1993 high risk pregnancy and delivery toronto c v mosby
A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy
... higher incidence of later cardiovascular disorders and a reduced life expectancy (Chesley, Annitto and Cosgrove, 1989) Pregnancy is recognized to be a privileged immunological state, and therefore ... Transplantation Unit and the high- risk pregnancy specialists, the IVF unit felt that an IVF treatment cycle could be offered to Mr and Mrs A as long as the risks of IVF-ET, over and above those attendant ... retardation Case discussion The decision to accept the couple for IVF treatment posed signiWcant dilemmas of both a technical (obstetric and renal) and an ethical nature Severe pre-eclampsia can present...
- 6
- 512
- 0
Normal pregnancy and delivery
... Superficial peroneal nerve{ Tibial nerve* Tibial nerve* *Branch of sciatic nerve { Branch of common peroneal nerve, itself a branch of the sciatic nerve V1 V2 V3 C2 C3 C4 T2 C5 T4 T1 C8 T10 C6 C7 ... uterus (the vena cava may be totally occluded), causing reduction in venous return and cardiac output and thus compromising the mother, fetus or both Vasovagal syncope may follow aortocaval compression ... NMC 2002 18 L O C A L A N A E S T H E TI C S Bupivacaine is the most commonly used local anaesthetic in British obstetric epidural analgesic practice Bupivacaine, lidocaine, ropivacaine and levobupivacine...
- 62
- 210
- 0
HIGH-RISK PREGNANCY pps
... midpelvis Diagonal conjugate (DC) True conjugate (CV) Angle of pubic arch V eula lam (Pylbiso Y ronbA aV eul lam ) etauq d nI Ն8 cm 8–9.5 cm (direct) Ն11.9 cm Ͻ8 cm Ͻ8 cm Ն10.5 cm Ͻ9.5 cm Ͼ11.5 cm ... inlet contracture MIDPELVIC CONTRACTURE Midpelvic contracture nearly always occurs as a result of an interspinous diameter of Ͻ9.5 cm This may be suspected if the pelvic sidewalls are convergent and ... imminence of vaginal delivery, and maternal factors CHAPTER HIGH- RISK PREGNANCY 229 METHODS OF FETAL ASSESSMENT ULTRASONOGRAPHY Clinical ultrasound involves high- frequency sound waves produced...
- 50
- 265
- 0
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... prevent conception and is not associated with any adverse effects on the pregnancy or the neonate Case presentation The study from which this case report was derived was conducted in accordance ... Psychosom Med 2001, 63(5):830-834 Jablensky AV, Morgan V, Zubrick SR, Bower C, Yellachich LA: Pregnancy, delivery, and neonatal complications in a population cohort of women with schizophrenia and ... during pregnancy and delivery; VNS was safe for the patient and her child Competing interests Mustafa Husain declares that, in the last five years, he has received research grants from Cyberonics,...
- 7
- 453
- 0
High risk pregnancy 1
... Class I: unrestricted physical activity No symptoms of cardiac insufficiency Class II: slight limitation physical activity Class III: mod limitation physical activity Class IV: No physical activity ... be given to block coagulation cascade Complications: organ injury; maternal mortality Incompetent Cervix: Passive dilation of cervix without contxs Usually in early pregnancy hx miscarriages ... VS, CBC, O2, IVF [RL-volume expander], type & cross Neonate may be hypoxic, in hypovolemic shock d/t bl loss Prepare for emergency C/ S Comparison: Abruption vs Placenta Previa Abruptio Placenta...
- 61
- 305
- 0
Bóa cáo y học: "Prospective, randomized trial comparing fluids and dobutamine optimization of oxygen delivery in high-risk surgical patients [ISRCTN42445141]" pot
... resulting in functional limitation Major clinical predictor (3 points) Angina (class III or IV, Canadian Cardiovascular Society Classification) Severe arrhythmias (advanced heart block, ventricular arrhythmia ... Trocino G, Vigna C, et al.: The effect of bisoprolol on perioperative mortality and myocardial infarction in high- risk patients undergoing vascular surgery Dutch Echocardiographic Cardiac Risk ... complications, particularly cardiovascular adverse events High- risk surgical patients often present a decreased intravascular volume prior to a surgical procedure due to various factors The importance of fluid...
