μm thick and that were of medium pore size the analytes were best visualized by combining the mixture of peptides with fluorescamine 3 mg ml in acetone at a ratio of 1 1 before
Báo cáo y học: "Summary The claudin multigene family encodes tetraspan membrane proteins that are crucial structural and functional components of tight junctions, which have important roles in regulating para cellular" pdf
... Claudin -17 Claudin-5 ‘Classic’ claudins ‘Non-classic’ claudins Claudin -10 b Claudin -15 Claudin-9 Claudin -11 Claudin-6 Claudin-4 Claudin -1 8a Claudin -3 Claudin -18 b Claudin-20 Claudin -12 Claudin -14 ... Claudin -14 Claudin-2 Claudin -19 b Claudin -1 9a Claudin -16 Claudin-7 Claudin -1 Claudin- 21 Claudin-24 Claudin-22 Claudin- 23 Figure A phylogenetic tree of full-length human claudin proteins, indicating the ... essential components of TJ structure and function TJs are found at the most apical part of the lateral surface of a sheet of epithelial cells and Nag and Morin: Genome Biology 2009, 10 : 235 235 .3 Table...
- 7
- 348
- 0
Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation
... pretreatment with saccharification Alkaline pretreatment and saccharification was examined by adding 3. 3 g of wheat straw in 10 0 ml monoethanolamine solution in a 200 ml shaker flask The monoethanolamine ... chemical pretreatments are acidic, alkaline, and water pretreatment Sulfuric acid and monoethanolamine (MEA) are applied as catalysts during acid and alkaline pretreatment No catalysts are applied ... temperatures and biomass concentrations: saccharification in the presence of xylanase; water pretreatment at 13 5 °C The results delineated that the increase in enzymatic hydrolysis temperature increased...
- 12
- 376
- 0
A study on syntactic, lexical semantic and rhetorical features of word groups containing words denoting seasons in vietnamese and english
... classifying data investigation are methods of collecting data Observation and - Analyzing data investigation techniques can be part of qualitative research as well as - Comparing and contrasting ... metaphor sentence and in finding ways and means of building larger and more and classification of metaphor All serve investigating WGsWS in elaborate spans of utterance syntactic, lexical-semantics ... our analysis and classification, the words spring/autumn to modify its number and aspect without changing its standing in front of and behind autumn in this word group are usually grammatical category...
- 13
- 1,056
- 1
Tài liệu Growth and nutritional status of children with homozygous sickle cell disease ppt
... Leonard MB, Zemel BS, Kawchak DA, OheneFrempong K, Stallings VA Plasma zinc status, 18 8 12 6 12 7 12 8 Published by Maney Publishing (c) W S Maney & Son Ltd 12 9 13 0 13 1 13 2 13 3 13 4 13 5 13 6 13 7 13 8 13 9 ... onset of puberty and sexual maturation were delayed Mean adult height was not attained in 96% of 75 SCD male Iraqi patients who were all 18 yrs of age, and 45% had delayed sexual maturation.55 In ... controls at the same stage of development of secondary sexual characteristics This suggested a variation in the rate of maturation of the hypothalamic–pituitary gonadotropin axis rather than gonadal...
- 25
- 602
- 0
Tài liệu Feaculty of Computer Science and Engineering Department of Computer Scienc Tutorial 3 Questions pdf
... beginning of the list Return the BST end generateBSTfromList Advanced Questions Question 11 Devise an algorithm that takes two values, a and b such that a < b, and which visits all the keys x in ... return a; c return (b= =1) ?a: a+mul (a, b -1) else return a+ mul (a, b -1) Algorithm pow (val a , int b ) Pre a, b >=0 Return the power ab The only two arithmetic operations that you are allowed ... recursive algorithm for the following problems b Find and return the maximum element in an array, where the array and its size are given as parameters Algorithm compute (val a , val n ...
- 4
- 469
- 1
Tài liệu SEXUAL AND REPRODUCTIVE HEALTH OF PERSONS WITH DISABILITIES doc
... and AIDS and other sexually transmitted infections, and sexual and a growing body of research indicates that persons with disabilities are at increased risk of HIV and AIDS .10 In addition to their ... and AIDS and other sexually transmitted infections, and sexual and a growing body of research indicates that persons with disabilities are at increased risk of HIV and AIDS .10 In addition to their ... rights, household and family formation, and international migration, while taking into account health and other considerations relevant under national immigration regulations Paragraph 8.7 Governments...
- 6
- 524
- 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10 rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18 Sfw CGCCGCTAGAGGTGAAATTC 18 Srev TCTTGGCAAATGCTTTCGCT TaqMan probe ... reverse A B Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11 rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ... 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC -3 and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC -3 and its complement for His8Ala (substituted nucleotides are underlined)...
- 14
- 601
- 0
Báo cáo khoa học: Regulated expression by PPARa and unique localization of 17b-hydroxysteroid dehydrogenase type 11 protein in mouse intestine and liver pdf
... recombinant 17 b-HSD 11 is shown in Fig 1B The amounts of 17 b-HSD 11 protein were markedly induced in both the mouse intestine and liver by administration of the PPARa agonist The induction ratios in ... 4 838 Results 17 b-HSD 11 protein is greatly induced in the intestine and liver by a PPARa agonist To confirm our previous observation at the mRNA level that 17 b-HSD 11 was greatly induced in the intestine ... differentiation-related protein (ADRP) and long-chain acyl-CoA synthetase (ACSL3) among 17 major proteins associated with the LDs formed in the human hepatocyte cell line HuH7 17 b-HSD 11 is associated with...
- 11
- 497
- 0
Greasy palms - The social and ecological impacts of large-scale oil palm plantation development in Southeast Asia docx
... that many oil palm plantations in Indonesia and East Malaysia are planted in areas that were clearly forested immediately prior to conversion to plantation In Sembuluh, Central Kalimantan, at the ... PAS, the leading Islamic party in the State Sungai Paka Forest Reserve lies on the slopes of the Eastern Highlands of Peninsular Malaysia Being isolated from the Main Range, the flora and fauna of ... Plantation, PT Sindora Seraya, PT Dumai Industrial Zone, PT Tri Bhakti Sarimas and PT Jatim Jaya Perkasa.86 Early in May 20 03, the Malaysian company PT Adei Plantations (95% owned by the Malaysian...
- 54
- 2,322
- 0
Báo cáo khoa học: Insulin like growth factor-1-induced phosphorylation and altered distribution of tuberous sclerosis complex (TSC)1⁄TSC2 in C2C12 myotubes pptx
... CA, USA) Plasmids pcDNA3 .1- myc-TSC1 (12 13 3 ), pcDNA3-Flag-TSC2 (14 129), pcDNA3-Flag-TSC2-S 939 A (14 13 2 ), pcDNA3Flag-TSC2-T146 2A (14 13 0 ) and pGEX-2TK -14 -3- 3 beta FEBS Journal 277 (2 010 ) 218 0– 219 1 ... Protein samples were collected at 10 , 30 and 60 after the initiation of IGF -1 stimulation (A) Changes in phosphorylation states of Akt (T308 and S4 73 sites) and S6K1 (T389 and T4 21 ⁄ S424 sites) were ... that was bound to 14 -3- 3 protein We found that the phosphorylation level of TSC2 protein at the S 939 and T1462 sites, which was associated with 14 -3- 3 protein, was increased after IGF -1 stimulation...
- 12
- 411
- 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... ligated into pET-2 8a to produce plasmids pSIB1-Cd and pSIB1 -a3 +Cd, respectively The sequences of the 5¢ PCR primers were 5¢-AGAGAGAA TTCATATGTCAGATTTGTTCAG -3 for N-domain+, 5¢CTGAAAACGCTAAGCATATGGGTATTACGA -3 ... C-domains of the homodimer, such that these domains are located with an appropriate distance and orientation Because of the high similarity in the amino acid sequence of SIB1 FKBP22 with that of ... C-domain+, and C-domain– The primary structures of these variants are schematically shown in comparison with that of the intact protein in Fig Because a long a3 helix spans both the N- and C-domains,...
- 11
- 332
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... analysis of LPS from strains RM 118 lgtC lic 3A, RM 118 lgtC, RM 118 (wt), RM 118 lic 2A, RM 118 lpsA and RM 118 lgtF before and after treatment with neuraminidase (as indicated by – and +, respectively) The ... removed by the hydrazinolysis treatment used to O-deacylate LPS [11 ] The molecular mass of the major sialylated glycoforms in the lgtC lic 3A double mutant (33 81. 6 and 35 46.0 Da) indicated the presence ... RM 118 lic 2A Relative intensity 11 81. 0 RM 118 Calculated molecular ion 11 81. 4 RM 118 lgtC lic 3A Observed molecular ion 11 26.0 RM 118 lgtC [M-2H]2– 10 05.2 Strain 16 09 .3 32 21. 1 32 21. 5 0.40 3Hex, 3Hep,...
- 11
- 579
- 0
Sexuality Issues and Gynecologic Care of Adolescents with Developmental Disabilities potx
... V Adult size Adult size Adult distribution (medial aspects of thighs, linea alba) 13 18 y 13 1 9 13 2 0 Greydanus & Omar Table Variations in pubertal changes Pubertal Changes Age Range of Appearance ... and their youth .1, 5,8 ,11 ,26 , 31 ,33 , 51 61 The birth of a baby can give parents considerable joy and start them off on a journey of fantasy about the wonderful things their child may that will make ... able to avoid unwanted sexual touching and assault.8,22,28, 51, 60 ,12 4 ,12 5, 13 3 , 13 5 , 13 8 ,15 2 15 4 It is important to educate adolescents and parents about the danger of unwanted sexual overtures and...
- 21
- 286
- 1
The effect of Qigong on general and psychosocial health of elderly with chronic physical illnesses: a randomized clinical trial doc
... 36 .6 3. 62 35 .00 1. 65 34 .55 2.65 1. 054 0 .35 9 31 .45 5 .38 31 . 53 3.06 30 .64 3. 63 30.74 3. 57 29.64 3. 27 0 .12 7 0.8 81 2 .10 2.68 3. 46 3. 20 8.78 9 . 31 15 .26 11 .74 3. 01 2.48 3. 84 3. 31 10.65 11 .75 12 .94 13 . 90 ... categorized into four domains, including physical health domain, psychological domain, social relationship domain and environment domain The Cronbach alpha values Int J Geriatr Psychiatry 20 03; ... 20 01) There are three main features of qigong: postures and movement, state of mind, and breathing The aim of practicing qigong is to cultivate qi to help the organism stay healthy and vital In...
- 9
- 555
- 0
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc
... synthesized by the classical x6-pathway, the classical x3-pathway, a pathway relying on intermediates of both of these pathways and by an alternative x3-pathway involving D9-elongation and D8-desaturation ... 20:1D8 b 20:1D 11 b 20:2D 11, 14 b 20:3D 11, 14 ,17 20:3D8 ,11 ,14 2.0 3. 7 11 .8 10 .8 24.7 16 :1D9 a 18 :1D9 a 18 :2D9 ,12 18 :3D9 ,12 ,15 5.7 5 .3 27.8 26.7 20:3D8 ,11 ,14 ± 0.2 ± ± ± ± 0.7 1. 0 0 .3 3 .3 a In the absence ... 20:3D8 ,11 ,14 and ARA were synthesized (Fig 4A) About 50% of 18 :3D6,9 ,12 was elongated by Pse1p and 15 % of the resulting 20:3D8 ,11 ,14 was converted to 20:4D5,8 ,11 ,14 by PtD5p Similarly, when 18 :4D6,9 ,12 ,15 ...
- 9
- 455
- 0
classical and quantum mechanics of systems with constraints
... number of primary constraints relating the coordinates and momenta for all times .3 Note that we can prove that theories with singular Lagrangians involve primary constraints in an in nitesimal manner ... way by introducing the so-called mass matrix, which is defined as: ∂ L (1) MAB = (11 ) ˙ ˙ ∂ QA ∂ QB Then, equation (10 ) is equivalent to demanding that the minor of the mass matrix A B associated ... proof reaffirms that singular Lagrangians give rise to primary constraints Note that the converse is also true, if we can find a linear combination of momenta that has a vanishing ˙ ˙ ˙ derivative...
- 45
- 334
- 0
báo cáo hóa học: " Kinematics and muscle activity of individuals with incomplete spinal cord injury during treadmill stepping with and without manual assistance" docx
... walking with or without manual assistance Data were averaged separately for the stance and swing phase Joint Without Manual Assistance (°) With Manual Assistance (°) Ankle Stance Swing 18 .8 13 . 5 ... showed that the difference in means of the Rvalue for the ankle joint profile was greater than the calculated least significant value This indicates that there is a 95% chance that there actually ... et al found that faster stepping speeds increase afferent input and efferent activity during walking in individuals with spinal cord injury [28] Other studies indicated that step training at faster...
- 14
- 434
- 0
Báo cáo hóa học: " The molecular dynamic simulation on impact and friction characters of nanofluids with many nanoparticles system" pot
... original manuscript XJL participated in discussion of the results and in revising the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they ... Probing transport mechanisms in nanofluids by molecular dynamics simulations 18 th National and 7th ISHMT-ASME Heat and Mass Transfer Conference, Paper No HMT-2006-C 339 , IIT Guwahati, India, January ... Preparation of Ni nanoparticles and evaluation of their tribological performance as potential additives in oils J Tribol 20 01, 1 23: 4 41- 4 43 Chinas-Castillo F, Spikes HA: Mechanism of action of...
- 8
- 295
- 0
HIV-INFECTION – IMPACT, AWARENESS AND SOCIAL IMPLICATIONS OF LIVING WITH HIV/AIDS ppt
... Epidemiological Data 47 Anatole Tounkara, Abdulrahman S Hammond, Bassirou Diarra, Almoustapha Maiga, Yaya Sarro, Amadou Kone, Samba Diop and Aboubacar Alassane Oumar Part Clinical Evidence of Secondary Manifestations ... Awareness and Social Implications of Living with HIV/AIDS interface contains an antiparallel β-sheet formed by the interdigitation of the N- and Cterminal β-strands in each subunit and by an interlocking ... compared with three cases in the early treatment arm (P=0.00 13 ) There were 23 deaths during the study: 10 in the early treatment group and 13 in the delayed treatment group, a difference that...
- 346
- 396
- 0
Báo cáo khoa học: "Relation between lymphocyte subpopulations of peripheral blood and immune responses of modified live hog cholera virus vaccine in pigs treated with an ionized alkali mineral complex" docx
... 24. 03 3. 19 31 .80 1. 82 Con 32 .97±0.94 26. 03 3. 55 29 . 31 3. 04 37 .45±6.2 6a 42. 23 4.6 2a T -1 35 .77±4.52 a, b a, b T-2 24 .35 ±0.65 42.80±2.85 36 .62 1. 9 8a, b a T -3 36.80±4.78 37 .11 1 .38 51. 10±5 .32 ... 10 .45±2. 23 23. 40±2.00 T -1 16 .18 1. 77 21. 84±2.77 T-2 18 .70±0.70 21. 89 3. 10 19 .76 1. 5 7a T -3 20 .35 ±2.64 26. 21 1. 74 23. 83 4.04 Con 16 . 93 3. 00 22. 91 2.60 25 .19 1. 23 All pigs were vaccinated with ... Con 37 .12 ±2.75 50.88±4.07 57.48±4.97 3. 94±0.6 0a, b 16 .10 ±0.90 T -1 7.98 1. 67b b T-2 9.55±0 .15 6. 73 0.7 8a 11 . 63 1 .39 a, b T -3 11 .78±0.75 8.77 1. 21 18. 43 2. 83 13 . 37±4.28 18 .33 1. 29 Con 10 .45±2.23...
- 4
- 374
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25