13 c nmr spectrum of a mixture of common nondeuterated solvents
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... repeat region of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and ... DUA(b1–3)GalNAc4S(b1–4)GlcA-ol: CS040# DUA(b1–3)GalNAc6S(b1–4)GlcA-ol: CS060# GalNAc6S(b1–4)GlcA-ol: CS#60# DUA(b1–3)GalNAc6S(b1–4)GlcA(b1–3)GalNAc6S(b1–4)GlcA(b1–3)GalNAc6S-ol: CS060606 DUA(b1–3)GalNAc4S(b1–4)l-IdoA (a1 –3)GalNAc4S(b1–4)l-IdoA (a1 –3)GalNAc4S-ol: ... DUA(b1–3)GalNAc6S(b1–4)GlcA-ol C B A A novel disaccharide, related to these trisaccharides has also been characterized, and the chemical shift data for this species, designated CS#60#, are also summarized...
- 11
- 481
- 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx
... hepatic process Changes in 1 3C- labeled glycogen C1 and C6 concentration (rate of 1 3C label incorporation, D13Glyc1 and D13Glyc6) were calculated by linear regression at speci c time points Data points ... were calculated from 1 3C NMR spectra with a temporal resolution of 4–8 as a result of averaging spectra collected with % temporal resolution 1 3C glycogen changes were calculated at % 2, % 3, and ... 6-phosphofructo-1-kinase, which can lead to increased 1 3C labeling at the triose level Such a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect...
- 9
- 465
- 0
Tài liệu A Mixture of Genius pptx
... most startling case of all," Ambly went on, "concerns the Nuclear Fission Society of Urania, Nevada It is not a well publicized fact that this quasi-academic group of adolescent physicists was exposed ... the fallacy which had made a fiasco of the project For was not maturity largely a matter of finding an acceptable place for oneself in the scheme of things? Was not maturity essentially a realistic, ... squirming, saw him perfunctorily place a hand to the baggy pocket of his jacket and quickly withdraw it, then arrived at a decision Reaching into his own coat, Duran took out the pack of cigarettes,...
- 22
- 375
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... the mature domain and CT-extension of Erv -C was PCR-amplified from this clone using primers (Forward: 5¢-CCCGGATCCATGGACATATCTACC-3¢ and Reverse: 5¢-GGTCTCGAGTTAAGCAAGTGGAAAAGCT-3¢) designed to ... the CT-extension remaining attached Moreover, this autocatalytic processing does not occur at acidic pH, instead autoactivation is found to occur at a basic pH of 8.0 By contrast, in rproErvCDCT, ... acts as an intramolecular chaperone to mediate correct folding of the protease [2] The mature catalytic domain of the enzyme of this family has a molecular mass of 21–30 kDa and shares a common...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... 1–68 Academic Press Inc., San Diego 28 Takahara PM, Rosenzweig AC, Frederick CA & Lippard SJ (1995) Crystal structure of double-stranded DNA containing the major adduct of the anticancer drug cisplatin ... induction and activation of DNA repair processes that, in general, confer chemoresistance to cancer cells The other pathway leads to programmed cell death through activation of proapoptotic genes such ... 50-mer target DNA substrates were treated with the drug in the presence of an excess of nonspeci c competitor calf thymus DNA mimicking randomsequence natural genetic material that can accommodate...
- 14
- 597
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... surface plasmon resonance (SPR) analysis indicate that IC specifically binds to membranes containing anionic phospholipids, rather than phosphatidylethanolamine (PE) A cellular localization analysis ... U-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4 742-95–12ER (Hamamatsu Photonics, Hamamatsu, Japan), and aquacosmos 2.0 software (Hamamatsu Photonics) Figures ... fluorescence microscopic analyses using IC–GFP revealed the cellular localization of IC–GFP at the vacuolar membranes and lumens during the stationary growth phase, suggesting that IC is specifically...
- 10
- 645
- 1
Tài liệu 13 Days The Chronicle of an Escape from a German Prison doc
... pfenning, comprised the following: Breakfast, coffee, of the war variety, probably made with acorns Dinner, soup, always containing lumps of mangel-wurzel, cabbage, black peas, and occasional pieces of ... submarine campaign arrived in the camp This did not look a all like a complete blockade of England! After careful thought a satisfactory explanation was forthcoming from the "under officer." "Of ... from an extremely crude state into what was really quite a respectable affair The main difficulty with which our theatrical manager had to contend, was the lack of material for "girls" in the caste...
- 71
- 446
- 0
Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc
... calculation H11 C1 1 C1 2–H12ax H17 C1 7 C1 8–H18eq H18ax. C1 8 C1 9–H19 H19 C1 9 C2 0–H20 H33 C3 3 C3 4–H34 H34 C3 4 C3 5–H35 H12ax. C1 2 C1 3–H13 H13 C1 3 C1 4–H14 H14 -C1 4 C1 5–H15 H15 C1 5 C1 6–H16eq H16ax. C1 6 C1 7–H17 ... (1984) Structure determination of a tetrasaccharide: transient nuclear Overhauser effects in the rotating frame J Am Chem Soc 106, 811– 813 41 Bax, A & Davis, D.G (1985) Practical aspects of two-dimensional ... coupling constants, a particular geometric restraint could be applied for the structure calculation of pimaricin Indeed, a long-range coupling constant 4JHO9,H1 0a ¼ 0.5–1 Hz was already non ambiguously...
- 9
- 522
- 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
... 2,2-biquinoline was added The mixture was incubated for 10 at room temperature and A5 46 was measured, using water as a reference A standard curve using 0–165 lm CuCl2Æ2H2O was also made and gave a calculated ... microorganisms-biotechnological and medical aspects Acta Biochim Pol 53, 429–443 21 Steenbergen JN & Casadevall A (2003) The origin and maintenance of virulence for the human pathogenic fungus Cryptococcus neoformans ... in Escherichia coli and characterization of the encoded tyrosinase Enzyme Microb Technol 38, 772–779 Kohashi PY, Kumagai T, Matoba Y, Yamamoto A, Maruyama M & Sugiyama M (2004) An efficient method...
- 13
- 778
- 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... of the protein backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated from the chemical shift values of backbone atoms 13Ca, 13Cb, ... polypeptide chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of ... C signal of the preceding amino acid, correlating the amide HN and the Ca signals, correlating the amide HN and the Ca signal of the preceding amino acid, correlating the amide NH with the Ca...
- 17
- 490
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... C- terminal helix Fig 11 A C- terminal helix is a characteristic feature of meiotic clade AAA ATPases Sequence alignments of some of the proteins listed in the PFAM database that contain the Vps4 C- terminal ... CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype Source EGY48 AMY245 MATa his3 trp1 ura3 LexAop(·6)-LEU2 MATa vps4-D::KanMx leu2 ura3 his4 lys2 bar1 MATa...
- 23
- 490
- 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx
... 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively ... ACC GCC CAC TGC CTT GTA GCC AGG-3¢ and a soluble form of TNSALP (V40 6A) , 5¢-GCA GCA AGG CTG CCT GCC TAG TGA TGG TGA TGG TGA TGG CTG GCA GGA GCA CA-3¢ TNSALP (V406L), TNSALP (V406I) and TNSALP (V406F) ... (V406F) were created using the QuikChange II Site-Directed Mutagenesis kit with the following primers: V406L, 5¢-CCT GGC TAC AAG CTG GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CCA GCT TGT AGCCAG G-3¢; V406I,...
- 11
- 500
- 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... without making myself ridiculous by a foreign accent As for my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish ... to wait It was not until the latter part of March that the Duke of Carmona came back to his mother's villa at Biarritz His arrival was not announced in the local paper, nevertheless I heard of ... that's all.” “Yes; that's all,” said Dick, laughing “And all that d'Artagnan had to was to get hold of a few diamond studs which a lady wanted to wear at a ball Sounds simple, eh? But d'Artagnan...
- 424
- 1,310
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG ... AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 1830–1881 of the MARCKS cDNA [38] and cloning the resulting doublestranded DNA into the SmaI site of ... 2–373 of HuD by PCR using clone kuniZAP-265114 as template and BamHI and SmaI sites containing primers (sense: 5¢-TAG CGG ATC CGA GCC TCA GGT GTC AAA TGG-3¢; antisense: 5¢-AAT GCC CGG GTC AGG ACT...
- 16
- 754
- 0
Báo cáo khoa học: In situ proton NMR analysis of a-alkynoate biotransformations ppt
... 2003 139 4 L Brecker et al (Eur J Biochem 270) Materials and methods Results Chemicals Isolation and characterization of the strain All chemicals were purchased from Sigma-Aldrich Chemical Co in ... isolated acetylene hydratase has been described, a purification, sequencing, and protein biochemical characterization of the initial acetylene hydratase is inevitable In case of the other, more common ... was decarboxylated to carbon dioxide and pyruvate About 90% of the latter metabolite was than further hydrolysed to acetate and formate Approximately 10% of the pyruvate was reduced to lactate,...
- 6
- 360
- 0
Báo cáo khoa học: NMR investigations of subunit c of the ATP synthase from Propionigenium modestum in chloroform/methanol/water (4 : 4 : 1) pot
... modestum and location of the a helical secondary structures in different subunit c preparations (a) Amino-acid sequence of E coli subunit c and location of a helices in the structure in chloroform/methanol/water ... presence of any long-range NOEs In particular, cross-peaks of aromatic protons could be completely assigned as short-range and medium-range NOEs (Fig 1) The secondary structure characteristic connectivities ... pH values indicated Resonance assignment Sequence-speci c backbone assignments for subunit c were obtained from 3D HNCA, 3D CBCA(CO)NH and HNCACB experiments using a 2-mM 15N/1 3C- labelled sample...
- 5
- 462
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... compactly folded C- terminal domain was interpreted as a consequence of the additional interaction between Ssa1p and the flexible N-terminal moiety of Ure2p, which is critical for assembly An alternative ... alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the N-terminal domain of the ... volume of 1% trifluoroacetic acid (TFA) This acidified sample was mixed : (v ⁄ v) with a saturated solution of sinapinic acid (10 mgÆmL)1 in 30% acetonitrile and 0.1% TFA) MALDI-TOF-TOF MS The samples...
- 12
- 510
- 0
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... FMNa Free TARFa TrxR wild-type TrxR E159Y mutant TrxR C1 38S mutant TrxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 1 0a) C( 1 0a) C( 10b) C( 10 c) C( 10d) C( 10e) N(1) ... mutant TxR C1 38S mutant TxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 1 0a) C( 1 0a) C( 10b) C( 10 c) C( 10d) C( 10e) N(1) N(3) N(5) N(10) 150.6 157.0 105.2 136 .0 ... pyrophosphate conguration as compared to that of native protein 13 C- NMR chemical shifts of the ribityl side chain Compared with FMN, the 1 3C chemical shifts of the sidechain carbon atoms are variably affected...
- 16
- 378
- 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... annotated In particular, the dNa(i,i+3) and dNa(i,i+4) connectivities are indicators of an a- helical secondary structure Intraresidual signals are not annotated (D) Summation of the experimental NMR ... broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared with random-coil data indicating an a- helical structure in an empirical pattern-recognition approach [13, 16] (B) ... unreliable So, instead, signal height of the cross-peaks was used for a conservative estimation of the maximum distances and classification of cross-peaks as weak, medium and strong For the calibration...
- 10
- 426
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... (a and c) of EW29Ch had a distinct chemical exchange on the chemical-shift timescale Site-speci c dissociation constants determined by NMR The site-speci c binding constants and chemical exchange ... subdomain c of EW29Ch [25] This interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal ... (Accelrys, San Diego, CA, USA) or the nmrpipe package [49], and analyzed using sparky software (Goddard and Kneller, sparky 3, University of California, San Francisco, CA, USA) 1H, 1 3C and 15N assignments...
- 11
- 458
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose