Alloreactive t cells and cytokines in murine graft versus host disease 2

_ Materials and Methods CHAPTER MATERIALS AND METHODS 2.1 Animals In our acute graft-vs-host disease (aGVHD) model, to week old inbred black C57BL/6J (H-2b) mice were used as donors The source of the mice was from Animal Resources Center, Murdoch in Western Australia They were kept in cages, maintained on untreated water and fed ad libitum Four to six week old gender-matched C.B-17 SCID mice (H-2d) purchased from Jackson Laboratory (USA) were used as recipients for monitoring the development of GVHD Maintained in plastic solid-bottom mouse cages with a flexible film isolator and suspended on rolling stainless steel racks in the isolator room of the Animal Holding Unit in National University of Singapore, these mice were employed at the age of 4-6 weeks as recipients for studying the pathophysiology of the transplanted donor T cells in aGVHD 2.2 Reagents and Antibodies Carboxy-fluorescein diacetate succinimidyl ester (CFSE) was purchased from Molecular Probes (USA) and employed for detection of cell division CFSE consists of a fluorescein molecule containing a succinimidyl ester functional group and two acetate moieties CFSE diffuses freely into cells and intracellular esterases cleave the 50 _ Materials and Methods acetate groups converting it to a fluorescent, membrane impermeant dye The dye is not transferred to adjacent cells CFSE is retained by the cell in the cytoplasm and does not adversely affect cellular function During each round of cell division, the relative intensity of the dye is decreased by half Monoclonal antibodies (mAbs) used in the study of T cell homing and regulatory T (Treg) cell surface marker expression were purchased from BD Pharmingen (USA) unless specified otherwise These mAbs are of rat origin and directed to mouse CD3ε (PE; clone 145-2C11), CD4 (PE; clone GK1.5), CD8 (PE; clone 53-67), CD25 (PE; clone PC61), CD45RB (PE; clone 16A), CD38 (PE; clone 90), CD103 or integrin αE chain (PE; clone M290), integrin β7 chain (PE; clone M293) and CTLA-4 (PE; clone 1B8; Santa Cruz Biotechnology, USA) Biotin-conjugated anti-mouse H-2Kb (clone AF6-88.5), CD38 and CD103 mAbs were used in combination with strepavidin-conjugated Cy-ChromeTM (SAv-PE-Cy5, BD Pharmingen) or strepavidin-RED670TM (Gibco BRL, USA) for Tri-colour flow cytometric analysis Rat anti-mouse CD3, goat anti-rat Ig (biotin conjugated) and strepavidin-conjugated horse raddish peroxidase (BD Pharmingen) were used for the immunohistochemical staining of T lymphocytes 80 µl of a freshly-prepared mixture of Hypnorm (fentanyl citrate and fluanisone), Dormicum (midazolam) and double distilled H2O at the ratio of 1:1:2 was applied to anesthetize mice before tail vein injection or blood collection from their retro-orbital plexus 51 _ Materials and Methods 2.3 Induction of Acute GVHD Mononuclear cells (MNCs) were prepared from the spleen and lymph nodes (LNs) (cervical, axillary, mesenteric and inguinal LN) of C57BL/6J or Balb/c donor mice MNCs of the spleen were isolated by density centrifugation over Ficoll-Paque (Pharmacia Biotech AB, Sweden), and LN cells were obtained by mincing the LNs and the tissue debris filtered using a 41 µm sterile mesh filter (Sefar AG, Switzerland) After washing twice with PBS, various numbers of these cells were injected into each recipient C.B.-17 SCID mouse via the tail vein The day of injection was recorded as day 0, and thereafter the recipient mice were monitored for symptoms of acute GVHD and weighed daily Mice were observed for the presence of skin and hair changes, hunched-back posture, diarrhea, and weight loss Mice had to have diarrhea/hunched posture or weight loss consistent with GVHD and then either skin lesion and hair loss to be considered as suffering from GVHD (Table 1) (Cooke et al., 1996) The time was recorded when the mice died of GVHD The percentage of weight loss and mortality rate was considered to reliably reflect the degree and severity of GVHD Table Criteria of acute graft-versus-host disease in mice Criteria Weight Loss Posture Grade 10% to 25% Severe hunching impairs movement Stationery unless stimulated Severe ruffling / poor grooming Obvious area of denuded skin _ Materials and Methods 2.4 Reverse-transcription and Real-time PCR 2.4.1 mRNA isolation from the tissues of recipient mice The recipient SCID mice were sacrificed at various time points after injection of donor cells, and the spleen, liver, heart, and skin were procured and snap frozen in liquid nitrogen until use Total RNA isolation was performed according to the kit manufacturer’s instruction (Roche, Germany) All reagents used were provided in the RNA isolation kit unless specified otherwise Briefly, a small portion (about 15 mg) of each tissue was retrieved and immediately put into a mixture consisted of 400 µl of lysis buffer and 200 àl of diethylpyrocarbonate (DEPC) treated 1ì PBS solution The tissues were homogenized using a tissue grinder (Polytron PT 1200; Switzerland) The supernatant of the tissue homogenate was then passed through a glass filter fleece and then incubated with DNase I for 30min at room temperature After three washes were performed using the wash buffers, the RNAs were eluted in 50 µl of elution buffer and stored at -80°C until use Mask and gloves were put on throughout the experiment and all reagents, glasswares, pipette tips and microfuge tubes used were DEPC-treated according to the protocol by Aususel et al (1991) 2.4.2 Agarose gel electrophoresis As an indication that the total RNA isolated from the tissues was intact, each sample was analysed using the submerged gel nucleic-acid electrophoresis apparatus (Biorad Mini-sub cell GT, USA) A 1.3% agarose gel (Biorad, USA) was cast by mixing 1.3g of agarose gel powder with 100ml of 1× Tris Borate EDTA (TBE) buffer (NUMI medium preparation facility, NUS) in a 250ml conical flask and heated in a microwave 53 _ Materials and Methods oven until fully dissolved After cooling to about 45°C, µl of ethidium bromide solution (BioRad) was added and mixed The fluid of agarose mixture was poured into a gel tray where air bubbles were removed using a pipette before the gel comb was inserted The solidified gel was then submerged in the gel electrophoresis tank filled with 1ì TBE buffer 3-5 àl of RNA samples were mixed with àl of 6ì gel loading dye (Promega, USA) before loading into a well 10 µl of pGEM or 100bp DNA marker (Promega) was also loaded in a separate well as a relative molecular size reference The samples were then electophorized at a constant voltage of 100 volts for 30 to check for the integrity of the 28S and 18S ribosomal RNA The RNA bands were visualized with a UV transilluminator (Vilber Lourmat, USA) and photographed (Polaroid CU-5 88-13, USA) 2.4.3 Reverse transcription This was accomplished using the first strand cDNA synthesis kit for RT-PCR (Roche) RNAs isolated previously from various tissues were used The kit was used according to the manufacturer’s instructions and recommendations As the first step, a reagent Master Mix was prepared as indicated in table The mixture was briefly vortexed and centrifuged (Eppendorf Centrifuge 5415C, USA) to collect the samples at the bottom of the microfuge tube (Greiner, USA) The reaction was incubated at 25°C for 10 and then 42°C for 60 Following the 42°C incubation, the Avian Myeloblastosis Virus (AMV) Reverse Transcriptase was denatured by incubating the reaction at 99°C for and then cooling to 4°C for To ensure that the concentration of cDNA (before PCR) was the same for all the samples, the concentration of nucleic acids was measured using a 54 _ Materials and Methods Beckman DU-600 spectrophotometer at a wavelength of 260nm The samples were than diluted to the concentration of the most diluted sample This would ensure that any difference in the amount of DNA amplified would be due to the difference in the proportion of that mRNA in that sample The cDNA samples were then stored at -20°C until use Table Components of Master Mix for cDNA synthesis Reagent Volume (µl)/sample Final concentration 10x Reaction Buffer 2.0 1x 25mM MgCl2 4.0 5mM Deoxynucleotide mix 2.0 1mM Oligo-p(dT)15 primer 2.0 0.04 A260 units (1.6µg) Random primer p(dN)6 2.0 0.08 A260 units (3.2µg) RNase inhibitor 1.0 50 units AMV reverse transcriptase 0.8 20 units RNA samples 6.2 A260 units (variable) Total volume 20.0 2.4.4 Polymerase chain reaction (PCR) The primer sequences for β-actin and various chemokine cDNA targets are listed in table These sequences were generated with the aid of computer software and then verified with the GenBank (National Institude of Health, USA) to ensure that the primer sequences were correct and did not cross react with other unrelated gene sequences Primers were then synthesized at the Oligonucleotide Sythesizer Unit (NUMI, Clinical Research Centre, NUS) 55 _ Materials and Methods Table Primer sequences employed to amplify various chemokine cDNAs Targets Direction Primer sequences BLC Forward 5’- TAGCTATAGCTAGCTAAAGC–3’ Reverse 5’- AAGATTCGFATCGATCGAGT–3’ Forward 5’- CGACAGATACGATCGATCAA–3’ Reverse 5’- AAGCATATCCTATCGATGAT–3’ Forward 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’ Reverse 5’- ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ Forward 5’- GCTAGGTCATCGGTCATCGG–3’ Reverse 5’- ACCAATGTCGATTAGCTACC–3’ Forward 5’- TTAAATCGTTGCGACAACTA–3’ Reverse 5’- GCCGATCGATCGATCGTACC–3’ Forward 5’- TTACCTGATCGGCTACACTG–3’ Reverse 5’- GGTCTACATCGATCGCTACT–3’ Forward 5’- ATAGACTCTCCGATATAGCT–3’ Reverse 5’- TAGCTATCGATCGATCGTAA–3’ Forward 5’- AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’ Reverse 5’- GGTCCTATTACGGCTACTAC–3’ Forward 5’-GTGGGCCGCTCTAGGCAC-3’ Reverse 5’-CTTTGATGTCACGCACGATTTC-3’ MIP-1α MIP-1β MIP-2 MCP-1 MCP-3 RANTES SLC SDF-1α SDF-1β Eotaxin β-actin Amplification of the cDNA derived from RNA of various tissues harvested at various time points post-transplantation was performed using a PCR Core Kit (Roche) The kit was used according to the manufacturer’s instructions The Master Mix was prepared as indicated in table 4: 56 _ Materials and Methods Table Components of the Master Mix for PCR Reagent Volume (µl)/sample Final concentration 10x reaction buffer 1x MgCl2 (25mM) 2.5mM dNTP Mix 0.2mM Forward primer 0.1-10 µM Reverse primer 0.1-10 µM Taq polymerase 0.5 1-8 U/100 µl cDNA template variable Sterile water 35.5 Total volume 50 The reagents were mixed and centrifuged briefly to collect the sample at the bottom of the tube The mix was then aliquoted into small PCR tubes (Greiner) and amplified for 28 cycles to verify the increases of DNA for each chemokine cDNA using a Hybaid PCR ExpressTM (Hybaid Ltd, USA) The cycler was preheated to 94°C for before amplification began The program for each cycle was as follow: • 94°C for 40 sec • 55°C for 40 sec • 72°C for For each amplification, negative controls (using double distilled water instead of cDNA template) and positive controls (using β-actin primers) were included After 28 cycles, the samples were cooled to 4°C and eletrophorized at a constant voltage of 80 volts on a 1.2% agarose gel (BioRad) in 1× TBE buffer (NUMI Medium Preparation Facility, NUS) for 30 together with a pGEM DNA molecular weight marker (Promega) and visualized with a transilluminator 57 _ Materials and Methods 2.4.5 Real-time PCR The mRNA expression of chemokines was conducted using the ABI Prism 7700 Sequence Detection System (Perkin Elmer, USA) The Taqman probes and primers specific for MIP-1α, MIP-2, MCP-1, MCP-3, Mig and β-actin were synthesized by Applied Biosystem (USA) All probes were labeled at the 5’ end with the reporter dye molecule FAM (6-carboxy-fluorescein) and at the 3’ end with the quencher dye molecule TAMRA (6-carboxytetra methyl-rhodamine) Probe and primer sequences were presented in Table Table Sequences of primers and probes employed in real time PCR Targets Sequences Forward primer: 5’ CTTGAGAGTGGCTATGACTTCTGTCT 3’ 5’ AGGACCCCACTGCGCCCAGA 3’ 5’ GCTGGAGAGCTACAAGAGGATCA 3’ Reverse primer: 5’ TCTCTCTTGAGCTTGGTGACAAAA 3’ 5’ CTACAGCTTCTTTGGGACACCTGCTGCT 3’ Forward primer: 5’ AGTGATAAGGAATGCACGATGCT 3’ Reverse primer: 5’ TGAGGTCTTTGAGGGATTTGTAGTG 3’ Probe: 5’ CAGCACCAGCCGAGGCACGA 3’ Forward primer: 5’ GGGAAGCTGTTATCTTCAAGACAAA 3’ Reverse primer: 5’ CTCCTCGACCCACTTCTGATG 3’ Probe: 5’ CTTCAGCGCAGACTTCCATGCCCTT 3’ Forward primer: β-actin Reverse primer: Probe: MCP-3 5’ TGACTTCAAGAACATCCAGAGCTT 3’ Forward primer: Mig 5’ CCTGCTGCTTCTCCTACAGCCGGA 3’ Probe: MCP-1 5’ TCAGGCATTCAGTTCCAGGT 3’ Forward primer: MIP-2 Reverse primer: Probe: MIP-1α 5’ GCGCCATATGGAGCTGACAC 3’ 5’ TTCAACACCCCAGCCATGTA 3’ Reverse primer: 5’ TGTGGTACGACCAGAGGCATAC 3’ Probe: 5’ TAGCCATCCAGGCTGTGCTGTCCC 3’ 58 _ Materials and Methods MIP-1α gene was amplified by RT-PCR and cloned into pcDNA 3.1 vector (Invitrogen, Netherlands.) Plasmid DNA containing MIP-1α was used as the standard The concentration (µg/ml) of the recombinant plasmid was determined by a spectrophotometer (λ=260 nm) and then converted into picomole (pmol) using the following formula: ã àg ì 106 pg/1àg ì pmol/660pg × 1/N = pmol N is the number of nucleotide pairs and 660 pg/pmol is the average molecular weight of a nucleotide pair The quantity in pmol can be further converted into plasmid copy number by using the constant of mole = 6.023×1023 molecules (or copy number) The recombinant