase and signal transducer and activator pathway, which appear to inhibit cytokine and GH signaling as part of a classical negative feedback loop [ 12 ] Increased hepatic ... citation purposes) Critical Care 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Vol 11 No O'Leary et al teins in intensive care unit patients Growth Hormone IGF Res 19 98, 8:455-463 Nicholson ... [(Eref)CTref,mean]/[(Etarget)CTtarget,mean] Statistical analysis Statistical evaluation of data was performed using analysis of variance with Tukey's test post hoc by Instat GraphPad version 5. 02 (GraphPad Software,...
- 8
- 318
- 0
SUMMARY OF COLORFASTNESS TEST RESULTS (2)
... understanding and implementing the FTC Care Label Rule We continue to fund research and provide free information and resources to the textile/apparel industry You can have the advantages of fast, easy ... you can eliminate a costly and time intensive step in your care label procedures For free assistance contact: Eric J Essma, Director Textile Industry Affairs Tel: 850- 522 - 627 0 / Fax: 21 2 -505-3300 ... preference information suggests that retailers and apparel manufacturers are losing millions in sales and profits unnecessarily due to incorrectly labeled products Bleachability is important to consumers...
- 2
- 220
- 0
Tài liệu Báo cáo khoa học: Investigation and prediction of the severity of p53 mutants using parameters from structural calculations pptx
... 25 28 14 )1 10 )2 2 30 14 14 18 )5 )1 )1 27 16 24 21 27 25 )3 )2 3 15 31 12 23 )6 0 21 43 11 )1 )2 )4 22 22 17 11 4 2 24 16 22 30 20 24 15 32 10 42 25 11 15 32 30 14 23 32 27 16 16 33 21 27 13 ... p53R2 WAF1 WAF1 ⁄ MDM2 WAF1 WAF1 ⁄ MDM2 WAF1 ⁄ MDM2 WAF1 ⁄ MDM2 MDM2 82 12 8 13 1 14 3 97 56 22 3 32 2 12 11 1 18 1 3 2 20 0 27 0 2 0 2 0 1 0 1 0 1 67 13 5 36–96 40–86 54 10 8 32 49 53 2 21 25 15 3 expected ... Polarity change Pocket ⁄ cavity B Energy Conservation Accessibility General properties Other WAF1 MDM2 BAX 14 -3-3-r AIP GAD45 NOXA p53R2 Average 16 22 13 11 12 )7 )1 )4 )2 24 15 10 10 15 )10 2 25...
- 14
- 561
- 0
Tài liệu ISS AN MSCI BRAND: 2012-2013 Policy Survey Summary of Results pptx
... Board diversity - Asia-Pacific Sustainability - Asia-Pacific M &A and proxy fights - Asia-Pacific 2 0 12 -2 013 Policy Survey Summary of Results 66 (1) 38 (2) 36(3) 32( 4) 27 (5) 23 (6) 21 ( 7) 17 (8) 12 (9) ... Summary of Results -4- © 2 0 12 Institutional Shareholder Services Inc A majority of investors indicated that both a standardized calculation of realized/realizable pay and measures of realized ... pay based on the proxy statement's Summary Compensation and Grants of Plan-Based Awards tables, reflecting salary and cash awards, together with the grant-date fair values of equity awards approved...
- 38
- 419
- 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf
... Takayanagi, Y & Oyama, F (19 91) Comparative base specificity, stability, and lectin activity of two lectins from eggs of Rana catesbeiana and R japonica and liver ribonuclease from R catesbeiana ... Ciencia y Tecnologia (BMC2000- 013 8-CO2- 02, Ó FEBS 20 04 MS characterization of onconase activation (Eur J Biochem 2 71) 11 71 HF2000-0 017 ), and from the Generalitat de Catalunya (SGR2000-64 and SGR20 01- 0 019 6) ... (AAP : ONC), and incubated at 37 °C Aliquots of lL were taken at 0, 1, 2, 4, 6, 8, 24 and 30 h, diluted 10 -fold in 0 .1% TFA-CH3CN (2 : 1) , mixed with an equal volume of saturated sinapinic acid...
- 9
- 704
- 0
Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx
... Sustainment Operational 45 36 11 7 45 36 11 7 13 ,13 2 19 ,387 10 ,354 19 ,387 10 ,354 13 ,13 2 11 2 4 31 28 8 4 31 28 8 11 2 1, 523 1, 405 3, 715 3, 715 1, 523 1, 405 28 12 1 13 7 28 12 1 13 7 14 6 545 829 14 6 545 829 11 ... 17 4 66 66 2 71 2 71 74 74 48 48 1, 137 1, 137 1, 043 1, 043 47 47 6 13 3 13 3 29 29 58 58 2 311 311 53 53 69 69
- 105
- 394
- 0
Economic benefits of standardization Summary of results Final report and practical examples pdf
... significance of national and that of international standards Standards are an indicator of innovative technological competitiveness The number of existing standards cannot explain in all cases structures ... faced increased competition because of European and International Standards Standards are internationally respected A German standards collection which has European and International standards as ... the economy as a whole Standardization and technological change, the effects of standardization on the German economy and foreign trade 10 11 13 14 14 15 16 17 17 18 19 20 Fraunhofer Institute...
- 39
- 343
- 0
Báo cáo hóa học: " Comparison of regression models for estimation of isometric wrist joint torques using surface electromyography" potx
... models using identical training data sets When using 90% of data as training data set and the rest of the data as testing data, we attained R2 values of 0.96 ± 0.04, 0.97 ± 0.04, 0.97 ± a 0.03, ... where 25 % and 90% of the data set is used for training models and the rest of the data set is used for testing using all SEMG channels Mean R2 values increased 19 %, 21 % , 18 %, 14 %, 32% , a and 26 % ... 0 .13 1. 03% 0 .11 1. 32% 0 .19 OLS Mean 2. 88% 0.84 3 .17 % 0.77 4. 82% 0.63 STD 0.94% 0 .11 1. 06% 0 .13 1. 81% 0 .23 Mean 2. 83% 0. 82 3 .11 % 0.79 4.73% 0.69 STD 0.93% 0 .10 1. 01 0 .11 1. 31% 0 .18 Mean 2. 85% 0.82...
- 12
- 560
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25