δ 2 t cells

Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps

Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps

... activity [17 ,20 ,21 ] Together these data suggest that RA patients may benefit from therapies aimed at the regulation of the Th cell balance towards Th2 cell activity It also implies that intrinsic ... organs [28 ] may contribute to this relatively enhanced peripheral Th2 activity in RA patients compared to healthy controls The reduced capacity of Th2 cells to migrate to the arthritic sites could ... major Th2-defining cytokine) in human naive CD4+ T cells include costimulation via CD28 in concerted action with TCR engagement [22 ] It has been shown in humans [22 ,23 ] and in mice [24 ,25 ] that,...

Ngày tải lên: 09/08/2014, 01:23

8 270 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... 5'-AGC CGG AAG GTT ATT GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T- 3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T- 3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' FACS sorting, by using ... upper 5'-GGC ATA CGC CAG TCA AAT A-3' mTLR1 lower 5'-ATG CAG AAA TGG GCT AAC TT-3' mTLR2 upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT GTT CTC GT-3' mTLR4 upper 5'-AGC ... alloreactive CTLs to proliferate and to secrete IFN-γ via TLR -2 adds another facet to the functional potential of T effector cells The fact that the same stimulatory signal leads neither to the release...

Ngày tải lên: 09/08/2014, 01:23

14 506 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

... based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen uptake [1,14-16] A previous study demonstrated that CD11c+CD11b+ ... (5'-CACTGTACCAGTGCAGTAG-3') and antisense (5'-ACCATTCACACACT CGTTAT-3') primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG-3') and antisense (5'CATTTGCCACGAGTGGGTAG-3') primers PCR products ... subsets and the maturation state of the DCs [1, 12] One mechanism, exploited by tolerogenic DCs, involves IDO [17 -21 ] IDO-competent DCs exert regulatory effects on T cells that are mediated by tryptophan...

Ngày tải lên: 09/08/2014, 10:22

10 473 0
Báo cáo y học: "IL-2 production correlates with effector cell differentiation in HIV-specific CD8+ T cells" doc

Báo cáo y học: "IL-2 production correlates with effector cell differentiation in HIV-specific CD8+ T cells" doc

... 0 .2 Ratio of IL -2+ to IFNγ+ cells 0.1 0.0 http://www.aidsrestherapy.com/content/3/1/18 terminal effector T cells (CD27- CD28- CD45RA+) responding to HIV (Figure 7) This is despite the fact that ... cohort of 19 HIV-positive subjects with progressive disease and 20 healthy controls (Table 1) Since activation of T cells was required to detect cytokine production, we wanted to ensure that the ... result of reduced CD4+ T cell counts in the HIV-positive subjects, since the differences were not statistically significant on a percentage basis (Table 2) It should be noted that the distribution...

Ngày tải lên: 10/08/2014, 05:20

14 273 0
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

... Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after culture with 20 0 U/ml human recombinant IL -2 (B) Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after co-culture ... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... pair: sense 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures,...

Ngày tải lên: 10/08/2014, 10:21

10 300 0
Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot

Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot

... ability of HTLV-1 and HTLV -2 derived RBDs to bind to parental and transfected 29 3T cells correlated with the data obtained using the C-term Glut-1 antibody As we expected from previous studies, ... of the data presented here strongly indicates that mAb1418 does not detect endogenous Glut-1 but rather interacts with a cell surface protein that is associated with Glut-1 overexpression in transformed ... not in a fully active state In a representative experiment where we compared PHA activation with the anti-CD3/CD28 antibody stimulation used here, the percentages of cells that had entered into...

Ngày tải lên: 13/08/2014, 09:21

9 283 0
Alloreactive t cells and cytokines in murine graft versus host disease 2

Alloreactive t cells and cytokines in murine graft versus host disease 2

... CGACAGATACGATCGATCAA–3’ Reverse 5’- AAGCATATCCTATCGATGAT–3’ Forward 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’ Reverse 5’- ATCCATCTGGCTAGGTCAGG–3’ ... GCTGGAGAGCTACAAGAGGATCA 3’ Reverse primer: 5’ TCTCTCTTGAGCTTGGTGACAAAA 3’ 5’ CTACAGCTTCTTTGGGACACCTGCTGCT 3’ Forward primer: 5’ AGTGATAAGGAATGCACGATGCT 3’ Reverse primer: 5’ TGAGGTCTTTGAGGGATTTGTAGTG 3’ Probe: ... TTACCTGATCGGCTACACTG–3’ Reverse 5’- GGTCTACATCGATCGCTACT–3’ Forward 5’- ATAGACTCTCCGATATAGCT–3’ Reverse 5’- TAGCTATCGATCGATCGTAA–3’ Forward 5’- AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’...