plasmid was then serially diluted into concentrations ranging from 108 to 102 and employed as a standard for other primer/probe and target combinations Primers and probes applied on the standard were specific for MIP-1α gene as shown in Table It was run simultaneously with each sample during every round of real time PCR The recipe for real time PCR reaction mix is shown in Table 6: Table Recipe for real time PCR reaction Mix Reagent Volume (µl)/sample Final concentration Taqman Uni Mix (2x) 25 1x Forward primer (10 µM) 1.5 300 nM Reverse primer (10 µM) 1.5 300 nM Taqman Probe (5 µM) 200 nM cDNA template 10-100 ng Sterile water 19 Total volume 50 59 _ Materials and Methods Thermal cycler parameters included at 50°C, 10 at 95°C, and then 45 cycles of denaturation at 95°C for 40 sec, annealing at 55°C for 40 sec and extension at 60°C for 40 sec Real time monitoring of the fluorescent emission from cleavage of sequence-specific probes by the nuclease activity of Taq polymerase allowed defining the threshold cycle during the early exponential phase of amplification Quantitative real time PCR was performed to determine the MIP-1α, MIP-2, MCP-1, Mig and MCP-3 mRNA copy number in each tissue and normalized to copies of the β-actin mRNA from the same sample 2.5 Tri-colour Flow Cytometric Analysis 2.5.1 On donor T cell homing study Donor splenocytes were labeled with CFSE prior to their injection into the recipient SCID mice Donor splenocytes were resuspended at 50×106 cells/ml in RPMI 1640 (Gibco BRL), and CFSE was added to a final concentration of 10 µM After incubation at 37°C for 10 with constant shaking, the reaction was terminated by adding equal volume of ice-cold RPMI 1640 containing 3% fetal calf serum (FCS), followed by washes with the same medium The cells were then resuspended in RPMI 1640 10×106 cells were injected into the recipient mice via tail vein Recipient mice were sacrificed on day 1, 3, 4, and 21 post-donor cell injection and total-body perfusion was performed by infusing 40 ml of 1× PBS into the right and left ventricle through cardiac puncture to flush out the blood cells in each organ Spleen, liver, heart, mesenteric lymph nodes (MLN) and peripheral lymph nodes (PLN, including cervical, 60 _ Materials and Methods inguinal and axillary lymph nodes) were procured from the recipient mice MNCs of the spleen and liver were isolated using Ficoll-Paque density centrifugation after homogenization Heart, MLN and PLN cells were obtained by mincing the tissues and the tissue debris filtered using a 41 µm mesh filter (Sefar, Switzerland) All cells were washed twice prior to staining with mAbs The isolated cells were washed with PBS containing 5% FCS and mM sodium azide Aliquots of 106 cells were stained in 96-well round bottom PVC microtitre plates Cells were firstly incubated on ice with biotin-conjugated anti-H-2kb mAb and either PE labeled anti-CD4 or anti-CD8 mAb, followed by strepavidinRED670TM staining for 30 The stained cells were resuspended in PBS supplemented with 0.5% paraformaldehyde at 4°C until FACS analysis was performed 1.5×105 cells were counted for each preparation with a FACSVantageTM SE Flow Cytometer (Becton Dickinson, USA), and tri-color data analysis was performed with the aid of a computer software (FlowJo; Treestar, USA) Lymphocytes were gated based on their low forward scatter and side scatter property, and H-2kb+ CD4+ or H2kb+ CD8+ cells were presented as a percentage of this gated population CFSE fluorescence reduction was used as an indication for cell proliferation 2.5.2 On Treg cell surface marker expressions 2.5.2.1 CTLA-4 and CD25 CFSE-labeled LN and spleen cells were isolated from the primary recipient mice as described in Section 3.3 Cells were stained with biotinylated anti-H-2Kb Ab + strepavidin-conjugated PE-Cy5, and either anti-CD25-PE or anti-CTLA-4-PE mAbs 3×105 live cell events were collected for each sample and analyzed with FlowJo 61 _ Materials and Methods program (Treestar) LN cells were first gated with the lymphocyte gate, and cell population with high CFSE fluorescent intensity (CFSEhi) and low CFSE fluorescent intensity (CFSElo) were then analyzed separately for the percentage of CD25+ and CTLA-4+ cells This CFSE level gating was not applied on the spleen cells 2.5.2.2 αEβ7 and CD45RB / CD38 Isolated cells were first stained with biotinylated anti-αE (CD103) + anti-β7-PE mAbs, or biotinylated anti-CD38 mAb + anti-CD45RB-PE mAbs, followed