- 11
- 312
- 0
Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"
... Among cases and controls, prescriptions on loratadine (ATC codes: R06AX13), other antihistamines (ATC code: R06, except R06AX13), clomifene (ATC code: G03GB02), antidiabetics (ATC code: A10) and ... primarily to secure reimbursement for the National Health Service in each county These systems include information on WHO’s Anatomical Therapeutic Chemical (ATC) classification code, the amount ... (95% CI: 0.0-4.9) and 0.5 (95% CI: 0.0-3.3), respectively The adjusted ORs for other antihistamines were 1.6 (95% CI: 0.3-5.5) and 1.0 (95% CI: 0.2-3.4), respectively Table Characteristics of...
- 5
- 528
- 0
Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf
... grievances and seek changes in government policies, are critical Civil society’s legitimacy and the importance of its role should therefore be at the core of donors’ policies According to LICADHO ... the courts.28 FIDH-OMCT / PAGE 12 Defending Economic and Social Rights in Cambodia A High- Risk Activity II The Process of Land Redistribution “Years of civil war and conflict, followed by land ... land, also in the name of “development”, in the future FIDH-OMCT / PAGE 13 Defending Economic and Social Rights in Cambodia A High- Risk Activity III The practice of forced evictions and relocation...
- 32
- 431
- 0
Guidance on Responsible business in conflict-affected and HiGH-Risk aReas: a ResouRce foR companies and investoRs potx
... especially: • “Handling and Resolving Local-Level Concerns and Grievances”: http://www.icmm.com/ page/15822/icmm-presents-new-guidance-note-on-handling -and- resolving-local-level-concerns-andgrievances ... Global Code of conduct for Private Security Companies and Private Military Companies http://www.dcaf.ch/privatisation-security/PSC_PMC-CoC_Draft_11.01.2010.pdf Code of conduct resulting from an active ... needs of conflict-affected and high- risk contexts Explanatory Note Systematic and large-scale violations of human rights, humanitarian and criminal law may accompany violent conflict, and can be...
- 48
- 390
- 0
Báo cáo hóa học: " Comparison of p53 and the PDZ domain containing protein MAGI-3 regulation by the E6 protein from high-risk human papillomaviruses" pdf
... 5'CAGATCTCATGTTTCAAGACACTGAGGAAAAACCAC while the downstream primer sequence was 5'CAGAATTCGTCACAGTGCAGTTTCT-CTACGTCGG The amplified E6 sequences were ligated between the Bgl II and EcoRI restriction ... is involved, Since p53 and MAGI-3 represent distinct targets for high risk HPV E6, our approach was to directly compare p53 and MAGI-3 degradation by E6 from several high risk HPV types and further, ... 18E6-GFP pcDNA3 p53 pcDNA3 0.00 33E6pro-GFP 33E6var2-GFP 33E6var3-GFP 33E6var5-GFP 33E6var6-GFP 33E6var7-GFP 33E6var8-GFP Comparing p53 protein levels and p53 transcriptional activity in cells expressing...
- 9
- 383
- 0
báo cáo khoa học: "Sentinel lymph node biopsy for high-risk cutaneous squamous cell carcinoma: clinical experience and review of literature" ppsx
... large randomized controlled trial can be accomplished considering the relative low incidence of high- risk SCC and long accrual period that would be required An alternative approach would be to contribute ... recurrence; H&E: hematoxylin and eosin; IHC: immunohistochemistry; LND: lymph node dissection; LR: local recurrence; N/A: not available; NPV: negative predictive value; NR: nodal recurrence; SCC: ... Aggressive surgical treatment has been shown to benefit selected patients with locoregionally confined advanced SCC and long term survivors have been reported following radical salvage resection and...
- 7
- 366
- 0
Báo cáo y học: " HIV-2 diagnosis and quantification in high-risk patients" ppt
... mg/dL, and a normal glucose Testing of the cerebrospinal fluid (CSF) was negative for cytomegalovirus (CMV, PCR), EpsteinBarr Virus (EBV, PCR), varicella zoster virus (VZV, PCR), Lyme (IgM and IgG ... analytical and clinical performance J Clin Virol 2002, 25(2):205-216 Gomes P, Palma AC, Cabanas J, Abecasis A, Carvalho AP, Ziermann R, Diogo I, Goncalves F, Lobo CS, Camacho R: Comparison of the COBAS ... load was undetectable (branched DNA technology, Versant HIV-1 RNA 3.0, Bayer) Given the confusing picture and strong clinical suspicion for HIV, a second Western blot specific for HIV- http://www.aidsrestherapy.com/content/5/1/18...
