t cells and their antigen specificity

... carboxamidomethylation, the proteins were digested with trypsin and the resulting peptide mixtures were subjected to RP-HPLC mapping The elution profiles of both protein preparations were almost identical (data not ... for tyrosine sulfation [29,30] present in both peptides In addition to the identification of tyrosine sulfate residues detected with the ESI technique, we were also able to identify the dominant ... unsulfated inhibitor from the heparin affinity matrix indicates that the N-terminal acidic domain may affect the GAG binding domain, although it can not be excluded that this effect is due to the...

Ngày tải lên: 08/03/2014, 22:20

... production of T cells that not recognize tumour cells in vivo based on this epitope [67-69] In contrast to these studies, the ability of our vaccination strategy to generate tetramer+ CD8 +T cells ... in the study were promiscuous Ex Vivo Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination ... putative TAAgs A few studies have concluded that hTERT p540 is not expressed or is cryptic on the surface of tumour cells and that immunization of cancer patients with hTERT p540 leads to the...

Ngày tải lên: 18/06/2014, 15:20

... AMD patients and healthy subjects in compliance with institutional review board (IRB) protocols after informed consent at the National Institutes of Health (NIH) The written consents were obtained ... represents a typical flow cytometry scatter plot The percentages of lymphocyte and monocyte gates increased after C5a treatment (from 41% to 52.8% and 5.96% to 17.0% respectively) Further apoptosis ... antagonist Ten separate experiments were performed and the figure shows representative data (C) TUNEL staining of CD4+ T cells treated with or without C5a and C5aR antagonist (D) PBMCs were treated...

Ngày tải lên: 18/06/2014, 22:20

... control group (P > 0.9, by Student’s t- test), between the age of the SLE patient group and the corresponding healthy control group (P > 0.9, by Student’s t- test), and between the RA patient group ... that differentiates all peripheral T cells irrespective of their specificity, or it may actually reflect an antigen- specific expansion of T cells potentially driven by autoantigen The decrease ... suggested that the differentiation may not be linear at all The central and effector memory phenotypes of CD4+ and CD8+ T cells in peripheral blood of RA patients are unknown Determination of these...

Ngày tải lên: 09/08/2014, 01:21

... distinctions still remain between the surface phenotype of TR and primed T cells, but they are more relative than absolute For example, although both primed T cells and TR cells express CD25, the latter ... CCR5 and their human counterparts expressing CCR4 and CCR8 [19,20] Such a distinctive pattern of chemokine receptors suggests that TR cells might be rapidly recruited to sites of inflammation and ... might act in concert (a) Antigen- presenting cell (APC)-activated TR cells transduce an unidentified active negative signal to nearby effector T (TE) cells located on the same APC or an adjacent...

Ngày tải lên: 09/08/2014, 01:23

... attracted to synovial tissue and the reason(s) why they get activated locally in the K/BXN serum transfer model to induce TGF-β1 have yet to be elucidated Taken together, the data illustrate the ... vivo neutralization studies in which anti-TGF-β1 treatment was shown to abrogate the protective effect of Vαi NKT cells in CD1d–/– mice, while not affecting joint inflammation in wild-type animals ... in the induction phase and a provocative role in antibody-induced joint inflammation A particularly fascinating and novel aspect of the current report is the notion that Vαi NKT cells may actively...

Ngày tải lên: 09/08/2014, 06:22

... women treated with autologous BM transplants develop thymic hypertrophy and a resurgence of thymic T cell output that contributes to the restoration of a wide T cell repertoire [29], although the ... increases antigen presentation by upregulating the production of IFNγ Thirdly, IL-7 and TGFβ inversely regulate the production of each other [25,26] The factors that regulate T cell function and contribute ... finding that while reconstitution of nude recipient mice with T cells from wild-type mice restores the capacity of ovx to induce bone loss, reconstitution with T cells from TNF deficient mice...