by avidin conjugated-PE-Cy5 When performing data analysis, LN cells were subjected to lymphocyte gate followed by either CFSEhi or CFSElo gating The percentage of cells which were αEβ7+ or CD38+CD45RBlo in the gated population was recorded No CFSE gate was applied on spleen cells 2.6 Fractionation of Proliferating and Non-proliferating Cells 2.6.1 Discontinuous Percoll gradient centrifugation High density (resting) peripheral lymphocytes were separated on a discontinuous Percoll gradient Iso-osmotic 1× stock Percoll solution was prepared by mixing parts of Percoll (Pharmacia, Sweden) with part of 10× concentrated PBS This stock solution was then further diluted with 1× PBS to make up Percoll solutions of different densities The discontinuous Percoll gradient was consisted of ml each of 40%, 50%, 60% and 70% Percoll solutions underlaid in order in a 15ml centrifuged tube (Greiner) A single cell suspension prepared from pooled LNs was overlaid on the gradient and 62 _ Materials and Methods centrifuged at 2500 rpm for 25 in at 20°C Resting and proliferating cells were removed from the 60%/70% and 40%/50% interfaces respectively and washed twice in 1× PBS prior to FACS analysis or injection into secondary recipient mice 2.6.2 Fluorescent activated cell sorting Spleen and LN cells were isolated from the C57BL/6 donor mice as described in Section 3.3, mixed at 1:1 ratio and labeled with CFSE as described in Section 3.5.1 70×106 cells were injected into each primary recipient mouse via tail vein On day post-transplantation, the spleen and LN cells were isolated again from the primary recipient mice LN cells were pooled and resuspended in RPMI containing 3% FCS at a concentration of 30×106/ml Cell aggregates and debris were removed using 41 µm mesh filter (Sefar AG) Sterile cell sorting based on the CFSE intensities of the LN cells were performed on FACSVantageTM SE Flow Cytometer (Becton Dickinson) Cells were first gated with lymphocyte gate (low FS and SS) (Fig 1a), and cells that retained the original CFSE fluorescent intensity (non-proliferating cells) and cells that showed highly reduced CFSE fluorescent intensity (early proliferating cells) (Fig 1b) were sorted into different channels Sorting was performed at a speed of 3,000-4,500 cells/sec, and the sorted cells were collected with sterile 12×75mm polystyrene Falcon tubes # 2058 (Becton Dickinson) containing 120 µl of FCS The sorted cells were pooled in 50 ml centrifuge tubes (Falcon) and centrifuged at 800 g for 12min to recover the cells Cells were then enumerated and used to inject the secondary recipient mice or subjected to mixed lymphocyte culture Spleen cells were used directly without sorting 63 _ Materials and Methods a b ChL ChR CFSE Fig.1 Sorting of CFSE-labeled cells isolated from primary recipient mice CFSElabeled LN cells were isolated from the primary recipient mice on day posttransplantation and analyzed with flow cytometry Lymphocyte gate was applied (a) and the cells were further gated based on their CFSE intensities (b) Cells showing high CFSE fluorescence were sorted into the right channel (ChR) while those with low CFSE fluorescence into the left channel (ChL) 2.7 Injection of Mixed Cells into Secondary Recipient Mice Spleen and LN cells were isolated from the primary recipient mice on day posttransplantation LN cells were sorted as described in the previous section into fractions – LN cells of original CFSE fluorescent intensity (CFSEhi), reduced CFSE fluorescent intensity (CFSElo), and unsorted LN cells Spleen cells were used directly without being sorted These fractions of cells were either injected directly into the secondary recipient mice as controls, or mixed with the CFSEhi LN cells prior to their injection Cell mixing experiment was performed in ways – 64 _ Materials and Methods CFSElo LN cells were mixed at different ratios with CFSEhi LN cells before injection into the secondary recipient mice, with the number of CFSEhi LN cells being kept constant at 1×106 for each mouse Similar to approach (1) but CFSElo LN cells were replaced with unsorted spleen cells 2×106 unsorted spleen cells were injected into each recipient mouse one week earlier to allow their repopulation in the recipient lymphoid organs before the injection of 1×106 CFSEhi LN cells The recipient mice were monitored for symptoms of acute GVHD, body weight development and survival rate 2.8 Cryosectioning and Immunohistochemistry Fresh tissues were collected, placed in the cryovials and immediately snap frozen and stored in liquid nitrogen until required Before sectioning, the tissues were embedded in OCT embedding medium (Fisher, USA) and frozen in the chamber of the cryostat (Leica CM3050, Germany) at -20°C The optimal cryostat cutting temperature for unfixed lymph nodes, liver, intestine and spleen was -12°C to -16°C and for skin and muscle was -18°C to -30°C Each sample was sectioned into µm-thick sections and placed on the 0.01% poly-L-lysine (Sigma, USA) -coated glass slides The slides were fixed immediately in 1:1 mixture of acetone and chloroform at 4°C for at least 15 minutes Fixed slides were air-dried briefly and wrapped in aluminium foil for longterm storage at -80°C until use 65 _ Materials and Methods Prior to staining, the sections were retrieved from -80°C freezer and dried thoroughly at room temperature The tissue on the slide was circled with a DAKO pen to prevent the reaction fluid from spreading out A 3-step immunoperoxidase staining was performed at room temperature Sections were then rehydrated in Tris-buffered saline (TBS, pH 7.6) Endogenous peroxidase was blocked by incubating the section with a peroxidase blocking reagent (Dako, Glostrup, Denmark) for 30 Nonspecific binding of the secondary antibody was prevented by incubating sections with goat serum (1:30 dilution) (Dako, Denmark) for 30 The serum was drained out by filter paper after the incubation The primary antibody, rat anti-mouse CD3, was used at 1:300 dilution in PBS The sections were incubated at 4°C overnight in a humidity chamber Three rounds of washing with TBS were performed before incubating the sections with the biotinylated goat anti-rat mAb (1:250) for 30 The sections were washed times with TBS before the strepavidin-HRP (1:200) was applied After 30 incubation, the sections were rinsed and color development was conducted using diamino-benzidine substrate solution (Dako) Development of color was controlled with the aid of a microscope Finally, the sections were counterstained with Mayer’s hematoxylin and mounted in Fisher Permount (Fisher, USA) 2.9 Mixed Lymphocyte Culture The culture medium used was DMEM (Gibco BRL) supplemented with 10% FCS, 100 U/ml penicillin, 100 µg/ml streptomycin, mM of L-glutamate and 50 µM of 2mercaptoethanol 2×105 responder cells were mixed with 4×105 irradiated (2,200 rad) 66 _ Materials and Methods Balb/c spleen cells and cultured in 200 µl medium/well in a 96 well round bottom plate at 37°C in a humidified, 5% CO2 cell culture hood Multiple wells were prepared for collecting cell culture supernatant (three well for each time point) on different days of culture to assay for cytokine levels The cultured cells were also harvested to determine their proliferation 2.10 Cell Proliferation Assay The proliferation of the cultured cells was determined by using a CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega, USA) according to the manufacturer’s instruction Briefly, cells subjected to mixed lymphocyte culture (MLC) were harvested at different time points of culture, resuspended in 100 µl of RPMI supplemented with 10% FCS and placed in new wells of a 96 well plate 20 µl of CellTiter 96 AQueous One Solution Reagent were then added into each well The plate was incubated for four hours at 37°C in a humidified, 5% CO2 cell culture hood Cell proliferation was determined by the amount of formazan (measured by the absorbance at 490 nm) formed due to the metabolic activities of cultured cells after hrs of incubation with its substrate 67 _ Materials and Methods 2.11 Enzyme-linked Immunosorbent Assay (ELISA) 2.11.1 Sample collection i) Supernatant of tissue homogenate Mice were sacrificed on different time points post-transplantation, and total body perfusion in a retrograde direction was carried out by injecting 40 ml of 1× PBS into the hepatic vein and the heart with syringe and 19-gauge needle This was to avoid chemokine contamination from the blood prior to the isolation of the organs Spleen, liver, heart, and skin were collected 20 mg of each tissue was resuspended in ml of 1× PBS enriched with 25 µl of Protease Inhibitor Cocktail Set III (Calbiochem, USA) and homogenized using a tissue grinder (Polytron PT1200, Kinematica AG, Switzerland) 800 µl of the supernatant was then collected and stored at -80°C until use ii) Blood Blood was collected weekly from the retro-orbital plexus of mice with acute GVHD The collected blood was incubated at room temperature for hours and serum was extracted and stored at -20°C until use iii) MLC supernatant MLC was performed as described in Section 3.8 and cultured in 200 µl of medium in U-bottom 96 well plate 160 µl of cell culture supernatant was obtained and stored at 20°C until use 68 _ Materials and Methods 2.11.2 Preparation and assay ELISA kits to assay on IFN-γ, IL-2 and MCP-1 expression levels was purchased from BD Pharmingen and used according to the manufacturer’s instructions Briefly, the capture antibody was diluted with 1× PBS to the recommended concentration and 100 µl was aliquoted into each well of 96 well flat bottom Maxisorp® plate (NUNC, Denmark) The plate was then sealed with ELISA plate sealer (Costar, Cambridge, MA) and incubated overnight at 4°C After being washed twice with Wash Buffer (1× PBS with 0.05% Tween 20), the plate was blocked with 200 àl of Assay Diluent (1ì PBS with 10% FCS) for hour at room temperature 100 µl of standard or samples were then added into each well and incubated at room temperature for hours After another washes, each well in the plate was added with 100 µl of Working Detector consisting of biotinylated detection Ab and avidin-conjugated horseraddish peroxidase pre-mixed at a recommended ratio Incubation was carried out at room temperature for hour The ELISA plate was washed for 10 more rounds before 100 µl of TMB substrate (Pierce, USA) was added into each well 50 µl of Stop Solution (2N H2SO4) was added into each well after 20 of incubation and the plate was read using a microtitre plate reader (Tecan, Switzerland) and the absorbance at A450 was recorded A correction wavelength of 570nm was employed to minus away plate defects On the other hand, ELISA kits to assay for MIP-1α, MIP-2, IL-4 and IL-10 were purchased from R&D Systems (USA) These kits came with plates pre-coated with capture Abs The assay procedure was performed using the same protocol as mentioned above besides that all the reagents and buffers used were those supplied in the R&D System ELISA kits The expression levels of chemokines detected using ELISA performed on the supernatant of tissue homogenate were normalized to the 69 _ Materials and Methods total protein level of the supernatant from the same tissue measured with the Bio-Rad protein assay dye (Hercules, CA) 2.12 Recombinant Immunotoxin Plasmid Preparation 2.12.1 Transformation of immunotoxin plasmid into E coli DT390-IL-2 recombinant plasmid was a generous gift from Dr Hu Huaizhong (University of Wisconsin, USA) Escherichia coli strain DH5α was employed for the cloning Competent DH5α E coli cells were pre-thawed on ice for 10 prior to transformation 10 µl of the DT390-IL-2 recombinant plasmid was added to 100 µl of DH5α cells and incubated on ice for 30 this was followed by heat shock at 42°C for min, after which the cells were placed on ice or another 100 µl of transformed cells was then plated out on pre-warmed LB plate (NUMI medium preparation facility, NUS) containing 100 µg/ml of ampicillin and incubated overnight at 37°C for the selection of clones 2.12.2 Plasmid isolation and purification Well defined colonies were picked from the LB plates and inoculated into ml of LB broth containing 100 µg/ml of ampicillin in sterile 15 ml tubes (Falcon, USA) and then incubated at 37°C with shaking at 200 rpm overnight Glycerol stocks of the bacterial culture were prepared by adding 0.5 ml of 40% glycerol to 0.5 ml of culture and stored at -80°C The plasmids were then isolated following the procedures of the Wizard plus SV Miniprep DNA Purification System (Promega) Briefly, the cells were harvested, 70 _ Materials and Methods and the pellet was resuspended in 250 µl of Cell Resuspension Solution and transferred to a sterile eppendorf tube The cells were lysed with 250 µl of Cell Lysis Solution To inactivate endonucleases and other proteins released by the lysed cells, 10 µl of Alkaline Protease Solution was added The reaction mixture was then neutralized with 350 µl of Wizard Plus SV Neutralization Solution and was centrifuged The cleared lysate was transferred to a Spin Column and was washed twice with Column Wash Solution previously diluted with 95% ethanol The spin column was then transferred to a sterile 1.5 ml eppendorf tube and the plasmid DNA was eluted with 100 µl of nuclease free water 2.12.3 Restriction endonuclease digestion and gel electrophoresis To verify whether the plasmids isolated from Section 3.11.2 contain the DT390-IL-2 insert, restriction endonuclease digest on the plasmid was carried out µl of plasmid was digested with 0.5 µl of Sal I (New England Biolabs, UK), 0.5 µl of EcoRI (New England Biolabs), µl of EcoRI buffer (New England Biolabs) and topped up to a final volue of 30 µl with sterile water The mixture was vortexed and incubated at 37°C overnight The digested DNA was then electophoresized in a 1.3% agarose-EtBr gel at 100 volts for 30 and the bands of interest were visualized and photographed 2.12.4 Isolation of recombinant plasmid using QIAGEN Endofree Plasmid Maxi Kit Glycerol stock of the transformed bacteria with the desired immunotoxin (IT) gene construct was spread onto a pre-warmed LB plate (containing 100 µg/ml ampicillin) and incubated overnight at 37°C a well defined colony was then picked and inoculated 71 _ Materials and Methods into ml of LB broth containing 100 µg/ml of ampicillin in a sterile 50 ml tube (Falcon), incubated at 37°C with shaking at 200 rpm for hours After the incubation period, the ml culture was sub-cultured into a flask containing 100 ml of LB broth with 100 µg/ml of ampicillin The plasmids were then isolated according to the instructions of the QIAGEN Endofree Plasmid Maxi Kit In brief, the bacterial cells were harvested and the cell pellet was resuspended in 10 ml of Buffer P1 containing RNase A The cells were then lysed with 10 ml of Buffer P2 and the released proteins were precipitated with 10 ml of chilled Buffer P3 After the precipitated proteins were removed with QIAfilter Cartridge, the filtered lysate was incubated with 2.5 ml of Buffer ER to remove the endotoxins in the lysate Following on, the lysate was passed through a resin column and washed twice with Buffer QC The DNA was then eluted with 15 ml Buffer QN into a 50 ml centrifuge tube (Falcon) 10.5 ml of room-temperature isoropanol was added into the eluate to precipitate DNA After centrifugation, the supernatant was discarded carefully as the DNA pellet was only loosely attached to the tube The pellet was washed with 70% absolute ethanol and centrifuged The supernatant was discarded and the pellet was airdry for 20 before dissolving in 100 µl of nuclease- and endotoxin-free Buffer TE Quantitation was performed at OD260 using a spectrophotometer (Perkin Elmer, MBA 2000) 2.13 In Vivo Transfection of Recombinant Immunotoxin Plasmids The SCID recipient mice used in this experiment were injected with 10×106 spleen cells isolated from C57BL/6 donor mice for induction of GVHD and were transfected 72 _ Materials and Methods with DT390-IL-2 recombinant plasmid on day and post-transplantation The IT plasmid solution was prepared as described in Section 3.11.4 and diluted to a concentration of mg/ml A TransIT® In vivo Gene Delivery System (Mirus, USA) was employed to deliver and express this IT gene in the recipient mice 30 µg of IT plasmid was used on each mouse The preparation of the plasmid/TransIT polymer mixture is shown in Table 7: Table Recipe for plasmid/TransIT polymer mixture Reagent Volume/mouse Endotoxin free water 140 µl DT390-IL-2 plasmid (1 mg/ml) 30 µl TransIT In vivo Polymer Solution 30 µl Total volume 200 µl The mixture was vortex vigorously for seconds and incubated at room temperature for Immediately prior to injection, the plasmid/TransIT polymer mixture was diluted 1× Mirus Delivery Solution The total volume required to inject a recipient mouse was determined by using the formula below: • Total injection volume per mouse (in mL) = mouse weight (g) / 10 The entire volume of the mixture was delivered by a quick injection at a constant speed within 6-8 sec into the recipient mouse via the tail vein in order to achieve the maximum gene expression The injection was performed on day posttransplantation and repeated on day 73 ... ATCCATCTGGCTAGGTCAGG–3’ Forward 5’- CAACGCTATCGCGTCGGATC–3’ Reverse 5’- TCGCTACTTAGCTACTCGAT–3’ Forward 5’- GCTAGGTCATCGGTCATCGG–3’ Reverse 5’- ACCAATGTCGATTAGCTACC–3’ Forward 5’- TTAAATCGTTGCGACAACTA–3’... AACCTTTAGTACCCATGCCA–3’ Reverse 5’- CACCTGTAGCTAGCTGCTAG–3’ Forward 5’- TAGCTGTCAACTCGATCTCC–3’ Reverse 5’- GGTCCTATTACGGCTACTAC–3’ Forward 5’-GTGGGCCGCTCTAGGCAC-3’ Reverse 5’-CTTTGATGTCACGCACGATTTC-3’... AAGATTCGFATCGATCGAGT–3’ Forward 5’- CGACAGATACGATCGATCAA–3’ Reverse 5’- AAGCATATCCTATCGATGAT–3’ Forward 5’- TAGCTTCTGATCGATGCATG–3’ Reverse 5’- TCTCATGCTAATCGATCGAT–3’ Forward 5’- TACTGCTACTGATCGACTGC–3’