0

— a basic element for the construction of thermal hydraulic models and codes

Tài liệu

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Sức khỏe giới tính

... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... groups be addressed? V.8 V.8.1 A coherent and comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and...
  • 22
  • 703
  • 0
Tài liệu Đề tài

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Thạc sĩ - Cao học

... Thus, the left-hand sides of (3.31) and (3.60) are the same for this choice of Λ We leave it to the reader to check that the right-hand side of (3.60) is at least as large as the right-hand side of ... z, and (2.6) At any site z at which the particles in σ (2) have type A, the particles also have type A in σ (1) Let A (·, ρ) be the random-walk paths associated to the various particles and ... independently of each other The only interaction occurs when a B-particle and an A- particle coincide; the latter instantaneously turns into a B-particle [KSb] gave some basic estimates for the growth of the...
  • 67
  • 490
  • 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Điện - Điện tử

... most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria ... from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different kinds of ... frequently the cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable...
  • 201
  • 540
  • 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tiếp thị - Bán hàng

... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/ or law as classes of strategic ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.")...
  • 14
  • 780
  • 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Báo cáo khoa học

... transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative regulation of the human ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
  • 12
  • 621
  • 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học

... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
  • 9
  • 634
  • 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... horizontal transfer of vitamin C-related genes In the process of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form...
  • 11
  • 571
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học

... shown) The behavior of this band in the diatom is thus similar to that of the PsbPlike protein in cyanobacteria [3,12] The fact that C gracilis, P gyrans, L japonica and U pinnatifida contained bands ... optimizing the availability of Ca2+ and Cl– cofactors for water oxidation in the green lineage In fact, all of the thylakoid membranes from diatoms (C gracilis and P tricornutum), a haptophyte (P gyrans) ... PsbQ are 61 and 29% between spinach and C reinhardtii, respectively In addition, the green algal and higher plant PSII did not react with any antibodies against the cyanobacterial and red algal...
  • 11
  • 501
  • 0
Báo cáo

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Báo cáo khoa học

... dissipated  when  a new wave arrives and breaks. Thus, the time  variation  of TKE  is  relatively  small,  and the combination  of wave‐induced  flow  and undertow may transport TKE and suspended  ... suitable  for a practical  application.  On  the other hand, based on results of Nadaoka et al  [9], Ting and Kirby [15‐17], it can be estimated  that  in  the surf  zone,  the time  scale  ... wave  breaking  on  a natural  beach  To  verify  the accuracy  of the numerical  model  on  the simulation  of the wave  transformation  on  a natural  beach,  existing  experimental data on the wave dynamics in ...
  • 11
  • 460
  • 0
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

Vật lý

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated...
  • 8
  • 634
  • 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

Vật lý

... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration...
  • 12
  • 705
  • 0
báo cáo hóa học:

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

Hóa học - Dầu khí

... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 of the European Parliament and of the Council of 13 November 2007 on advanced therapy ... correlated with the "in vivo" effect of the cells and this must be addressed both in a suitable animal model and during a controlled clinical trial of acute myocardial infarction Basic and clinical ... with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone-marrow mononucleated cells used in cardiac regeneration Materials and methods...
  • 9
  • 773
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Hóa học - Dầu khí

... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... and state of activation, may not accurately reflect the status and behavior of their counterparts localized in the target organ In this latter regard, there is experimental evidence that the blood...
  • 12
  • 573
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Điện - Điện tử

... collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical ... scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay Working group critically ... interpreted the data and wrote the manuscript PR was a co-leader of this study, and was involved in all activities starting from the concept phase until final interpretation of results and approval of the...
  • 13
  • 752
  • 0
o cáo hóa học:

o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Hóa học - Dầu khí

... collection and assembly of data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical ... scientific aspects, data analysis and interpretation as well as manuscript writing and approval All authors read and approved the final manuscript The members of the CRI-CIC Assay Working group critically ... interpreted the data and wrote the manuscript PR was a co-leader of this study, and was involved in all activities starting from the concept phase until final interpretation of results and approval of the...
  • 13
  • 579
  • 0
báo cáo hóa học:

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

Hóa học - Dầu khí

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... analyzed the data and prepared the manuscript VB participated in the preparation of the bone cores and exposure of the samples to the different treatments, performed the microscopic analysis and helped...
  • 4
  • 403
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx

Hóa học - Dầu khí

... mg catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for ... Fig 2a, only the G band (tangential mode), D band (related to disordered graphite or amorphous) and a shoulder at 1604 cm-1 (the fundamental E2g mode of graphite) are presented In the lower wavenumber ... spectrophotometer at room temperature and in a backscattering geometry, with Ar laser at 514.5 nm Results and Discussion Figure shows the Raman spectra for materials grown at different growth temperature (a: ...
  • 4
  • 395
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Versatile Route for the Synthesis of Nickel Oxide Nanostructures Without Organics at Low Temperature" doc

Hóa học - Dầu khí

... by the solvents and organics in the structural evaluation of NiO nanostructures The EDX measurement indicates that nanoparticles are composed of Ni and O, and the analysis in the NiO nanoparticles/nanoflowers ... band and holes in valence band There is a sharp band in the PL spectra of NiO nanoparticles and nanoflowers at 380 and 490 nm, respectively The visible emission is related to the defects-related ... emission such as oxygen vacancies and Ni interstitials Finally, there are a weak and a broad visible emission band at 600 nm in both the spectra that is usually attributed Nanoscale Res Lett (2008)...
  • 5
  • 526
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Báo cáo khoa học

... earlier, the variances of the complex Gaussian random variables at the output of the Rayleigh simulator may have arbitrary values, depending on the variances of the Gaussian random variables at ... that, we have to calculate the variance of the outputs of Doppler filters, which may have an arbitrary value depending on the variance of the complex Gaussian random variables at the inputs of Doppler ... and (21)) As a result, the resultant complex Gaussian random variables {z j }N=1 in Z have zero means and variances j (powers) {σg j }N=1 j It is known that the means and the variances of Rayleigh...
  • 15
  • 602
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25