... atomic scattering FH factor f ỵ f (In practice, f is a negative quantity.) The anomalous part 00 FH is calculated using the imaginary part of the atomic scattering factor, if 00 As indicated ... only ina few dedicated research laboratories a decade ago Similarly, automation has begun to assume increasing roles in cryogenic specimen changing for data collection; many laboratories are ... anomalous scattering.) If the parameters of the anomalous scatterers are known (including the complex atomic scattering factors at wavelength ), a F may be calculated In contrast to the earlier...
... actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in meaning ... ~'¢ ' "Hai arigatou gozaimasu Kyoto Kanko Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, "A hai arigatou gozaimasu e Kyoto Kanko ... 1245(-8.5) The values inside brackets are the rate of decrease 4.3 More Applicable for a Result Having a Few Errors In EPC+SSC, the rate of decrease was 8.5%, and the decrease was obtained in all type...
... engine; carburettor and fuelinjected versions are available (carburettor versions not available in the UK) The crankshaft runs in five main bearings Thrustwashers are fitted to No main bearing ... crankshaft (main bearings) and camshaft The big-end bearings are supplied with oil via internal drillings in the crankshaft, while the camshaft bearings also receive a pressurised supply The camshaft lobes ... resulting in serious damage to the engine (eg burnt valve seats and/or cylinder head warping/cracking) The clearances are checked and adjusted as follows Remove the cylinder head cover and oil baffle...
... there are four quasideterminants: |A| 11 = a1 1 − a1 2 · a 1 · a2 1 , 22 |A| 12 = a1 2 − a1 1 · a 1 · a2 2 , 21 |A| 21 = a2 1 − a2 2 · a 1 · a1 1 , 12 |A| 22 = a2 2 − a2 1 · a 1 · a1 2 11 We see that each of ... introduced in [317] (see again [324]) under the name “binary.” The binary transformations in [317, 324] are a 2+1 construction based on alternative Lax pairs This is a combination of the classical DTs ... Hermitian conjugate to A, i.e., the intertwining relation takes place automatically for L1 = AA+ Given an operator algebra, we can derive comprehensive statements about eigenvalues and eigenstates...
... translation Intralingual translation Interlingual translation Practical1 Practical1 Intralingual translation: 'Today I attempted' Gist translation: ��I L�I � Preliminaries to translation as a ... in translation Interlinear translation Literal translation Free translation Communicative translation From interlinear to free translation Equivalence and translation loss Equivalence Translation ... conversation in both Standard Arabic, as it might appear ina short story or novel, and the contextually more natural colloquial Arabic): Standard Arabic Literal translation A Peace be upon you B And...
... dashes and commas all link parts of sentences ina meaningful way A comma in Chinese may indicate ‘new idea coming next’, and we might want to use, instead, a full stop in an English translation ... Ian Higgins and Michael Loughridge Thinking Italian Translation A course in translation method Italian to English Sándor Hervey, Ian Higgins Stella Cragie and Patrizia Gambarotta Russian Translation ... professional translators employed by international organisations and agencies, and we well to incorporate the collaborative principle into training at whatever level 8 Introduction The rationale and...
... Waterman Volume 273 RNA Polymerase and Associated Factors (Part A) Edited by Sankar Adhya Volume 274 RNA Polymerase and Associated Factors (Part B) Edited by Sankar Adhya Volume 275 Viral Polymerases ... Chemistry (Part B) Edited by Guillermo A Morales and Barry A Bunin Volume 370 RNA Polymerases and Associated Factors (Part C) Edited by Sankar L Adhya and Susan Garges xxxvi methods inenzymologyVolume ... from malignant Diagnosis and initial staging Solitary pulmonary nodules Lung cancer Colorectal cancer Lymphoma Esophageal cancer Breast cancer Head and neck cancer Melanoma Lymphoma Breast cancer...
... personali and aptitude in our analysi as there may not be any e ut ity e is, y experts participating and ag ggregation is inco orporated in the method m 2.2 Wisdom of cro owds It is said that the ... software development The resulting input data is based on a five-level rating scale using SWEBOK 4.2 Analysis of candidate developers using SOM In this section, we perform a SOM analysis, integrating ... software design Structure and architecture Analyses and evaluation of software designing quality A notational system of software design Tactics and method Programming skill Basis of building software...
... nonlinear and cannot be easily expressed by any analytical equation The neural network can 289 Fig 12 Validation of model with online operating data (phase A) provide very good mapping if trained ... Moon and A Keyhani, “Estimation of induction machine parameters from standstill time-domain data,” IEEE Trans Ind Applicat., vol 30, Nov./Dec 1994 290 [6] A Keyhani, H Tsai, and T Leksan, “Maximum ... the magnephase current and the damper winding current Let’s tizing current assume that the phase parameters and obtained from standstill test data are accurate enough for low current case And...
... Data collection and Statistical analysis Real time PCR data was assembled using the LightCycler computer application software 4.05 dedicated for the LightCycler 2.0 All data was analyzed using ... CACGGCGTAGGAGACCAC GNRH1 #29 Roche Diagnostic, Cat No: 04687612001 GACCTGAAAGGAGCTCTGGA CTTCTGGCCCAATGGATTTA HPRT Human HPRT Gene Assay (Roche Diagnostic, Cat No: 05046157001) to be statistically ... of data ENM, EG, KA collected surgical tissue and blood samples, performed anatomicopathologic macroscopic and microscopic examinations and delivered clinical patients’ data All authors read and...
... over an interval containing the movement onset (measured as the finger switch activation) if no artifact was detected in that particular interval The interval starts at tstart seconds before Page ... beneficial properties of linear classification methods, such as simplicity, are maintained, however, the overall classification is nonlinear in the input space, since the feature and input spaces are ... computing resources, which are funded inpart by the Canada Foundation for Innovation, Alberta Innovation and Science, BC Advanced Education, and the participating research institutions The authors...
... routine DVT prophylaxis with Injection Enoxaparin 40 mg subcutaneous once a day Anaesthesia was standardized and all patients received epidural anaesthesia according to standard practice Patients ... data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and ... and was involved in critically reviewing the manuscript FA and MUC participated in the designed the Page of study and participated in the preparation of the protocol and data collection MU participated...
... routine DVT prophylaxis with Injection Enoxaparin 40 mg subcutaneous once a day Anaesthesia was standardized and all patients received epidural anaesthesia according to standard practice Patients ... data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and ... and was involved in critically reviewing the manuscript FA and MUC participated in the designed the Page of study and participated in the preparation of the protocol and data collection MU participated...
... coordination of study, manuscript drafting and approval SC data acquisition, manuscript drafting and approval BJ coordination of study, patient recruitment, manuscript drafting and approval AKA ... K, Nakajima H, Miyazaki T, Yayama T, Kawahara H, Kobayashi S, Tsuchida T, Okazawa H, Fujibayashi Y, Baba H: Effects of Alendronate on bone metabolism in glucocorticoid-induced osteoporosis measured ... coordination of study, manuscript drafting and approval VL study design, data acquisition, analysis, manuscript drafting and approval Competing interests CP is a consultant to Algeta ASA Received:...
... various loads The incident light intensity was calibrated using a standard solar cell composed of a crystalline silicon solar cell and an infrared cutoff filter (KG-5, Schott AG, Mainz, Germany) ... groups are removed In addition, the atomic ratio of carbon and oxygen (C/O), obtained by taking the ratio of C1s and O1s peak areas in XPS spectra, increases from 2.7 to 5.1, which also indicates ... analysis All authors read and approved the final manuscript Acknowledgments This work was financially supported by the National Natural Science Foundation of China (No 20907031) References Kamat...
... estimates were obtained as follows Recordings were made at varying locations in each room and at varying distances relative to a single source in this case a loudspeaker The sampling rate was 48 ... may be found that the classical approach of concentrating the microphones ina closely spaced array causes many of the participants to be a significant distance from all available microphones As ... both a lowpass and often harmonic signal This poses particular problems We have assumed Fa,b to be a zero-mean, normal random variable The analysis and experimental evidence underpinning this assumption...
... n-Rold´ n, J F Gomez Lopera, C Atae-Allah, J aa Mart´nez-Aroza, and P L Luque-Escamilla, A measure of ı quality for evaluating methods of segmentation and edge detection,” Pattern Recognition, vol ... information about the performance of the segmentation as the empirical discrepancy methods In fact, they are mainly used to obtain a preliminary metric, or when the ideal segmented image is not available ... out a manual segmentation, where some kind of uncertainty could appear In this work, real images are used to obtain the ideal segmentation Although the creation of the ideal segmentation of each...
... either a specimen manufactured for the purpose or a representative section of the base material in place (see 5.2) 4.1 Shear testing apparatus, being a loading frame incorporating a means of applying ... means of determining the compression strength may be agreed 6.1 Location of fixing 6.1.1 Standard specimen of base material When installed ina standard specimen of base material a fixing shall ... located in the soffit as cast 6.1.2 Other base materials In base materials other than a standard specimen of base material, where individual units are bonded with mortar joints, the fixing shall...