Ngày tải lên: 16/09/2015, 17:13

24 258 0
Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

Báo cáo y học: "Association between regulated upon activation, normal T cells expressed and secreted (RANTES) -28C/G polymorphism and asthma risk – A Meta-Analysis"

... mast cells [22 ] It has been shown that RANTES induces recruitment of eosinophils and their up regulation into the airways of asthmatic patients causing tissue damage [23 -25 ] Both atopic asthma ... consistent with the hypothesis from previous studies that the -28 C/G polymorphism with higher activity of RANTES may be more important in asthma risk, although the association was not significantly ... to affect the transcription of the RANTES gene In human cell lines, the -28 G was shown to increase promoter activity of RANTES in comparison with the more frequent -28 C, suggesting that the polymorphism...

Ngày tải lên: 26/10/2012, 09:39

7 525 0
Đề thi thử ĐH lần 2 T.Anh ( có key )

Đề thi thử ĐH lần 2 T.Anh ( có key )

... I needn t ) A I needn t have time to write that letter B I needn t have written that letter C I needn t having written that letter D I needn t wrote that letter 69 “Let’s check everything once ... ) A It is a pity that I didn t apply for that job B It is a pity that I applied for that job C It is a lucky that I didn t apply for that job D It is a pity that I is not applying for that job ... important part in conversation C Therefore, the prevention of waste is an important part in conversation D Therefore, the prevention of waste is not an important part in conversation ………………….The...

Ngày tải lên: 29/07/2013, 01:26

5 433 1
Lop 2- T 11

Lop 2- T 11

... 21 = 12 = 12 = b) 12 = 12 =3 12 = 12 = 12 Bài 2: Yêu cầu HS làm vào SGK =5 12 12 12 12 - HS đọc yêu cầu - Nhận x t Bài 3: - Đ t tính t nh hiệu, bi t số bị trừ số trừ lần l t: a 12 ... đ t tính t nh Bài 3: T m x - Yêu cầu HS làm vào nháp 12 = 12 = 12 = 121 0 = - Đ t tính t nh 62 72 32 27 15 35 57 24 - em lên bảng x + 18 = 52 x = 52 18 53 19 72 36 36 72 x = 34 x + 24 = 62 ... 1: K t hợp n t cong trái lợn vào - N t 1: Giống n t của chữ H (Đ t b t đờng kẻ 5, vi t n t cong trái lợn ngang) - N t 2: T điểm đ t b t n t đổi chiều b t vi t n t móc ngợc trái, - GV vi t mẫu...

Ngày tải lên: 28/08/2013, 23:10

23 255 0
Lop 2-T 4-chuankien thuc

Lop 2-T 4-chuankien thuc

... t m , k t - Muốn bi t có ? que t nh ta làm nh 74 , nêu cách t m k t ? - T Nhận x t , thao t c lại cách t m k t - H làm thao t c theo T hay - Yêu cầu H lên bảng đ t tính t nh - H đ t tính t nh ... cách đ t tính t nh 18+3, 38+4, 58+5 Cần ý H vi t k t c t Đ t tính thẳng c t Bài 2: T nêu yêu cầu t p T vi t bảng đề - T yêu cầu số HS thực t nh để kiểm tra k t Bài 3:Giải toán có lời văn -T hỏi ... dò: ( 2) xơng ph t triển t t - T nhận x t ti t học Ti t : Âm nhạc : Học h t : xoè hoa I Mục tiêu : Giúp HS : - Bi t h t dân ca - Bi t h t theo giai điệu lời ca - Bi t h t k t hợp vỗ tay gõ...

Ngày tải lên: 19/09/2013, 10:10

21 268 0
Lop 2-T 5-chuankien thuc

Lop 2-T 5-chuankien thuc

... câu: tuần I MUC TIÊU: - Bi t phân bi t từ v t nói chung với t n riêng v t nắm đợc quy t c vi t hoa t n riêng Vi t Nam ( BT1) ; bớc đầu bi t vi t hoa t n riêng Vi t Nam ( BT2) - Bi t đ t câu theo ... nhận x t , t m nhóm thắng -Nhận x t học - VN làm t p lại VBT Thứ ngày 26 tháng năm 20 08 Toán: Luyện t p Ti t : MUC TIÊU: - Bi t giải trình bày giải toán nhiều t nh khác - BT 1 ,2, 4 II Ho t động dạy ... Nghe phân t ch đề toán -T nêu toán : -Có 38 que t nh, thêm 25 que t nh Hỏi có - H thao t c que t nh, nêu k t ( t t ? que t nh? nhiều cách) 38 +25 =34 - Y/c H sử dụng que t nh để t nh k t - T sử dụng...

Ngày tải lên: 19/09/2013, 14:10

18 222 0
GIÁO AN 2 T 1CHUẨN KTKN

GIÁO AN 2 T 1CHUẨN KTKN

... em thuận hòa( lần) Chữ vi t rõ ràng, t ơng đối n t, thẳng hàng, bước đầu bi t nối n t chữ vi t hoa với chữ vi t thường chữ ghi tiếng -Ở t t tập vi t, HS khá, giỏi vi t đủ dòng( t p vi t lớp) trang ... ……………………………………………………………………………………………………………… 26 Môn: Luyện t câu Ti t: I MỤC TIÊU : *CHUẨN KT – KN -Bước đầu làm quen với khái niệm t câu thông qua t p thực hành -Bi t từ liên quan đến ho t động học t p bt1, bt2 vi t câu nói ... ……………………………………………………………………………………………………………… 35 Môn: T p làm văn Ti t: I MỤC TIÊU *Chuẩn KT – KN -Bi t nghe trả lời câu hỏi thân BT1; nói lại vài thông tin vi t bạn BT2 -HS khá, giỏi bước đầu bi t kể lại nội dung tranh BT3 thành câu chuiyeenj...

Ngày tải lên: 20/09/2013, 21:10

37 219 0
Lop 2-T 6-chuankien thuc

Lop 2-T 6-chuankien thuc

... làm toán VBT - Nhận x t học Ti t : I MUC TIÊU: Luyện t câu: tuần 12 - Bi t phân bi t từ v t nói chung với t n riêng v t nắm đợc quy t c vi t hoa t n riêng Vi t Nam ( BT1) ; bớc đầu bi t vi t hoa ... nhận x t , t m nhóm thắng -Nhận x t học - VN làm t p lại VBT Thứ ngày 26 tháng năm 20 08 Toán: Luyện t p Ti t : MUC TIÊU: - Bi t giải trình bày giải toán nhiều t nh khác - BT 1 ,2, 4 II Ho t động dạy ... dò : ( 2) sáng t o - T Nhận x t ti t học ho t động t p thể: Sinh ho t lớp I Nội dung : - Lớp trởng.điều khiển lớp nhận x t ho t động tuần - Các t bình x t thi đua tuần - Lớp trởng t p hợp...

Ngày tải lên: 21/09/2013, 01:10

17 263 0
GA LOP 2- T 8

GA LOP 2- T 8

... x t - Hc sinh lm vo v + Tri r t ct da, ct tht + ễng t i c i i vo + Gia ỡnh t i sng rt hnh phỳc Giỏo ỏn Lp Trng Tiu hc T n Thnh Th sỏu, ngy15 thỏng 10 nm 20 10 Toỏn PHẫP CNG Cể TNG BNG 100 I Mc tiờu: ... -Lm : BT1 BT2 BT4 BT a II Cỏc hot ng dy v hc : Hot ng ca giỏo viờn n nh : Kim tra : BT4- Chm mt s v BT - Nhn x t tuyờn dng Bi mi : GTB :LUYấN TP Bi : T nh nhm Bi : Vit s thớch hp vo ụ trng ... hng 26 17 38 26 S hng 36 16 Tng 31 51 54 35 Bi 3: Giỏo viờn cng c t nh tng s hng ó bit da vo t nh vit ghi kt qu t nh tng hng di Bi 4: Hc sinh t nờu toỏn theo t m tt ri gii - Hc sinh lờn thi...

Ngày tải lên: 27/09/2013, 06:10

18 301 0
chính tả 2  T 24.ppt

chính tả 2 T 24.ppt

... phía lùm L lững thững theo hướng Tun T Thứ năm ngày tháng năm 20 10 Chính t (Nghe -vi t ) V Voi nhà Con voi lúc lắc vòi hiệu điều , đến trước mũi xe C T lo lắng : T -Nó đập tan xe Phải bắn ... Thứ năm ngày tháng năm 20 10 Chính t (Nghe -vi t ) Voi nhà Thứ năm ngày tháng năm 20 10 Chính t (Nghe -vi t ) V Voi nhà Con voi lúc lắc vòi hiệu điều , đến trước mũi xe T lo lắng ... đập tan xe Phải bắn ! Nhưng , voi quặp ch t vòi vào đầu xe co lôi mạnh xe qua vũng lầy Lôi xong , huơ vòi phía lùm lững thững theo hướng Tun Thứ năm ngày tháng năm 20 10 Chính t (Nghe -viết...

Ngày tải lên: 27/09/2013, 20:10

11 326 1
g/a 2 t/giang sh8-kI-2010

g/a 2 t/giang sh8-kI-2010

... c th thỳ Nhng nh quỏ trỡnh lao ng, tri qua hng triu nm loi ngi ó tin húa hn tt c cỏc ng vt khỏc Vy h ng cú nhng c im no tin húa hn ng vt? Bi hc hụm chỳng ta cựng lm rừ ny Tit 11- Bi 11: Tin ... Quan s t hỡnh v 11.1-11.3, hon thnh bi bng 11 I/ Tin hoỏ b xng ngi so vi b xng thỳ c thụng tin bng tr li cõu hi: Cỏc phn so sỏnh B xng ngi - t l s /mt - Li cm xng mt - ln - Ph t trin - Ct sng ... g t (thuc - Ln ; ph t trin v phớa sau nhúm xng c chõn) Nhng c im no ca b xng ngi thớch nghi vi t th thng ỳng i bng chõn? ỏp ỏn: c im ca b xng thớch nghi vi t th thng ng i bng Nhng chõn : - Ct...

Ngày tải lên: 29/09/2013, 21:10

14 224 0
GA 2- T 10

GA 2- T 10

... mng, thm hi, thụng bỏo tt tin tc - Vi hc sinh c bu thip Th t ngy 27 thỏng 10 nm 20 10 Toỏn: 11 tr i mt s : 11 I Mc tiờu: - Bit cỏch thc hin phộp tr dng 11- 5, lp c bng 11 tr i mt s - Bit gii bi toỏn ... hng dn tng t - Hc sinh thc hin phộp t nh 40 - 18 22 * khụng tr c ly 10 tr c ly 10 tr bng 2, vit * thờm bng 2, tr bng 2, vit * Vy: 40 18 = 22 * Thc hnh Giỏo viờn hng dn hc sinh lm ln lt t bi 1, ... nờu cỏch thc hin: t tớnh, ri t nh - Hc sinh nhc li: * khụng tr c ly 10 tr bng 2, vit nh * tr bng 3, vit - Hc sinh thc hin trờn que t nh t m kt qu l 22 - Hc sinh nhc li cỏch thc hin phộp t nh -...

Ngày tải lên: 30/09/2013, 02:10

20 312 0
VIET DS8 T23 $2 T/C CƠ BẢN CỦA PHÂN THỨC

VIET DS8 T23 $2 T/C CƠ BẢN CỦA PHÂN THỨC

... t chung) B B: N ?4: Ho t động 2: Quy t c đổi dấu : (10’) Quy t c đổi dấu: T t p ?4b, GV giới HS ý theo dõi nhắc lại Nếu đổi dấu t mẫu phân thiệu quy t c đổi dấu quy t c đổi dấu thức phân thức ... TRƯỜNG THCS ĐẠ M’RÔNG GIÁO ÁN: ĐẠI SỐ A A.M = (M đa thức khác đa B B.M thức 0) Nếu chia t mẫu phân thức cho nhân t chung chún phân thức phân thức cho GV cho HS làm bt ?4 HS thảo luận bt ?4 ... x ) x − 11 Củng Cố: (8’) - GV cho HS thảo luận t p ?4 SGK/ 37 Dặn Dò: (2 ) - Về nhà xem lại VD t p giải - Làm t p 5, SGK/ 38 - Xem trước R t kinh nghiệm ti t dạy: ………………………………………………………………………………………………………………...

Ngày tải lên: 09/10/2013, 13:11

2 227 1
w