1β gene expression and vasogenic edema development in a porcine model of intracerebral hemorrhage pdf
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx
... CCGCTATGACGCCATCTGCT R TGCACGACGAGGTCCTCACT AF019758 Decorin 55 319 F CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 ... evident at the lateral joint margin (panel f, arrowheads), and the area of most severe cartilage damage with surface fibrillation (rectangle, panel e) and the adjacent area (circle, panel d) are indicated ... GTGGGGAAACTGCACAACAT L47641 GAPDH 55 320 F TCACCATCTTCCAGGAGCGA R GGCGTGGACAGTGGTCATAA AF035421 Shown are the details of the primers used for RT-PCR, including annealing temperatures, size of the amplified...
- 10
- 416
- 0
Báo cáo y học: "The in vivo expression of actin/salt-resistant hyperactive DNase I inhibits the development of anti-ssDNA and anti-histone autoantibodies in a murine model of systemic lupus erythematosus" ppt
... units (AEU) relative to a standard positive sample that was assigned a value of 100 AEU The data are presented as mean ± standard error of the mean Statistics were performed comparing autoantibody ... calculated based on a standard curve of recombinant bovine DNase I (SigmaAldrich) In addition to the standard assay buffer, optimised to generate maximal DNase activity, inhibitors of wild-type DNase ... within that grade of glomerular hypercellularity Grades to IV are as described in Materials and methods ash.DNase I, actin-resistant, salt-resistant and hyperactive mutant of DNase I; wt.DNase...
- 11
- 558
- 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx
... biochemical markers of liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination ... multiplicity of infection; ELISA: enzyme-linked immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; ... LLC and A5 49 cell lines were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and maintained in 5% CO2 at 37°C in Dulbecco’s minimum essential medium (DMEM) containing...
- 10
- 696
- 0
báo cáo hóa học:" Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" doc
... biochemical markers of liver and kidney and the histological examination of hematoxylin and eosin stained major organs (Figure 5) Taking all these data into consideration, it appears that combination ... multiplicity of infection; ELISA: enzyme-linked immunosorbant assay; TUNEL: terminal deoxynecleotidyl transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; ... LLC and A5 49 cell lines were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and maintained in 5% CO2 at 37°C in Dulbecco’s minimum essential medium (DMEM) containing...
- 10
- 485
- 0
Báo cáo sinh học: "Combination immunotherapy and active-specific tumor cell vaccination augments anti-cancer immunity in a mouse model of gastric cancer" pdf
... Ishihara Y, Yamada A, Tanaka N, Itoh K, Harada M, Todo S: Immunological evaluation of personalized peptide vaccination in combination with a 5-fluorouracil derivative (TS-1) for advanced gastric ... IFN-g release and cell-mediated cytotoxicity after vaccination with mGC8 cells and GM-CSF T cells generated from TVDLN at day nine after vaccination were polyclonally activated and expanded as described ... presence of GM-CSF at the vaccine site, antigen-presenting cells (APC) are recruited, activated and capable of activating tumor-specific T cells in the vaccine-draining lymph nodes [33,37] A future aim...
- 14
- 454
- 0
Báo cáo y học: "Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonis" ppsx
... distribution was determined preoperatively and again on day using an incapacitance meter (IITC, Inc.) Briefly, an incapacitance meter consists of two scales and specialized caging to encourage a rearing ... Kinematic and dynamic gait compensations in a rat model of lumbar radiculopathy and the effects of tumor necrosis factor-alpha antagonism Kyle D Allen1,2, Mohammed F Shamji1,3, Brian A Mata2, ... during the early phase of lumbar radiculopathy may distinguish a focal unilateral pathology of lumbar radiculopathy from the generalized pain syndrome of lumbar spinal stenosis and IVD degeneration...
- 39
- 531
- 0
Effects of central nervous system free fatty acids, prostaglandins and lysophospholipids on allodynia in a mouse model of orofacial pain
... infection and neoplasms Neuralgic pain is generally expressed in the facial area as idiopathic trigeminal neuralgia The ill-defined category of atypical oral and facial pain includes a variety of pain ... data Ratio scale data is a type of cardinal data Cardinal data are on a scale where it is meaningful to measure the distance between possible data values There are two types of cardinal data: interval ... interval scale data and ratio scale data For cardinal data, if the zero point is arbitrary, then the data are on interval scale For cardinal data, if the zero point is fixed, then the data are on a...
- 91
- 468
- 0
Báo cáo y học: "Vasopressin improves survival in a porcine model of abdominal vascular inj" ppt
... differences in study end-points Materials and methods Surgical preparations and measurements The project was approved by the Austrian Federal Animal Investigational Committee, and the animals were managed ... oxygen at 20 breaths/minute, cmH2O positive end-expiratory pressure, and tidal volume adjusted to maintain normocapnia Anaesthesia was maintained with propofol (6 to mg/kg per hour) and a single injection ... (102.2°F) A 7-Fr catheter was advanced into the descending aorta via a femoral cutdown for withdrawal of arterial blood samples and measurement of arterial blood pressure A 7.5-Fr pulmonary artery catheter...
- 9
- 295
- 0
Báo cáo y học: "Gender-based reciprocal expression of transforming growth factor-β1 and the inducible nitric oxide synthase in a rat model of cyclophosphamide-induced cystitis" ppsx
... Figure Urine levels of active and latent/total TGF-β1 at baseline and after CYP Urine levels of active and latent/total TGF-β1 at baseline and after CYP Active and latent/total TGF-β1 values are reported ... emerge as a central mediator of the resolution of inflammation and induction of healing and in the bladder Our results therefore argue in favor of evaluating urinary TGF-β1 in IC patients in order ... reported as pg/mg of creatinine Panel A Urine levels of TGF-β1 at baseline In the absence of CYP injection, male and female rats excreted very low amounts of TGF-β1 Total (empty black triangle) and active...
- 13
- 244
- 0
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx
... pathway Celebrex COX2 Signaling mediated by p38-alpha and p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 p38 signaling mediated by MAPKAP kinases ... all patients Table 2: Glioblastoma drug targets Drug name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling mediated by p38-gamma and p38-delta pathway ... was quantified using Affymetrix Human Genome U13 3A Array Pathway network interactions dataset: Network information was obtained from the National Cancer Institute's Pathway Interaction Database...
- 26
- 278
- 0
báo cáo khoa học: " Plant origin and ploidy influence gene expression and life cycle characteristics in an invasive weed" ppsx
... oxidase (Weller et al 2000) CGTCGCATTCCAGATTATCCA CAACTACGGATATATAAGAGCCAAAAC TG ACAACATCCAGAAGGAGTCC GCAACACAGCAAGCTTAACC Ubiqutin Actin Gossypium hirsutum AAP73454 Weller et al 2000 [60] The annotation ... AAB57694 Chitinase, class II Arabidopsis At4g01700 Beta-1, 3-glucanase Doxey et al 2007 [35] Arabidopsis At4g14080 Standards Actin (01058) ACCAACATGAGAACAACCGATAC TCACACTGGTGTCATGGTCGGAAT Cytochrome ... Eurasian tetraploids and seven populations of Eurasian diploids (Table 2) Each leaf was immediately cut in half and the leaf tip was placed in a mL vial containing RNAlater solution (Ambion, Austin...
- 13
- 299
- 0
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis
... are critical pro-inflammatory mediators in AP and the associated lung injury SP-NK1R interaction is also a determinant of inflammatory edema in acute interstitial pancreatitis (Maa et al., 2000b) ... Originally published in Journal of Pharmacology and Experimental Therapeutics and Journal of Cellular and Molecular Medicine Yung-Hua Koh, Ramasamy Tamizhselvi, and Madhav Bhatia Extracellular ... pancreatitis Inflammation is an immunological response characterized by redness, swelling, heat, and pain localized to a tissue A rapid and prominent increase in pancreatic inflammation is a hall-mark of...
- 190
- 432
- 0
Gene expression changes in the brainstem and prefrontal cortex in a mouse model of orofacial pain
... an inflammatory response that induces pain This type of pain is known as inflammatory pain Inflammatory pain is due mainly to the action of prostaglandins and bradykinin, and substances released ... microarray-based approaches to examine gene expression and miRNA changes in the brainstem and prefrontal cortex in a mouse facial carrageenan injection model of orofacial pain At the brainstem level, increased ... 1.2 Major pathways for pain sensation from the body Adapted from Purves and Williams, 2001 13 Chapter I Introduction Orofacial pain Orofacial pain is defined by the American Academy of Orofacial...
- 179
- 428
- 0
Báo cáo y học: "Gene expression induced by interleukin-17 in fibroblast-like synoviocytes of patients with rheumatoid arthritis: upregulation of hyaluronan-binding protein TSG-6" doc
... amplification Gene Number TSG-6 GAT TTA GGT GAC ACT ATA GAA TAC CCA GGC TTC CCA AAT GAG TA TTG ATT TGG AAA CCT CCA GC CCA GGC TTC CCA AAT GAG TA GGC CAT TTT CTT GGA TTC CT CCG AAG TCA TAG CCA CAC ... nylon membrane After hybridization and washing, the array membrane was exposed to a phosphorimaging screen Data analysis was performed with AtlasImage Software 1.0 Expression values of transcripts ... without template was included Samples of six dilutions of the standard cDNA and of the target cDNA were run in triplicate in a Rotor -Gene 2000 (LTF, Wasserburg, Germany) Initial denaturation at 95°C...