Ngày tải lên: 09/08/2014, 10:20

... grafts for reconstitution Eight to ten weeks post reconstitution, thus allowing for T cell differentiation, the animals were sacrificed and thymocytes were isolated from the grafts The differentiated ... Tar-CCR5Rz vector transduced CD34+ cells were injected into the SCID-hu mice thy/liv grafts and allowed to differentiate into thymocytes At ~60 days post-engraftment, the cells were harvested and analyzed ... against HIV1 infection These results showed for the first time that expression of these transgenes in combination not interfere with normal thymopoiesis and thus have set the stage for their...

Ngày tải lên: 10/08/2014, 05:20

... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... with CHO/EGFP cells (C) Representative FACS scatter plots of apoptotic CD3 +T cells 72 h after co-culture with CHO cells transfected with IDO (D) Representative FACS scatter plots of apoptotic ... was used to identify the product of interest (pMD19IDO) Materials and methods To investigate IDO gene integration into CHO cells, total RNA was isolated from CHO cells transfected with pIRES2-EGFP-IDO...

Ngày tải lên: 10/08/2014, 10:21

... ctg aac tgg ctg taa ctt ctg c-3’ 6MIEpex2R 5’-tct aag ctt cag caa tcc aat aat tga tg-3’ 6MIEpex3R 5’-cat aag ctt gca tac gtt cct cat tgg at-3’ 6MIEpex4R 5’-cat aag ctt cca aag ttt tga att ctt ... tac ctc ctg ttt ttg agt aag ata tga c-3’ 6MIEpF-165 5’-agt cgg tac cag cta att tcc att cca tat ttg tc-3’ 6MIEpF-102 5’-agt cgg tac cta cag cga ttg gct cct tca tcc tc-3’ 6MIEpR 5’-agt cct cga ... 5’-agt cgg tac cta ctg tgg ttg ggg tct ttc cta c-3’ 6MIEpF-531 5’-acc ggt acc tac cca ggc taa cga gaa cc-3’ 6MIEpF-381 5’-agt cgg tac cac att cct gtt tca tga tgt gta gc-3’ 6MIEpF-214 5’-agt cgg tac...

Ngày tải lên: 11/08/2014, 21:21

... 314 T1 and 314 T2 were the same, showing that consecutive transfers of HCV into the same cell type not affect the sequence The 314 T1 and T2 sequences were almost identical to genotype H77, therefore ... CGS TCT ACG AGA C 10.1a Positive 48 71 CTG TGA GGA ACT WCT GTC TTC ACG CRG 10.2 Negative 310 293 CAC TCG CAA GCA CCC TAT CAG 9.1a-flap Positive 24 42 AAT AAA TCA TAA GAC ACT CCA CCA TRG ATC ACT ... We are reporting the isolation and replication of HCV from patients infected by type strains of HCV These new isolates can be cultured in both B and T cells By contrast to type strains of HCV,...

Ngày tải lên: 12/08/2014, 04:20

... as yet unknown modification of Agrin that endows it with higher aggregating activity, and furthermore redistributes the protein to the site of the IS where it may facilitate antigen presentation ... importance of the actin cytoskeleton in the spatiotemporal formation of the IS and T cell activation [33] Nonetheless, there is still a lot to be learned about the function of Agrin in T cells Its ... antigen presentation; and to identify the receptor(s) that mediate the effects of Agrin in immune cells At the organism level, vital information will be generated by: studying how T cells and the...

Ngày tải lên: 12/08/2014, 12:20

... 5'-ctggaatcacttggcagct- Page of 12 (page number not for citation purposes) Retrovirology 2009, 6:43 gagctctacagagagagtcca-3' and 5'tatggtaccttaagcataatcaggaacatcgtatgggtagtcacacatttcttctgggatttc-3' ... (gccaacgctcaatccggttctcgc) and CTGB3 (gctattttccagctgttctcgagtg) were used for the 5' end Primers CTB4 (ttattccctagtccaaggatgac) and CTGB4 (cagacaatagactatcaagacactgtg) were used for the 3' end PCR was performed ... cDNA in the pCXN2 vector, was used as a template for PCR with forward (5'-ggtctagagcactatggagggagagaggaag-3') and reverse (5'-gggaattcatgcatagtctggtacatcgtaggggtacttaggaaggggtggaagtggtgg-3')...

