... present Apoptosis isa form of cell death and is essential for the correct development and homeostasis of multicellular organisms [27–29] Reaper isa potent apoptotic inducer critical for programmed ... (Novagen, Madison, WI, USA), Myc (9E10; Santa Cruz Biotechnology, Santa Cruz, CA, USA), Flag M2 (Sigma) and GFP (Clontech) and then incubated with horseradish peroxidase-conjugated antibody against ... are dispensable for Scythe interaction DUIM1 indicates specic elimination of amino acids 196–241, and DUIM2 indicates specic elimination of amino acids 263–307 UIM1-N5 and UIM2-N5 indicate site-directed...
... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin Ais the most abundant, and it is mainly used as an antibiotic against infections caused ... that bacitracin is not a selective inhibitor of PDI Instead, bacitracin can also interact with folding polypeptide chains and other molecular chaperones and folding catalysts Bacitracin probably ... B-chain of insulin causes precipitation that can be followed as an absorbance increase at 540 nm (A) Representative changes in absorbance as a function of time From left to right, the traces are:...
... landmark L isa function of both the distance between the point and the location of the landmark, and the salience of the landmark To represent distance we use a normalised distance function distnormalised ... target object to a landmark rises as that target’s distance from the landmark decreases but falls as the target’s distance from some other distractor object decreases Figure shows graphs comparing ... fall in the same region of the scale, and can be easily compared visually 750 and Roy (2002) use machine learning to obtain a statistical mapping between visual and linguistic features Gorniak...
... that this isa leader and an organization that cares about its employees and their welfare and will be with them in a time of crisis That’s a more formal crisis management approach but all day ... the plans, deal with all kinds of people, stay financially solvent, display leadership, constantly influence and persuade, be a part ofa community, and sustain some balance for personal sanity ... probably the nature of people to what they can get away with Comedienne Chris Rock puts it, A man is basically as faithful as his options.” And at the top of the skyscraper, you can get away...
... the plans, deal with all kinds of people, stay financially solvent, display leadership, constantly influence and persuade, be a part ofa community, and sustain some balance for personal sanity ... reiterate The best work on getting better every day Professional football players have practice and scrimmage all week long between Sunday games Opera and rock musicians rehearse and practice their ... a CEO Even When You Don’t Feel Like It To Act Like a CEO Is to Perform—Both in Action and Acting How Effective CEOs Act—The Actions and the Acting— Is Their Job As a Leader, You CEO Theatrics...
... financial areas and a VP of product development for actually getting the idea to market He can hand that off to people He can’t hand off keeping his ear to the ground so he understands the nuances ... The chairman and CEO of Nieman Marcus says, “Many of us tend to think of vision as a rarefied ability, something unique to individuals ofa creative or intellectual bent Artists have vision And ... the day to day This allows the day to day to function, but to input to and appreciate the advantages they will gain when the changes are installed Take care of those that cannot handle change...
... opinions of process What is valid today will be completely outdated and invalid next week Constant adaptation and acceptance of change isan essential quality,” says Brian McCune, Managing Partner of ... team preparation: Assigned and circulated i Environmental analysis ii Market and competitive analysis iii Financial: history and forecast iv Strategic and organizational diagnoses Priority-setting ... bungee plan — Brian McCune Managing Partners of e-merging technologies The good about the practical approach is that it is doable and realistic, not just theoretical A strategic plan cannot create...
... to new information?” says Curt Carter, CEO of Gulbransen, Inc and America, Inc One female CEO who will remain anonymous had the most stellar academic education I have ever seen Advanced degrees ... they hand the baton 83 HOW TO ACT LIKE A CEO back to you and you have to stand up and lead,” says Michael Trufant, CEO of G & M Marine Inc “Like a doctor, you can’t prescribe until you diagnose.” ... says Joan Gustofan, Vice President of 3M That includes mistakes GE’s Jack Welch tells the story of his first job in Pittsfield, Massachusetts, where he had a disaster and a plant blew up He had...
... Dan Amos CEO, AFLAC The goal is to setan example that constructive critique and feedback is the “breakfast of champions.” In reality it is, but in the heat of the moment, it can look like a ... boss hands out a “Payday” candy bar attached to paychecks “My Dad used to say it’s only 15 inches between a pat on the back and a kick in the ass,” says Bill Warren, CEO of National Inspection ... provide consulting from financial services to office décor to home landscaping 102 KEEP GOOD COMPANY At one computer company, the employees get a self-stick company logo decal they can stick onto...
... CEO of Parker Album Company A successful human in an elevated position with a clear setof ideas and goals.” Krebbs is right Still, elevated means visible and visible means people are constantly ... pat on the back of the CFO It’s just that the CFO is the reflection of the direction of the company The CFO’s image isa bit more practical,” says Peter Mackins, CPA of Santa Barbara Nurses Association ... depreciation, amortization, and tax impacts “You understand what is most important, and then you pray a lot,” says one CEO THE AREAS WHERE ONLY THE CEO CAN ADD VALUE With the financial indicators...
... purposefully paced Power is characteristically calm Weak is characteristically harried and distracted When John McCain accepted the New Hampshire primary win, he practiced his speech for hours, reminding ... takes endurance It becomes an athletic event,” says Jack O’Brien, CEO of Allmerica Financial You can’t relax As CEO, you are always on and you can’t show what you really feel If you ignore this ... curiosity of how to create value Are a role model and setan example, particularly an example of integrity Support, mentor, and listen Walk the talk Relay and relate information in a manner which is...
... HOW TO ACT LIKE A CEO “The worst situation one can find is lack of financial commitment and a lack of engagement To be affiliated with a cause to ‘build one’s résumé’ isan unfortunate situation, ... take care of yourself to be beneficial to others If you don’t strike some workable and satisfying balance between work and family, work and social, social and family, body and mind, and mind and ... years? The number one answer isfor personal and professional balance.’” Balance is very important, particularly on the health side You need to consider it more than the balance sheet — Mark...
... Christian Boucaud Country Manager-Brazil S.M.J Beverages Dan Amos President/CEO AFLAC, Inc AM FL Y Nancy Albertini CEO Taylor-Winfield Daryl Brewster President Planters Specialty Company Carol Ballock ... Lyons CEO Neurocrine Biosciences John Krebbs CEO Parker Album Company Peter Mackins CPA Visiting Nurse Association Lawrence Land Attorney at Law Alex Mandl CEO Teligent Barry Lathan President/CEO ... ColografX System Dario Mariotti General Manager Mayfair Hotels Mary Lee CPA Peter Mannetti President & CEO US West Wireless, LLC Stan Lewan Market Manager, E-Commerce IBM Peter Marcus Chairman/President...
... CCTTTCCAACCATCCTACCAGCTTGATGTCTATCCCTATGCTGCTTGGTTTCATCCTGCGCAAATCATGCAACATGTTGCTTACTCACCATTCCATGACACTGCCA -T AG A T -G C A- C G -C ACT -C- T -C- ACT-GG-ACA -T-CAC A- GC -C- CT -TC -TCC-T G -A- C ... T-GT A T T GATGTGACTGAAAAT*CCATTCT*TGA*TTTCTCTCCTCAATGTCGATCGTGT*AACCCACCTATCCCAAGGCTTCAACTGTTATTTTAGAGTAGGACAATCCCAAAT GT T G-****TT-ACA-G T-TTCATCTATCATGTCA ATT A T C- G -A ... -TGTCTTTCTTCTTTTCAATAAATTACATTTTAAGGCACTATT -CA -G -G GTTCTTTCTTC***TCAATAAATTACATTTTAAGGCA -C -A A -G -C -T G TTCTTCCTTCTTTTCAATAAATT ATTATGCCAGTATGAAGGTCACTGAATCAGAGTG**TTAAAAGTCTTTACT*GGTT**CTATA*TGGGAATTTTGTTGAAAAA*TCTTTAAATTGCTTCTTCTGTAA...
... important information on the protein folding mechanism, but also an understanding of protein regulation via conformational changes on stress A comparison of the spectral characteristics of the ... stability Conformational changes at low chemical denaturant concentrations – structural and functional implications The elucidation of the hierarchy of global or local events during protein denaturation ... domain of poly (A) -speci c ribonuclease has a noncanonical binding site for mRNA cap analog recognition Nucleic Acids Res 36, 4754– 4767 Monecke T, Schell S, Dickmanns A & Ficner R (2008) Crystal...
... gallus; AT, Arabidopsis thaliana; ZM, Z mays; CA, Candida albicans; SC, S cerevisiae; SP, Schizosaccharomyces pombe Only eukaryotic cytosolic enzymes contain positively charged C- terminal extensions ... temperature, and checked periodically for the appearance ofa blue color that developed between 30 and h b-Galactosidase activity was quantified using Gal-ONp as a substrate in assays carried out according ... Kaminska M, Deniziak M, Kerjan P, Barciszewski J & Mirande M (2000) A recurrent general RNA binding domain appended to plant methionyl-tRNA synthetase acts as a cis-acting cofactor for aminoacylation...
... CONTENTS facts can give pleasure to the amateur and help his professional colleagues T H E EXCAVATION OF W A P A N U C K E T NO 90 How a group of amateurs with professional guidance unearthed an ancient ... must be taken I want to thank Gerard Piel, Dennis Flanagan, Donald Miller and their associates on the staff of SCIENTIFIC AMERICAN, where much of this material originally appeared, for permission ... original manuscript and read proof with painstaking care but throughout the long months of preparation displayed an understanding of (and tolerance for) the human male that professional psychologists...