- 7
- 323
- 0
Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx
... determination of polymorphisms in codons 54 and 57, a fragment of 315 base pairs (bp) was amplified using the following primers: 5'-ATAGCCTGCACCCAGATTGTAG-3' (forward primer) and 5'-AGAGACAGAACAGCCCAACAC-3' ... 68:688-693 Sasaki K, Tsutsumi A, Wakamiya N, Ohtani K, Suzuki Y, Watanabe Y, Nakayama N, Koike T: Mannose-binding lectin polymorphisms in patients with hepatitis C virus infection Scand J Gastroenterol ... with a mutant allele showed one band (of 315 bp) For codon 57, a fragment with a wild-type allele showed one band (of 315 bp), whereas the fragment with a mutant allele was cleaved into two bands...
- 4
- 318
- 0
Báo cáo y học: "Type I interferon receptor controls B-cell expression of nucleic acid-sensing Toll-like receptors and autoantibody production in a murine model of lupus" doc
... USA) PJU was a member of the scientific advisory boards of Monogram Biosciences, Inc (South San Francisco, CA, USA) and XDx, Inc (Brisbane, CA, USA) and is a cofounder of and consultant to Bayhill ... response in pristane-treated WT and IFNAR2-/- mice Serum from individual mice was used to probe lupus autoantigen microarrays that contained more than 50 candidate SLE autoantigens A table containing ... ligand binding and signal transduction through the receptor [27,28] Negative regulators of IFN and other proinflammatory cytokine signaling, including suppressor of cytokine signaling (SOCS1) and...
- 10
- 408
- 0
Multi-tissue gene-expression analysis in a mouse model of thyroid hormone resistance docx
... the amplification of APC, carbonic anhydrase 4, lysyl oxidase and somatostatin cDNA A total of 32 cycles were used for the amplification of tenascin C, enolase 3β (muscle) and creatine kinase ... selection and data analysis All array data were deposited in the NCI-CIT microarray database [65] where Cy3 and Cy5 signals were median normalized and expression ratios (Cy5/Cy3) were calculated The ... thyroid hormone and the primary mode of T3 action is a direct influence on cardiac gene expression [20] Increased heart rate (tachycardia) and myocardial contractility are clinical features common...
- 17
- 459
- 0
báo cáo khoa học: " Comparison of Radioimmuno and Carbon Nanotube Field-Effect Transistor Assays for Measuring Insulin-Like Growth Factor-1 in a Preclinical Model of Human Breast Cancer" doc
... conditions in the University of Maryland, Baltimore animal facility and maintained in accordance with institutional guidelines approved by the University of Maryland, Baltimore Animal Care and Use ... a pattern of progressive adenocarcinoma with similar genetic changes and pathophysiology as seen in human breast cancers associated with BRCA1-mutations [11,12] Additionally, as in human BRCA1-associated ... (upper and lower) An enlarged view of a cell indicating the contact surfaces of the source and the drain is shown to the right of the wafer Gate voltage is applied at the back of the wafer Also indicated...
- 6
- 329
- 0
Báo cáo khoa hoc:" A study of association between common variation in the growth hormone-chorionic somatomammotropin hormone gene cluster and adult fasting insulin in a UK Caucasian population" doc
... to assess the role of CSH1.01 variation in measures of fetal and postnatal growth and adult insulin resistance, as measured by fasting insulin concentrations and Homeostasis Model Assessment of ... JA, Dunger DB: Maternal-fetal interactions and birth order influence insulin variable number of tandem repeats allele class associations with head size at birth and childhood weight gain Diabetes ... necessary to carry out large-scale studies of CSH1.01 and fasting insulin in individuals spanning a wide range of ages We found no evidence of an association of CSH1.01 genotype with weight at year...
- 7
- 353
- 0
Báo cáo y học: " Abdominal wall and labial edema presenting in a girl with Henoch-Schönlein purpura: a case report" pptx
... case describes circumferential anterior abdominal wall edema and labial edema as a complication of HSP Gastrointestinal manifestations of HSP are common However, they usually result from edema ... and radiological edema of the labia majora, which was likely an extension of the abdominal wall edema A finding such as this has never been reported before, and may be the female equivalent of ... course of the next six days, she developed increasing abdominal pain and “distention” She also experienced significant pain in her genital area with associated labial swelling She was transferred...
- 4
- 302
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25