Ngày tải lên: 12/08/2014, 23:20

... between the two groups of patients (Figures 1b and 1c) At day seven, although the percentage of Tregs was higher in the septic patients than in the nonseptic patients and healthy volunteers, there ... septic shock [18] We observed that, although the percentage of NK cells was not different between patients and healthy volunteers throughout the study period, patients with shock presented with ... to deplete Tregs, we must acknowledge that anti-CD25 is not specific for Tregs and leads to the depletion of other important cells (activated T cells) Moreover, anti-CD25 antibody may not have...

Ngày tải lên: 13/08/2014, 20:21

... investigated in future studies Another limitation is that the present study was not designed to predict the morbidity or mortality of septic shock, which are both also worth further investigation Taken ... (B7-H1) and PD-L2 (B7-DC) [19] PD-1 and its ligands exert inhibitory effects in the setting of persistent antigenic stimulation by regulating the balance between T- cell activation, tolerance, and ... during their treatment Six patients received adjunctive corticosteroid treatment (3 mg/kg hydrocortisone) before or at the time of sampling Nine septic shock patients died during their ICU stay...

Ngày tải lên: 14/08/2014, 07:21

... of the embryo and invade into the decidualised uterus during placentation These two types of cells have direct contact and active interactions at the interface between the mother and the fetus ... SSEA stage specific embryonic antigen STZ streptozotocin/streptozocin TAE tris-acetate-EDTA (buffer) TBS tris buffered saline TEMED tetramethylethylenediamine TERT telomerase reverse transcriptase ... still the primary treatment for type diabetes It is the most effective diabetes treatment for hyperglycemia and is sometimes required in the treatment of type diabetes as well However, patterns...

Ngày tải lên: 11/09/2015, 10:02

... transplantation Transplantation 57(10): 1474-1479 Bishop DK and Orosz CG 1989 Limiting dilution analysis for alloreactive, TCGFsecretory T cells: two related LDA methods that discriminate between ... 1990 T cell depletion with anti-CD5 immunotoxin in histocompatible bone marrow transplantation The correlation between residual CD5 negative T cells and subsequent graft-versus-host disease Transplantation ... activity, and development of histopathological alterations Transplantation 44(2): 254-260 Gillis S, Ferm MM, Ou W, Smith KA 1978 T cell growth factor: parameters of production and a quantitative...

Ngày tải lên: 16/09/2015, 17:13

... which might not represent the whole lot of alloantigens or minor histocompatible antigens that the donor T cells might encounter upon entering the host system Therefore, these allogeneic T cells ... histopathologic signs of GVHD These results showed that DT390-anti-CD3 IT has potent cytotoxicity against T cells and could be employed as a therapy to induce transplantation tolerance or treat ... alloreactive T cells with anti-IL-2 immunotoxin prior to injection into the recipient mice Similar to our results, the remaining cells did not exhibit detectable alloreactivity in vitro, but the mortality...

Ngày tải lên: 16/09/2015, 17:13

... irradiated, their antigen- presenting cells could present donor MHC via the direct pathway In the recipients, T cells were activated and proliferated in the lymphoid system, and the effector T cells ... histocompatibility antigens of the recipient (Korngold et al., 1987; Sayegh et al., 1994) However, T cells in the graft also facilitate engraftment and contribute to immune reconstitution Depletion ... recipient mice injected with these cells (data not shown) It was reported that one of the approaches that Treg cells exert their suppressive activity on normal T cells in MLC is by inhibiting the...

Ngày tải lên: 16/09/2015, 17:13