- 5
- 361
- 0
báo cáo khoa học: " Assessing the role of syringe dispensing machines and mobile van outlets in reaching hard-to-reach and high-risk groups of injecting drug users (IDUs): a review" ppt
... mobile vans can render a congenial environment that provides near anonymous access Mobile vans can cover a greater geographic area and can more readily accommodate changes in local conditions A van ... maintenance of a vehicle and fuel costs [58] However, services through mobile vans can be provided at both locations and times that are compatible with the IDUs' lives Mobile vans increase accessibility ... hidden and high- risk IDUs These two modalities can successfully address concerns about temporal and spatial accessibility and overall acceptability of NSP Intrinsic advantages of each can offset...
- 9
- 422
- 0
báo cáo khoa học: " High HCV seroprevalence and HIV drug use risk behaviors among injection drug users in Pakistan" doc
... returned to receive their HIV and HCV test results, underscoring the need for HIV and HCV educational prevention programs to focus on reducing the stigma of HIV and HCV and engaging individuals in ... participants had ever heard of HIV or HCV before All participants provided a blood specimen at the study visit and received HIV and HCV pre-test counseling by trained interviewers and were compensated ... level Also, being a current injector, ever having jerked, ever sharing syringes and sharing injection tools and ampoules and ever receiving a barber shave were positively associated with HCV...
- 10
- 225
- 0
Báo cáo y học: "High-risk human papillomavirus in the oral cavity of women with cervical cancer, and their children" pot
... detect the prevalence of HR-HPV in the oral cavity of women with cervical cancer, and to evaluate the risk factors which contribute to its occurrence Also, this study aimed to detect the existence ... oral cavity of women with cervical cancer, and their children Table Association of HR-HPV in the oral cavity of women with cervical cancer, with variables Four samples (5.71%) from the oral cavity ... the cervical malignancies [25] This difference in HPV invasiveness could be due to various factors Firstly, oral cavity is in direct contact with carcinogens present in tobacco and alcohol, making...
- 6
- 342
- 0
Báo cáo y học: "Prevalence of human papillomavirus infection and genotype distribution among high-risk Korean women for prospecting the strategy of vaccine development" docx
... in cervical carcinogenesis in these countries Even if clinical trials of prophylactic vaccines targeted for HPV-16 and -18 showed dramatically preventive effect for HPV infection and precancerous ... the cross-protection between various HPV genotypes is still unsolved in vaccinated women [20] These results indicate that area-specific HPV vaccines should be developed for preventing HPV infection ... Study group: Effect of prophylactic human papillomavirus L1 virus-like-particle vaccine on risk of cervical intraepithelial neoplasia grade 2, grade 3, and adenocarcinoma in situ: a combined analysis...
- 4
- 345
- 1
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc
... anthelmintic product: Acta vet scand vol 43 no 2, 2002 102 M M Larsen et al Table Descriptive statistics for significant risk factors for high endoparasitic burden (EPG>200) and oddsratios (95% confidence ... in Table and Collinearity between the variable "the veterinarian gives advice regarding the choice of anthelmintics" and the variable "veterinarian gives advice regarding pasture hygienic measures" ... horses The fact that there is reduced efficiency of anthelmintics in foals could, according to Herd & Gabel (1990), be due to accumulation of encysted cyathos- Risk factors and anthelmintic treatment...
- 8
- 294
- 0
Báo cáo khoa học: "Highs and lows in high-risk surgery: the controversy of goal-directed haemodynamic management" pps
... The Clinic of Intensive Care Medicine, University Hospital Bern and University of Bern, has or has had research, education and consulting contracts with Edwards Lifesciences References What can ... predictive value of central venous saturation in the participating centres and in their case mix remains, and that the patient population at high risk in those centres can be identified Competing ... perioperative treatment protocol have any chance if postoperative care is suboptimal? How organisational aspects of postoperative intermediate and intensive care influence the outcomes? An understanding...
- 3
- 245
- 0
Báo cáo khoa học: "Molecular adsorbent recirculating system and hemostasis in patients at high risk of bleeding: an observational study" potx
... for liver failure due to acute liver failure, acute-onchronic liver failure, liver dysfunction after liver transplantation and sepsis The local Ethics Committee waived the need for informed consent ... Joukhadar C, Strobl W, Gendo A, Madl C, Gangl A: Citrate pharmacokinetics and metabolism in cirrhotic and noncirrhotic critically ill patients Crit Care Med 2003, 31:2450-2455 25 George MM, Van Thiel ... whole blood and the charcoal and anion exchanger columns Clinically important, platelet loss was not accompanied by deterioration of platelet function According to the study by Doria and colleagues...
- 9
- 207
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose