11 2 thêm phần cứng hoặc xử lý sự cố với các phần cứng thêm wizard
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
... 48 +++ 34 26 ++++ 24 24 ++ 105 48 ++ 114 41 ++ 72 42 10 ++ 75 25 11 ++ 96 46 12 ++ 74 34 13 ++ 118 42 14 ++ 60 28 15 ++ 101 49 16 ++ 48 40 17 + 96 35 18 + 48 11 19 + 48 31 20 + 72 18 21 + 48 UA ... ReA) AJ2 926 01 1,334 96.93 Uncultured soil bacterium (1 UA) AF 423 2 62 1 ,29 5 96.91 Unclassified proteobacteria (1 ReA) AY 820 722 1,383 96.46* Unclassified Rhodocyclaceae (2 UA) AY 328 759 1,388 99. 42 Bacteria ... Y09639 1, 324 98 .11 Variovorax sp (1 ReA) AB1964 32 1,383 99 .28 α Proteobacterium (1 ReA) AY1 620 46 1,308 99. 62 α Proteobacterium (1 ReA+ 21 UA) AY1 620 53 1,3 32 99.85 β Proteobacterium (1 UA) AF236007...
- 14
- 500
- 0
Báo cáo khoa học: Spermosin, a trypsin-like protease from ascidian sperm cDNA cloning, protein structures and functional analysis doc
... GSTL1(DL2) fusion proteins, was determined as described in Materials and methods GST-L1 129 GST GST GST-L2 97 129 GST-L1 (∆L2) GST 23 96 B GST alone GST-L1 GST-L2 GST-L1( GST-L1(∆L2) 28 kDa containing ... Biochem 26 9) Ó FEBS 20 02 Gn Hp In Bb A (kDa) 45 B 2- ME + - (kDa) 29 1.9 kb 28 kDa: IVGG 33 kDa: IVGG SEGP 40 kDa: IVGG SEST 40 33 28 C Signal peptide Light chain Heavy chain Preprospermosin H 23 97 ... sequences between L1 and L2 light chains revealed that the L1 but not the L2 had a region Ó FEBS 20 02 Cloning and characterization of ascidian spermosin (Eur J Biochem 26 9) 661 A 23 Fig Expression of...
- 7
- 493
- 0
Báo cáo khoa học: " Identification and prevalence of Ehrlichia chaffeensis infection in Haemaphysalis longicornis ticks from Korea by PCR, sequencing and phylogenetic analysis based on 16S rRNA gene" docx
... 92. 9 91.8 91.6 90.3 15 15 15 13 13 16 14 15 16 17 17 22 17 95 .2 93.9 91.4 91.4 91.1 17 17 17 16 17 15 20 21 22 16 16 19 17 19 92. 9 91.3 90.5 92. 1 21 21 21 25 26 20 13 14 15 27 27 28 24 28 24 27 ... 1 10 11 12 13 14 15 16 17 18 19 20 21 0 10 11 12 13 13 13 15 15 15 17 21 30 31 34 10 11 12 13 14 15 16 17 18 19 20 21 100 100 100 98.5 97.9 97.7 97.4 97 .2 96.9 96.4 96.4 96.4 96 .2 96 .2 96 .2 95.6 ... 24 27 90.4 91.6 91.4 30 30 30 27 27 27 33 32 33 31 31 35 34 31 34 34 38 99.7 91.5 31 31 31 27 27 26 34 33 32 32 32 34 34 32 34 34 38 91.8 34 34 34 29 28 28 30 32 31 33 33 30 31 35 35 30 31 31...
- 5
- 353
- 0
Báo cáo y học: " Comparative evaluation of INNO-LiPA HBV assay, direct DNA sequencing and subtractive PCR-RFLP for genotyping of clinical HBV isolates" pot
... plasmid as KWT1 KWT2 KWT3 KWT4 KWT5 KWT6 KWT7 KWT8 KWT9 KWT10 KWT11 KWT 12 KWT13 X59795 KWT14 AJ34 4116 AY1 6115 7 KWT15 AB033559 KWT16 AB0780 32 AY090453 AY741796 AB 126 581 AB1047 12 AY 721 605 Page of described ... AJ34 4116 -FRANCE, AY1 6115 7-INDIA, AB033559-PAPUA, AB0780 32- JAPAN, AY090453-SWEDEN, AY741796-IRAN, AB 126 581-RUSSIA, AB1047 12- EGYPT and AY 721 605-TURKEY) Ali et al Virology Journal 20 10, 7 :111 http://www.virologyj.com/content/7/1 /111 ... 118 0 Dasman 154 62, Kuwait Received: 12 April 20 10 Accepted: 30 May 20 10 Published: 30 May 20 10 © 20 10 Ali et available from: distributedLtd the terms of the Creative This is an Open Access7 :111 ...
- 5
- 370
- 0
Analysis, sequencing and in vitro expression of PCR products
... TGGGCTATAGACTTCGCCATTCTTCTCAAATACGCCACCGCTCCAGGAGCCTCCAATGGTAAAAACACGACCGTCTGACATGC 180 190 20 0 21 0 22 0 23 0 24 0 25 0 (C) GTAGCTGATGACTGATACCCACGAGCCACTTGCATGTCAGGTCCCGGGATCCAGCTATCGCTAGATGAATCATACAAACT 26 0 27 0 28 0 29 0 300 310 320 330 TGGTCTTCTTGGCATCGTTGCCACCTGTTGACTACGATCTGACCGTTACCATCCATGGAGATACCAGGCCAGAACATA ... direct Analysis, sequencing and in vitro expression of PCR products 107 14 15 16 17 18 19 20 21 22 23 24 DNA sequencing of allele-specific polymerase chain reaction-amplified HLA-DR genes BioTechniques ... Acids Res 16: 3 025 –3038 Mitchell LG, Merril CR (1989) Affinity generation of single-stranded DNA for dideoxy sequencing following the polymerase chain reaction Anal Biochem 178: 23 9 24 2 Mundy CR,...
- 24
- 494
- 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx
... CAD 624 46 CAD67773 NP_000563 AAC64705 CAA43090 A34853 43 .2 37.6 28 .0 28 .5 25 .2 25 .2 45.7 39.3 26 .6 26 .6 25 .1 25 .1 CAA24863 27 .4 AAB26148 28 .0 CAA24863 27 .0 26 .9 26 .6 25 .7 AAG16755 NP_0 6119 4 AAK 624 68 ... IL-10 (CAA24863), IL-10 (NP_000563), IL-19 (AAG16755), IL -20 (NP_0 6119 4), IL -22 (AAK 624 68), IL -24 (AAG41401), IL -26 (NP_0608 72) and interferon-a (P01579); from torafugu IL-10 (CAD 624 46); from ... splicing [29 ] Carp IL-10 shares a higher similarity to mammalian IL-10 (25 28 %), when compared with the other IL-10 family members (16 21 %) Spotted green pufferfish IL -20 (AY294560) and IL -24 (AY294560)...
- 8
- 584
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
... 10 11 12 13 Neutral Neutral Other Basic QH Basic QH Basic Y Basic Y Basic Y Basic Y Basic QH Basic QH Other Basic G 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 P1 P2 ... 42 42 44 47 + + D melanogaster homolog A gambiae homolog GC2555, GC1 327 , GC23 42 GC1919, GC1 327 AACO5656-5668 GC2341, GC 125 2, GC2360 GC 320 36, GC14959 GC14959, GC14301 GC16963 FEBS Journal 27 2 ... encoding a cuticular protein from rigid FEBS Journal 27 2 (20 05) 4774–4786 ª 20 05 FEBS M Iijima et al 12 13 14 15 16 17 18 19 20 21 22 23 24 cuticles of the giant silkmoth, Hyalophora cecropia...
- 13
- 582
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... specific light strand 26 27 28 29 30 31 32 33 34 35 36 37 38 39 transcripts from the displacement loop region J Biol Chem 25 8, 126 8– 127 5 Chau, C.A., Evans, M.J & Scarpulla, R.C (19 92) Nuclear respiratory ... Biochemistry 28 , 763–769 Ó FEBS 20 03 114 0 V Camasamudram et al (Eur J Biochem 27 0) Clayton, D.A (20 00) Transcription and replication of mitochondrial DNA Hum Reprod (Suppl.), 11 17 10 Shoubridge, E.A (20 02) ... polyadenylation site Gene Expr 4, 125 –141 21 Proudfoot, N.J., Furger, A & Dye, M.J (20 02) Integrating mRNA processing with transcription Cell 108, 501–5 12 22 Guo, Z & Sherman, F (1996) 3¢-end-forming...
- 13
- 415
- 0
DNA Sequencing – Methods and Applications Edited by Anjana Munshi pptx
... 0 .22 ( 0.30) (0.0) 80 0 .25 (0 .24 ) 0.38 (0.33) (0.0) (0.0) 90 0.83 (0.33) 1.74 (0.40) 0.14 (0 .11) 0.09 (0. 02) 100 GNAS (84% GC; 24 2 bp) 0.07 ( 0. 12) 75 0.76 (0 .23 ) 0. 62 (0.14) 0 .27 (0.41) 0 .20 ... (79%) 75 62. 2 (35.8) 91.6 (2. 6) 93 .2 (10.6) 99.6 (0 .2) 80 90 91.3 (1.6) 90.0 (3 .2) 92. 0 (1.1) 90 .2 (1.1) 99.5 (0 .2) 99.6 (0.1) 99.5 (0 .2) 99.4 (0.1) 3 62. 6 (20 4.1) 567.6 (95.4) 667 .2 (41.6) 535.6 ... 89.6 (22 .1) 91 .2 (17.4) 99.0 (0.5) 98.3 (2. 8)* 98.3 (2. 8) 90.8 (18.3) 99.4 (0 .2) 99 .2 (0.5) 1 62. 0 (54.9) 175.0 (25 .4) 164.4 (64.0) 194.6 (3.6) 193 .2 (0.4) 193 .2 (0.5) 193 .2 (0.5) 195 .2 (5.5)...
- 184
- 928
- 0
Báo cáo khoa học: Site-directed mutagenesis and footprinting analysis of the interaction of the sunflower KNOX protein HAKN1 with DNA ppt
... amounts (50, 100 and 25 0 ng) of either HAKN1 or I50K-HAKN1 to oligonucleotides BS1 and BS(mut7C) is shown Oligonucleotide sequences are shown in Fig FEBS Journal 27 2 (20 05) 190 20 2 ª 20 04 FEBS M F Tioni ... indicated in bold and underlined FEBS Journal 27 2 (20 05) 190 20 2 ª 20 04 FEBS 195 KNOX homeodomain–DNA interactions universally conserved among homeodomains [2, 31] The importance of this interaction ... Na–HAKN1 (a protein containing the N-terminal arm of MATa2) or R55K–Na–HAKN1 (a protein with both modifications) FEBS Journal 27 2 (20 05) 190 20 2 ª 20 04 FEBS M F Tioni et al of other homeodomain–DNA...
- 13
- 558
- 0
Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx
... )3 62 )23 3 ⁄ )21 4 )113 ⁄ )94 )97 ⁄ )78 )83 ⁄ )64 )71 ⁄ ) 52 ) 126 ⁄ )107 )146 ⁄ ) 127 )175 ⁄ )156 )22 9 ⁄ )21 0 )350 ⁄ )331 )396 ⁄ )377 )4 92 ⁄ )473 a In relation to the translation start site at ) 21 16 , ... ApaI ApaI ApaI ApaI )22 20 ⁄ )22 01 )36 ⁄ )17 ) 21 16 ⁄ )20 97 )17 12 ⁄ )1693 )837 ⁄ )818 )685 ⁄ )666 )637 ⁄ )618 )619 ⁄ )600 )599 ⁄ )580 )580 ⁄ )561 )560 ⁄ )541 )5 42 ⁄ ) 523 ) 523 ⁄ )504 )503 ⁄ )484 ... 915– 929 19 Laudes M, Christodoulides C, Sewter C, Rochford JJ, Considine RV, Sethi JK, Vidal-Puig A & O’Rahilly S (20 04) Role of the POZ zinc finger transcription factor 18 72 20 21 22 23 24 25 26 27 ...
- 14
- 340
- 0
Báo cáo khoa học: Tracking interactions that stabilize the dimer structure of starch phosphorylase from Corynebacterium callunae Roles of Arg234 and Arg242 revealed by sequence analysis and site-directed mutagenesis doc
... ± 0.4/n.a 2. 60 ± 0.06 /20 ± 2. 00 ± 0. 02/ 12 ± 0.5 4.45 ± 0.05/stableb 2. 93 ± 0. 02/ stableb + phosphatea 5 .2 (3.45 3.55 2. 27 ± ± ± ± 0.2c/stableb,c 0.03d/stableb,d) 0.02d/stableb,d 0.02d/43 ± 5d ... 23 4, 23 6 and 24 2 was interesting (Fig 2) Arginines are common components of protein interfaces and occur frequently at oxyanion-binding protein sites [20 ,21 ] Residues Arg234, Arg236, and Arg2 42 ... Biol 24 2, 321 – 329 22 Nandi, C.L., Singh, J & Thornton, J.M (1993) Atomic environments of arginine side chains in proteins Protein Eng 6, 24 7 25 9 23 Jones, S., Marin, A & Thornton, J.M (20 00)...
- 11
- 444
- 0
bioinformatics sequence and genome analysis - david w. mount
... in Fig 2. 2 COLLECTING AND STORING SEQUENCES IN THE LABORATORY s 21 Continued Figure 2. 2 22 s CHAPTER Figure 2. 2 Continued COLLECTING AND STORING SEQUENCES IN THE LABORATORY s Figure 2. 2 Example ... A, B, F Thus, hexadecimal 0F corresponds to binary 0000 111 1 and decimal 15, and FF corresponds to binary 111 1 111 1 and decimal 25 5 A DNA sequence is usually stored and read in the computer ... Nucleic Acids Res 25 : 3389–34 02 Bairoch A., Bucher P., and Hofmann K 1997 The PROSITE database, its status in 1997 Nucleic Acids Res 25 : 21 7 22 1 Barker W.C and Dayhoff M.O 19 82 Viral src gene...
- 565
- 510
- 0
Báo cáo hóa học: " Research Article Binocular Image Sequence Analysis: Integration of Stereo Disparity and Optic Flow for Improved Obstacle Detection and Tracking" pptx
... 50 100 100 150 150 20 0 20 0 50 100 150 20 0 25 0 300 50 100 150 20 0 25 0 300 100 150 20 0 25 0 300 (a) The stereo image pair at frame 60 50 50 100 100 150 150 20 0 20 0 50 100 150 20 0 25 0 300 50 (b) The ... MVD y (il , j) , are defined as 20 18 16 50 14 12 10 100 150 20 0 50 100 150 20 0 25 0 300 (a) No fusion Disparity map 20 18 16 50 14 12 10 100 150 20 0 50 100 150 20 0 25 0 300 (b) With fusion MVDx il ... for automotive applications,” EURASIP Journal on Applied Signal Processing, vol 20 05, no 14, pp 23 22 23 29, 20 05 [2] Y Huang, “Obstacle detection in urban traffic using stereovision,” in Proceedings...
- 10
- 363
- 0
Báo cáo hóa học: " Autoregressive Modeling and Feature Analysis of DNA Sequences" pot
... weak 22 EURASIP Journal on Applied Signal Processing 0 .26 0 .24 0 .24 Residual error Residual error 0 .26 0 .22 0 .2 0.18 0 .22 0 .2 50 100 Order 150 0.18 20 0 50 (a) 150 20 0 150 20 0 (b) 0 .26 0 .24 0 .24 ... [19] [20 ] [21 ] [22 ] [23 ] [24 ] [25 ] [26 ] [27 ] [28 ] [29 ] [30] [31] [ 32] [33] [34] [35] [36] [37] DNA: a signature of the nucleosomal structure,” Phys Rev Lett., vol 86, no 11, pp 24 71 24 74, 20 01 ... Analysis of DNA Sequences 19 0 .28 0 .26 0 .26 Residual error 0.3 0 .28 Residual error 0.3 0 .24 0 .24 0 .22 0 .22 0 .2 0 .2 0.18 50 100 Order 150 0.18 20 0 50 (a) 150 20 0 150 20 0 (b) 0.35 0.3 0.3 Residual...
- 16
- 331
- 0
Báo cáo khoa học: " Sequence Analysis of Canine LINE-1 Elements and p53 Gene in Canine Transmissible Venereal Tumor" doc
... * ** * * * * *A * * * * 954 3040 981 3 120 1008 320 0 1034 328 0 1061 3360 1088 3440 111 4 3 520 114 1 3600 116 8 3680 119 4 3760 122 1 3840 124 8 3 920 127 4 4000 127 5 4080 G A CT G C T A AC T C T G GG A ... Anim al Genetics 1996, 27 , 397-405 21 Singer, M F SINEs and LINEs : Highly repeated short and long interspersed sequences in mammalian genomes Cell 19 82, 28 , 433-434 22 Van Leeuw en, I S., Hellmen, ... products generated contiguous 4 ,25 1-bp cDNA sequences encoding 1 ,27 5 amino acids (hatched region of LINE-1 in Fig 2) A comparison with the human ORF2 revealed that canine ORF2 sequences had a 63% homology...
- 8
- 263
- 0
Minireview Maize DNA-sequencing strategies and genome organization Ron J Okagaki and Ronald L ppt
... genome Genome Biology 20 04, 5 :22 3 http://genomebiology.com /20 04/5/5 /22 3 Genome Biology 20 04, Volume 5, Issue 5, Article 22 3 Okagaki and Phillips 22 3.3 References 10 13 14 16 17 19 20 interactions 18 ... 22 3 .2 Genome Biology 20 04, Volume 5, Issue 5, Article 22 3 Okagaki and Phillips repetitive In contrast, 35% of the 95 ,23 3 methylation-filtered and 21 % of 100,000 high-CoT ... Martienssen RA, McCombie WR: Maize genome sequencing by methylation filtration Science 20 03, 3 02: 21 15 - 21 17 Whitelaw CA, Barbazuk WB, Pertea G, Chan AP, Cheung F, Lee Y, Zheng L, van Heeringen...
- 3
- 249
- 0
Signal sequence analysis of expressed sequence tags from the nematode Nippostrongylus brasiliensis and the evolution of secreted proteins in parasites potx
... Biology 20 04, 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Volume 5, Issue 6, Article R39 Harcus et al protective immunity to nematodes Immunol Rev 19 92, 127 :20 5 -22 0 Holland ... NBC0 027 2 144 2e-35 CE 324 75 YYNYS 0 .26 2 22 0.513 Y N Unknown NBC00 328 147 4e-36 CE00431 YYYYS 0. 523 17 0.999 Y N Globin NBC00581 122 7e -29 CE00431 YYYYS 0.404 21 0.998 Y N Globin NBC00601 93 5e -20 ... elegans NBC000 12 86 6e-18 CE2 022 3 YYYYS Y 80 3e-16 2 CE17 924 YYYYS 0.9 32 18 0.999 Y Y Unknown NBC0 023 7 84 5e-17 CE2 022 3 YYYYS 0.671 19 1.000 Y Y Unknown (similar to NBC000 12) NBC0 025 8 145 1e-35...
- 15
- 416
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu