15 schuzczyk henryk chitosan based pharmaceuticals for reduction of cholesterol and lipid contents c a vol 132 n0 23 2000 p 1170 313724p finland
Báo cáo hóa học: " Research Article Link Quality-Based Transmission Power Adaptation for Reduction of Energy Consumption and Interference" pot
... walking around For each scenario, we collected a packet trace and used a post processing approach to compare every method and parameter In this way, every parameter combination could be compared based ... and parameters, we used a post processing approach In this approach, we took the trace and divided it into 200 batches Each batch contained 150 packets, 10 packets of each power level For each ... the packet delivery ratio in any measurable way Some work also discussed combinations of power and rate adaptation to achieve good performance In [5], it was proposed to select data rate and transmission...
- 17
- 325
- 0
In situ forming supramolecules and chitosan based hydrogels for regenerative medicine
... * P < 0.05 Figure 2.9 Intracellular uptake of HP nanogels Confocal microscopic images of HeLa cells incubated with FITC-labeled heparin−Cya−Pluronic−VS and FITC-labeled heparin−Cya−Pluronic−cRGDfC ... fabricating nanocarrier -based drug delivery systems for controlled and targeted therapeutic application Chapter provides general information of cancer and cancer treatment strategies The recently cancer ... HeLa celles incubated with c( RGDfC)PEG-ADA:SPIO@βCD:PTX SAMNs at 37 oC for h H NMR spectra of DOPA-CD (A) and ADA-PEG-VS (B) xiv List of Table Table 1.1 Selected examples of ligands used in active...
- 140
- 206
- 0
Tài liệu Báo cáo khoa học: Enzymes for the NADPH-dependent reduction of dihydroxyacetone and D-glyceraldehyde and L-glyceraldehyde in the mould Hypocrea jecorina doc
... following primers were used: 5¢-gaattcagaatg gcctccaagacgta-3¢ and 5¢-gaattcttattcctcctctggccaaa-3¢ The PCR product was cloned, similar to gld1, first in a TOPO vector and then in the expression vector ... library of the H jecorina strain Rut C- 30 [21] by PCR The following primers, introducing an EcoRI restriction site, were used: 5¢-gaattcaacatgtcttccggaaggac-3¢ and 5¢-gaattcttacagcttgatga cagcag-3¢ ... and Tor Nessling Foundation and PR was an Academy Research Fellow of the Academy of Finland References Baliga BS, Bhatnagar GM & Jagannathan V (1964) Nicotinamide adenine dinucleotide phosphate-specific...
- 7
- 510
- 0
accounting ethics and its important role for reduction of accounting fraud an empirical study in hanoi
... Professional Accountant When I mention about the rule for Professional Accountant, I always consider the code of ethic, GAAP (General Accepted Principal) for professional accountant Both of them are ... accountancy It can be considered as an example of professional ethics We have to consider the code of ethics for profession accountant and some factor that relate to the accounting fraud According ... essentials part for this research According to my research, the International Ethics Standards Board for Accountant (IESBA) was created the Code of Ethic for Professional Accountant This organization...
- 44
- 501
- 0
accounting ethics and its impotant role for reduction of accounting fraud an empirical in hanoi
... University, Hanoi capital, Vietnam Object of research: accountants and auditor who are major accounting at any company in Hanoi Companies in research: public companies and private companies in Hanoi ... OF ABBREVIATIONS WTO: The World Trade Organization IFAC: International Federation of Accountants AGA: Advancing Government Accountability GAAP: General Accounting Accepted Principal ACCA: Association ... are - Fraud and illegal acts: Those provide practical guidance related to ethical issues when professional accountants and professional practice face fraud and illegal acts; - Conflicts of interest:...
- 58
- 338
- 0
Báo cáo sinh học: "15 kDa Granulysin versus GM-CSF for monocytes differentiation: analogies and differences at the transcriptome level" docx
... group of chemokines that are able to attract neutrophils (CXCL1, CXCL3) [46], memory and activated T cells (CXCL11, CCL20, CCR7) [47,48], monocytes (CCL2, CCL20) [49], macrophages and dendritic cells ... (http://www.biocarta com), are part of a specific pathway were selected For each pathway, similarly to Chaussabel et al 2008 [24] a less stringent p- value (0.05) and FDR (0 .15) filter was applied and the remaining ... the Antigen Processing and Presentation, and Monocyte and Surface Molecules Pathways, although the former pathway revealed a constant up-regulation of genes, whereas for the latter pathway a down-regulation...
- 12
- 388
- 0
Báo cáo hóa học: " Carbon composite micro- and nano-tubes-based electrodes for detection of nucleic acids" pot
... http://www.nanoscalereslett.com/content/6/1/385 characterization LT treated electrochemical data and participated in preparation of the manuscript VA participated in the design of the study and performed the analysis of the data RK conceived ... Prasek et al Nanoscale Research Letters 2011, 6:385 http://www.nanoscalereslett.com/content/6/1/385 A Page of B Figure Preparation and characterization of MWCNTs (A) Set-up of the apparatus for ... R: Easy to use and rapid isolation and detection of a viral nucleic acid by using paramagnetic microparticles and carbon nanotubes -based screen-printed electrodes Microfluid Nanofluid 2010, 8:329-339...
- 5
- 382
- 0
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf
... approaches and the new metric for measuring accuracy prediction in Section Further, we present the protocols of data transfer and data retrieval and our adaptive accuracy adjustment using reinforcement ... neighbors and update the list periodically based on the communication of beacon packets [23] Upon each neighbor update, the node checks its data track table If a node identity, which appears in the data ... Trace -Based Scheme In this approach, opposite to the point -based approach, the collector node does not calculate the moving direction at each time point Instead, it measures the Pearson correlation...
- 17
- 362
- 0
Báo cáo hóa học: "Research Article A Geometrical-Based Model for Cochannel Interference Analysis and Capacity Estimation of CDMA Cellular Systems" pot
... inradius circular approach were similar The dependence of the capacity of a WCDMA network on cells sectorization and BS antenna radiation pattern has also been studied Cells sectorization and ... numerical evaluation of the proposed model are presented The accuracy of the proposed model and the circular-cell approximation is examined in detail The impact of the BS antenna radiation pattern and ... Germany, June 2005, paper 240 [28] C Tarhini and T Chahed, “On capacity of OFDMA -based IEEE802.16 WiMAX including adaptive modulation and coding (AMC) and inter-cell interference,” in Proceedings...
- 7
- 298
- 0
Báo cáo hóa học: " Research Article A Nonlinear Decision-Based Algorithm for Removal of Strip Lines, Drop Lines, Blotches, Band Missing and Impulses in Images and Videos" docx
... object in the projection device causes the line scratches The transfer process between film material and telecine can also produce scratches It is difficult to propose a general mathematical model for ... with improved performance can replace several independent algorithms required for removal of different artifacts Application of the proposed algorithm to black and color video sequences is also ... EURASIP Journal on Image and Video Processing filtering Additionally, impulse noise is a standard type of degradation in remotely sensed images This paper considers application of median -based algorithms...
- 10
- 288
- 0
Báo cáo hóa học: "Research Article Colour Vision Model-Based Approach for Segmentation of Traffic Signs" doc
... as a simple colour appearance model by CIE [19], called CIECAM It can predict colour appearance as accurately as an average observer and is expected to extend traditional colorimetry (e.g., CIE ... 3, pp 191–209, 1993 M R Luo, X W Gao, P A Rhodes, H J Xin, A A Clarke, and S A R Scrivener, “Quantifying colour appearance part III Supplementary LUTCHI colour appearance data,” Color Research ... the application of CIE colour appearance model that is developed based on human perception The experimental results show that this CIECAM model performs very well and can give very accurate segmentation...
- 7
- 294
- 0
Báo cáo vật lý: "AN ANFIS-BASED PREDICTION FOR MONTHLY CLEARNESS INDEX AND DAILY SOLAR RADIATION: APPLICATION FOR SIZING OF A STAND-ALONE PHOTOVOLTAIC SYSTEM" ppsx
... indirect, although generally accepted correspondence exist for most standard applications.3,19 Secondly, based on the numerical method19 and the proposed hybrid approach (ANN-GA),24 we can determine ... During each epoch, the node outputs are calculated up to layer At layer 5, the consequent parameters are calculated using a least-squares regression method The output of the ANFIS is calculated and ... particular location It is the most important parameter for sizing of stand-alone PV systems.1–4 The application of PV system can be used for electrification of villages in rural areas, telecommunications,...
- 21
- 398
- 0
Báo cáo y học: "ISsaga is an ensemble of web-based methods for high throughput identification and semiautomatic annotation of insertion sequences in prokaryotic genomes" pdf
... AGCGCCATCATTCCAGTACAAAATTCCCCAGGGCCATTC CCTAGTCCTTTCCACAGCTCTCAAAATTTCCTCACACTC CTCCACAGA 00 GGTGAGAC AGTTGCAGCAGGACTATTCCATTCGCCAAATTTGTCAGGT CAAAATAAACCCACTCTTAACTTTTTCAACCAAGCGACATCACTTAAAG ... FLANKING REGION RIGHT GAACCTGTAGCCTCTGAAAACACCCTTACTCCCCAATAAATTCATTGAC 10 ATTCATTGACCTAGTTTTTGACAAGAAAGGGGGGCTCGTTTGAGCCCCC AAAGCCTCACTGTCCTTACACCTAACCAAAAACGGCAGAT GGTGAGAC 00 CTCCACAGA AGCGCCATCATTCCAGTACAAAATTCCCCAGGGCCATTC ... 99 CACTTAAAGTTGGTAGTGAAATACACCCAACCAATGCAGCAATTCCTGT Figure Part of the individual IS report This example shows the four complete copies of ISAcma18 from the genome of Acaryochloris marina The...
- 9
- 672
- 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... read accumulation; 3, statistical calculations Back end pre-processing tasks (microarrays): 1, background subtraction; 2, probe normalization; 3, probe accumulation; 4, statistical calculations ... replicates BMC Bioinformatics 2010, 11:564 11 Goecks J, Nekrutenko A, Taylor J: Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research ... samples We present ExpressionPlot, a software package consisting of a default back end, which prepares raw sequencing or Affymetrix microarray data, and a web -based front end, which offers a...
- 12
- 394
- 0
báo cáo khoa học: " A simple and high-sensitivity method for analysis of ubiquitination and polyubiquitination based on wheat cell-free protein synthesis" potx
... summarized in Additional file The first round of PCR was performed on each cDNA template using 10 nM of each of the following primers: a target protein specific primer (5'-CCACCCACCACCACCAatgnnnnnnnn nnnnnnnn-3'; ... Figure of (UPL7 and recombinant Arabidopsis HECT-type E3 ligases Analysis UPL5) Analysis of recombinant Arabidopsis HECT-type E3 ligases (UPL7 and UPL5) A, Production of FLAG-tagged recombinant UPL ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived...
- 11
- 349
- 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt
... best-performing competing methods such as PicTar, TargetScanS, and NBmiRTar HuMiTar has good computational efficiency and comparable signal-tonoise ratio when compared with TargetScanS and PicTar ROC analysis ... targets The B Comparison area the predictions specific to and the black HuMiTar The white area shows overlap area predictions and NBmiRTar indicated at number of Comparison of the number of predicted ... overlap with predictions of a competing method indicated at the x-axis, and the black area shows predictions specific to HuMiTar In the case of PicTar, the predictions are reduced to a set of miRs...
- 12
- 621
- 0
Báo cáo y học: "Gene expression-based screening for inhibitors of PDGFR signaling" potx
... 5'-AGC GGA TAA CGC TTC CCT TGA TCT GAC TGG-3' and 5'-AGC GGA TAA CAT GAT GCT GGG AAC AGG AAG-3'; ATP5B, 5'-AGC GGA TAA CCA AAG CCC ATG GTG GTT ACT3' and 5'-AGC GGA TAA CGC CCA ATA ATG CAG ACA CCT3'; ... CTG CTT TCC CG-3'; c- fos, 5'TGC CTC TCC TCA ATG ACC CT-3'; ATP5B, 5'-GAC TGT GGC TGA ATA CTT CA-3'; RPL2 3A, 5'-GTC TGC CAT GAA GAA GAT AGA A- 3' To select compounds that inhibited expression of ... RPL2 3A, 5'-AGC GGA TAA CAA GAA GAA GAT CCG CAC GTC-3' and 5'-AGC GGA TAA CCG AAT CAG GGT GTT GAC CTT-3' The following primers were used for single-base extension reactions: EGR1, 5'-TTC CCC CTG...
- 14
- 302
- 0
A behaviour based algorithm for encirclement of a dynamic target using multiple mobile robots
... obstacle-avoidance behaviour has the highest priority followed by target-encirclement, and target-tracking For instance, if Obstacle-avoidance Target-circumnavigation Target-tracking S S S : Suppress ... and ca are drawn with radii equal to D, from the vertices c, a and b Triangle abc is also an equilateral triangle with sides equal to D In another study, Yun, Alptekin, and Albayrak have proposed ... always cease the current behaviour and launch obstacle-avoidance behaviour 3.4 Encirclement Strategy The switching between target-tracking behaviour and target-circumnavigation behaviour plays a very...
- 132
- 256
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25