a prefabricated module may be needed only for a specific resource just power just cooling or just it space because of stranded capacity in their existing facility
Báo cáo y học: "Gene polymorphisms in APOE, NOS3, and LIPC genes may be risk factors for cardiac adverse events after primary CABG" pdf
... acquisition of data, or molecular genetic analysis and interpretation of data; SE, ABF and PL have been involved in drafting the manuscript or revising it critically for important intellectual content; ... Umbehr M, Plass A, Bestmann L, Maly FE, Zünd G, Turina M: Genetic polymorphisms of apolipoprotein E4 and tumor necrosis factor beta as predisposing factors for increased inflammatory cytokines ... cytokines after cardiopulmonary bypass J Thorac Cardiovasc Surg 2004, 128(1):92-7 Chaaba R, Smaoui M, Hammami S, Attia N, Ben Hamda K, Masmoudi AS, Mahjoub S, Bouslama A, Ben Farhat M, Girard-Globa A, ...
- 8
- 404
- 0
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx
... system for detecting heartbeats, interfaced to an RF data acquisition unit Sensor data can be continuously forwarded from the wearable to the base unit for two days before recharging the batteries ... data storage or a data processing unit can be replaced by a miniature transmitter However data forwarding wearables, which typically use RF, Bluetooth, or WLAN, are range-limited, and therefore ... transmissions) has a range of 10 m, making it ideal for Personal Area Networks (PAN) or communicating with a base station placed centrally in a small apartment Higher power Bluetooth has a range of up...
- 17
- 603
- 1
báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx
... female and male animals of different lines raised on a fattening farm of the southern region of GDR, and from 461 A. I boars of a breeding station Each sample (2.0 ml) was incubated at 37 °C for ... population in GDR Because of the lack of information about the family connections of the fattening pigs analysed and with the aim of verifying the estimate of frequency 461 A. I boars of different races ... animals from a local herd which had been studied However, it is remarkable that this type of aberration was found only in A. I boars of the Landrace Among 62 Landrace animals analysed, boars showed...
- 7
- 313
- 0
A study on the teachers' application of task-based method and the 10th form students' use of learning strategies in their listening lessons at Tran Phu High Sch
... gives a broad definition which includes two types of tasks: tasks that requires language, for example, making an airline reservation and tasks that can be performed without language, for example, ... prior knowledge or to other ideas in the new information; and inferencing, or using information in a text to guess at meaning or to complete missing ideas For the strategy of monitoring, ineffective ... First and foremost, the teachers must prepare activities that are interesting but not challenging Interesting activities can be in form of small games, quiz, matching pictures with information, and...
- 69
- 833
- 0
A cullin 1 based SCF e3 ligase complex directs two distinct modes of neuronal pruning in drosophila melanogaster
... GCGGCCAAGACTTTGTTAAG sox14 GAAAGATCTCCGAGCCACAG ATCTGGCTCCAAACCATGAA mical TTGGTGGGCTTCCTTAGATG GTTCAAACCGAGTCCGAGAG cul1 CCACATGCGAAGAGGTTCTTAT CAAGGATGGACTTGAGATCTGTC uba1 GATATCCTTCTGTCGGGACTTG ... to be degraded during pruning would be an attractive candidate Alternatively, the degradation pathway may regulate the protein stability of a key signaling molecule that is crucial for relaying ... larvae were transferred to standard culture medium containing the same amount of ethanol Larvae consumed rapamycin food for approximately hours before cessation of feeding The puparium formation...
- 147
- 173
- 0
The text doesn’t stop at the end of the page (or does it) an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime
... little bit harder Or maybe it was me Maybe it was a great job in a good pub and I should have been happy to have it Either way, once I’d finished there I vowed never to go behind a bar again Kevin ... at work, or even a tiff, sparked off by something as innocent as a shitty day, can rapidly spiral into a break-up and words said in the heat of such a row are not easily taken back That’s what ... question of how longform narrative in particular will fare as a result As a storyteller writing a novel set in a contemporary context, I became aware of the possible use-value of social media, in the...
- 317
- 311
- 0
Attention Homeowners: You may be eligible for a Montgomery County Property Tax Credit potx
... Programs The information contained in this pamphlet is brief and general Its purpose is to make you aware of the availability of the Homeowners’ Tax Credit Program for homeowners of all ages, including ... Maryland State Department of Assessments and Taxation (SDAT) at 1-800-944-7403 to order an application form • Download the form and instructions from the SDAT web site at www.dat.state.md.us/sdatweb/htc.html ... out an application form each year By filling out one form, your eligibility for each of these property tax credit programs will be reviewed by the State To get an application: • Call the Maryland...
- 4
- 251
- 0
Báo cáo sinh học: "Silencing the epidermal growth factor receptor gene with RNAi may be developed as a potential therapy for non small cell lung cancer" pot
... probe 5'FAM-ACGCCGTCTTCCTCCATCTCATA GCTAMRA3' Thermal cycler parameters included one cycle at 94°C for min, and 45 cycles involving denaturation at 94°C for 10 s annealing at 53°C for 30 s and ... improving chemosensitivity One of the commonly used drugs was cisplatin, a DNA-damaging anticancer agent It has been demonstrated that cisplatin modified DNA repair activity in a variety of different ... form formazan crystals by reacting with metabolically active cells Subsequently the formazan crystals were solubilized by 150 µl of DMSO The absorbance of each well was measured in a microplate...
- 12
- 314
- 0
Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf
... 1, indicating their coreferentiality For the sake of computational uniformity, we also attach reference tags to non-referring lexical elements In such cases, the tags denote lexical instead of ... referential identity For instance, the fact that the two tokens of subordinating conjunction dass ‘that’ in Fig carry the same tag, is interpreted by ELLEIPO as indicating lexical identity In combination ... treatment of Gapping and LDG An S-node dominates a superclause iff it dominates the entire sentence or a clause beginning with a subordinating conjunction (CNJ) In Fig 1, the strings dominated by...
- 4
- 456
- 0
Báo cáo khoa học: The outer membrane component of the multidrug efflux pump from Pseudomonas aeruginosa may be a gated channel pptx
... pump of P aeruginosa and showed that OprM forms a channel with some specificity for amino acids and peptides Furthermore, we present data indicating that OprM functions as a gated channel allowing ... TolC forms a channel in planar lipid bilayer membranes and that the pore size of the TolC channel appeared to be insufficient for the exportation of drugs or toxins Indeed, Koronakis et al [29] ... carbonic anhydrase (30 kDa), aldolase (42 kDa), albumin (66 kDa), a- galactosidase (116 kDa) and myosin (200 kDa); Lane 2, purified OprM; Lane 3, OprM treated with a- chymotrypsin Fragments are indicated...
- 8
- 317
- 0
SAURASHTRA UNIVERSITY RAJKOT MASTER OF ARTS (ECONOMICS)CHOICE BASED CREDIT SYSTEM COURSE OF STUDIES SYLLABUS (A draft of CBCS courses in M.A., Economics submitted for Revision of Curriculum to be executed from ,June, 2010)ByDEPARTMENT OF ECONOMICS SA doc
... for data analysis, Information processing, modeling and graphical presentation The advancements for PC software and declining prices of hardware are the key factors for their widespread use in ... husband and wife; Nuptiality Concept and analysis of marital status, single mean age at marriage; Synthetic cohort methods Unit-4: Fertility, Nuptiality and Mortality: Trends in age at Mortality ... Death rates, crude and age -specific; Mortality at birth and infant mortality rate Levels and trends in more and less developed countries; Sex and age pattern of mortality; Factors for decline in...
- 120
- 449
- 0
báo cáo sinh học:" "I won''''t be staying here for long": a qualitative study on the retention of migrant nurses in Ireland" ppt
... private sectors Unfortunately, beyond data on nationality and year of arrival as derived from immigration and registration data, no further information was available on the overall Page of 12 (page ... adaptation However, the reality is that migrant nurses are individuals who seek what many of us take for granted – a job, a salary, a family life For some, Ireland may be just the latest in a ... categories from the raw data" [26] Data management was facilitated by the use of the MaxQDA qualitative data analysis package Results Of the 21 nurses interviewed, only four stated that they intended...
- 12
- 495
- 0
báo cáo hóa học:" Validity of instruments to measure physical activity may be questionable due to a lack of conceptual frameworks: a systematic review" pot
... of the APA state that “the construct of interest for a particular test should be embedded in a conceptual framework, no matter how imperfect that framework may be [3] Our finding of a lack of ... importance of physical activity, it is challenging to define what physical activity actually means and how to capture the important aspects of physical activity Thus, a conceptual framework of physical ... Pulmonary Disease Activity Rating Scale (CARS) x - Life-related activities ’The dimension that deals with all aspects of human life in accordance with the International Classification of Functioning...
- 13
- 357
- 0
Monkey with a PinWhy you may be missing 6% a year on your investment returns pot
... ratio (TER) – the total of their expected fund annual management charge (AMC), administration costs, profit, legal fees and audit costs It has been increasing in recent years and, for an average ... 5% a year above that of the rate of inflation In contrast, holding cash has beaten inflation by only around 1% Take care with that word “cash” Normally you’d expect it to mean the returns and interest ... about it for a long period, sometimes many years During that period, they are absorbing information about investing from reading articles in papers and magazines, talking with friends and, of course,...
- 110
- 386
- 0
Báo cáo khoa học: "Barriers to adequate follow-up during adjuvant therapy may be important factors in the worse outcome for Black women after breast cancer treatment" doc
... had full access to all of the data in the study, and takes responsibility for the integrity of the data and the accuracy of the data analysis JF participated in the design of the project BRW and ... status was not available, we felt that health insurance status might act as an adequate surrogate for this factor At the time of initial treatment, 45% (N = 118) of the entire cohort was uninsured ... days) for the entire cohort This interval was not statistically changed based on race (median of 23 days for Black patients vs 22 days for the rest) or insurance status (charity care vs Medicaid...
- 10
- 292
- 0
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
... Cite this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis Journal of Immune Based Therapies and Vaccines ... manuscript All authors have read and approved the final manuscript Competing interests AH is a Director of Adjuvantix Ltd and also holds some stock in Adjuvantix Adjuvantix Ltd have an interest in CD40mAb ... Efficacy of human papillomavirus (HPV)-16/18 AS04-adjuvanted vaccine against cervical infection and precancer caused by oncogenic HPV types (PATRICIA): final analysis of a double-blind, randomised...
- 3
- 245
- 0
Báo cáo khoa học: "Deletions of neuraminidase and resistance to oseltamivir may be a consequence of restricted receptor specificity in recent H3N2 influenza viruses" doc
... all RNA segments, attached to T7 promoter sequences for additional length The primers were 5'-AATACGACTCACTATAAGCAAAAGCAGG, complementary to the 3' end of viral RNA and 5'-CGGAATTCAATACGACTCACTATAAGTAGAAACAAGG ... Kaverin NV, Gambaryan AS, Bovin NV, Rudneva IA, Shilov AA, Khodova OM, Varich NL, Sinitsin BV, Makarova NV, Kropotkina EA: Postreassortment changes in influenza A virus hemagglutinin restoring HA-NA ... to grow in the presence of an NA inhibitor, is not accompanied by changes in HA and appears to be a new mechanism of resistance to NA inhibitors; lack of requirement for NA activity as a consequence...
- 15
- 281
- 0
Báo cáo y học: "Local leptin production in osteoarthritis subchondral osteoblasts may be responsible for their abnormal phenotypic expression" doc
... system's manual (Amersham Pharmacia Biotech, Piscataway, NJ, USA) Rabbit anti-leptin receptor at a dilution of 1:1,000 (Cedarlane, Hornby, Ontario, Canada), rabbit anti-human actin at a dilution of ... chimera or the antagonist of leptin signaling AG490 would alter alkaline phosphatase activity in normal Ob Indeed, leptin addition to normal Ob stimulated vitamin D3-dependent alkaline phosphatase ... 5'-GGCTTTGGCCCTATCTTTTC-3' (sense) and 5'GGATAAGGTCAGGATGGGGT-3' (antisense) for Lep1; 5'-CCTCATCAAGACAATTGTCACC-3' (sense) and 5'CAGCATGTCCTGCAGAGACC-3' (antisense) for Lep2; 5'-GCCAGAGACAACCCTTTGTTAAA-3'...
- 13
- 192
- 0
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine ... dimethyl arginine (ADMA) in µmol/l, lactate in mmol/l, and mean arterial pressure (MAP) and central venous pressure (CVP) in mmHg Noradrenaline dosage was measured in µg/minute SOFA, Sequential Organ ... 0.005) ADMA levels Available online http://ccforum.com/content/10/5/R139 Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl...
- 7
- 265
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25