Biểu hiện gen flic cải biến của salmonella dublin trong escherichia coli và đánh giá hoạt tính sinh học của protein tái tổ hợp

TRƢỜNG ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN ********************** NGUYỄN THỊ NHUNG BIỂU HIỆN GENE fliC CẢI BIẾN CỦA Salmonella dublin TRONG Escherichia coli VÀ ĐÁNH GIÁ HOẠT TÍNH SINH HỌC CỦA PROTEIN TÁI TỔ HỢP LUẬN VĂN THẠC SỸ KHOA HỌC Hà Nội - 2020 ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN ***** NGUYỄN THỊ NHUNG BIỂU HIỆN GENE fliC CẢI BIẾN CỦA Salmonella dublin TRONG Escherichia coli VÀ ĐÁNH GIÁ HOẠT TÍNH SINH HỌC CỦA PROTEIN TÁI TỔ HỢP Chuyên ngành: Sinh học thực nghiệm Mã số: 8420101.14 NGƢỜI HƢỚNG DẪN KHOA HỌC: TS Võ Viết Cƣờng PGS.TS Nguyễn Lai Thành Hà Nội – 2020 LỜI CẢM ƠN Trong thời gian thực đề tài này, nhận nhiều bảo, động viên, giúp đỡ thầy cô giáo, cán nghiên cứu, bạn bè, đồng nghiệp gia đình Trước hết, tơi xin chân thành cảm ơn TS Võ Viết Cường - Phòng Độc học Các bệnh nhiệt đới - Viện Y sinh nhiệt đới, người động viên, hướng dẫn giúp đỡ để tơi hồn thành luận văn tốt nghiệp Tơi xin bày tỏ lòng biết ơn sâu sắc tới PGS.TS Nguyễn Lai Thành Bộ môn Sinh học Tế bào – Khoa Sinh Học - ĐH Khoa học tự nhiên- ĐHQG Hà Nội, thầy tận tình bảo, truyền đạt kiến thức, kinh nghiệm cho lời khuyên quý báu suốt thời gian học tập trường Cũng này, xin gửi lời cảm ơn tới thầy cô giáo khoa Sinh học - Trường Đại học Khoa học tự nhiên, truyền đạt kiến thức suốt q trình đào tạo trường Tơi xin gửi lời cảm ơn chân thành tới cán nghiên cứu, kỹ thuật viên Viện Y sinh nhiệt đới – Trung tâm nhiệt đới Việt Nga, đồng hành giúp tơi hồn thành khóa luận Cuối cùng, với lịng biết ơn sâu sắc tơi xin dành cho gia đình bạn bè, người ln hỗ trợ động viên tinh thần suốt trình học tập Hà Nội, ngày 21 tháng 02 năm 2020 Nguyễn Thị Nhung MỤC LỤC MỞ ĐẦU CHƢƠNG 1- TỔNG QUAN 1.1 Salmonella dublin 1.2 Protein flagellin 1.2.1 Đặc điểm cấu trúc 1.2.2 Flagellin đáp ứng miễn dịch 1.2.3 Ứng dụng flagellin thực tiễn 1.3 Nghiên cứu sản xuất flagellin tái tổ hợp 1.3.1 Tổng hợp gene fliC mã hóa cho flagellin 1.3.2 Vector pE-SUMO3 1.3.3 Chủng E coli sử dụng cho nhân dòng vector biểu protein tái tổ hợ 10 CHƢƠNG 2- VẬT LIỆU, PHƢƠNG PHÁP 13 2.1 Vật liệu 13 2.1.1 Đối tƣợng nghiên cứu 13 2.1.2 Hóa chất thiết bị 14 2.2 Phƣơng pháp nghiên cứu 17 2.2.2 Khuếch đại gene tinh sản phẩm PCR 18 2.2.3 Cắt gene vector enzyme cắt giới hạn 18 2.2.4 Ghép gene vào vector 19 2.2.5 Biến nạp vào tế bào E.coli 20 2.2.6 Tinh định lƣợng protein flagellin tái tổ hợp 21 2.2.7 Phƣơng pháp đọc trình tự acid amin LC/MS .22 2.2.8 Các phần mềm, chƣơng trình tin sinh học sử dụng nghiên cứu 23 CHƢƠNG 3- KẾT QUẢ VÀ THẢO LUẬN 24 3.1.1 Khuếch đại gene tinh sản phẩm PCR 24 3.1.2 Cắt gene vector enzyme cắt giới hạn 25 3.1.3 Ghép gen vào vector biến nạp vào E.coli DH5α 26 3.1.4 Nhân dòng vector pSUMO_fliC 26 3.2 Biểu protein FliC tái tổ hợp 27 3.2.1 Biến nạp pSUMO_fliC vào E coli Rosetta so sánh kích thước gene fliC chủng E coli 27 3.2.2 Biểu flagellin dạng dung hợp tế bào E.coli 28 3.2.3 Tối ƣu biểu protein tái tổ hợp tế bào biểu E.coli Rosetta .29 3.3 Tinh định lƣợng protein FliC 38 3.3.1 Xử lý tiền tinh chế 38 3.3.2 Tinh protein SUMO-fliC sắc ký lực 39 3.3.3 Đánh giá ổn định cấu trúc protein dung hợp trình tinh phƣơng pháp Western blot 40 3.3.4 Giải trình tự cấu trúc protein flagellin tái tổ hợp 42 KẾT LUẬN VÀ KIẾN NGHỊ 45 TÀI LIỆU THAM KHẢO 46 PHỤ LỤC 53 DANH MỤC CÁC HÌNH Hình 1.1: Vi khuẩn Salmonella[9] Hình 1.2: Lát cắt ngang cấu trúc roi (a) cấu trúc protein flagellin (b)[36] Hình 1.3: Cơ chế bảo vệ phóng xạ flagellin [54] Hình 1.4: Trình tự amino axit flagellin sử dụng thí nghiệm Hình 2.1: Cấu trúc gene fliC cải biến 13 Hình 2.2: Sơ đồ thiết kế thí nghiệm 17 Hình 2.3 Sơ đồ cấu tạo đơn giản hệ thống khối phổ 23 Hình 3.1: Kết điện di sản phẩm PCR khuếch đại gene fliC 24 Hình 3.2: Kết điện di sản phẩm cắt gene fliC vector pSUMO3 25 Hình 3.3: Sự phát triển tế bào E.coli sau biến nạp 27 Hình 3.4: So sánh gene fliC sau biến nạp vào chủng E.coli 28 Hình 3.5:Biểu protein tế bào E.coli Rosetta 29 Hình 3.6: Biểu protein flagellin mơi trường ni cấy 31 Hình 3.7: Kiểm tra biểu fliC nồng độ IPTG 33 Hình 3.9: Kiểm tra biểu fliC điều kiện thời gian thu mẫu khác 37 Hình 10: Kết xử lý tiền tinh chế flagellin tái tổ hợp ure 39 Hình 3.11: Kết tinh flagellin tái tổ hợp sắc ký lực .40 Hình 3.12: Xác định fliC Western blot 42 Hình 13: Trình tự acid amin tương ứng gen fliC tự nhiên 43 Hình 3.14: Đoạn trình tự axit amin protein tái tổ hợp đọc ngẫu nhiên 43 Hình 3.15: So sánh cấu trúc 3D dự đoán protein flagellin tái tổ hợp với cấu trúc flagellin tự nhiên 43 DANH MỤC CÁC BẢNG Bảng 2.1: Các loại enzyme, kháng thể hóa chất dùng nghiên cứu 14 Bảng 2.2: Môi trường dung dịch dùng cho nghiên cứu 15 Bảng2.3: Các thiết bị dùng nghiên cứu 16 Bảng 2.4: Thành phần phản ứng PCR 18 Bảng 2.5: Thành phần hỗn hợp phản ứng cắt 19 Bảng 2.6: Thành phần phản ứng nối gene fliC vào vector pSUMO3 19 DANH MỤC TỪ VIẾT TẮT Chữ viết tắt Nghĩa tiếng Anh Nghĩa tiếng Việt AD Antigenin determinant Vùng định kháng nguyên Amp Ampicillin Kháng sinh Ampicillin ADN Deoxyribonucleic acid Axit deoxyribonucleic ARN Ribonucleic acid Axit ribonucleic APN Ammoium persufate Ammoium persufate Apoptosis Apoptosis Chết theo chƣơng trình Bp Base pair Cặp bazo-nito Enzyme-linked Kỹ thuật miễn dịch gắn enzyme ELISA immunosorbent assay G-CSF Granulocyte colony Yếu tố kích thích cụm bạch cầu hạt stimulating factor IFA Immunofluorescence Assay Kỹ thuật miễn dịch huỳnh quang IgG Immunoglobulin G Immunoglobulin G IgM Immunoglobulin M Immunoglobulin M IPTG Isopropyl-beta-D-1- Chất cảm ứng IPTG thiogalactopyranoside Kda Kilo Dalton Kilo Dalton LB Luria-Bertani Môi trƣờng LB Dntp Nucleoside 5’- triphosphates Nucleoside 5’- triphosphates OD Optical density Mật độ quang học PCR Polymerase Chain Reaction Phản ứng chuỗi trùng hợp pSUMO Plasmid Ssmall Ubiquitin-like Plasmid tái tổ hợp mang gen FliC Modifier PVDF Polyvinylidin difluorit Polyvinylidin difluorit PBS Phosphate buffered saline Phosphate buffered saline Rpm Revolutions per minute Vòng/phút SDS Sodium dodecyl sulfate Natri dodexin sunfat SDS-PAGE Sodium dodecyl sulfate Điện di gel polyacrylamit có polyacrylamide gel chứa SDS electrophoresis TAE TEMED VD Tris-acetate-EDTA Tris-acetate-EDTA Tetrathylethylenediamine Tetrathylethylenediamine Variable domains Vùng biến đổi kháng nguyên Luận văn cao học Nguyễn Thị Nhung MỞ ĐẦU Protein flagellin có nguồn gốc từ vi khuẩn Salmonella spp, từ lâu đƣợc ý đến nhƣ tá dƣợc tiềm đặc tính hỗ trợ miễn dịch Với khả kích thích mạnh mẽ hệ miễn dịch bẩm sinh, miễn dịch kích ứng kích hoạt biểu nhiều gene liên quan đến trình ngăn cản tế bào apoptosis Vì vậy, protein flagellin có nhiều ứng dụng ngành cơng nghệ sinh học y dƣợc nhƣ làm vaccine, chất hỗ trợ miễn dịch, kích hoạt hệ miễn dịch chống ung thƣ Trên giới, flagellin tái tổ hợp đƣợc nhiều cơng trình nghiên cứu để ứng dụng sinh học điều trị Nhƣ chế phẩm Entolimod với thành phần flagellin có chức tăng cƣờng phục hồi hệ miễn dịch, giảm tổn thƣơng bệnh phóng xạ cấp tăng tái tạo mơ Ở Việt Nam, nay, có vài nghiên cứu làm flagellin tái tổ hợp Cụ thể nhƣ nhóm nghiên cứu Phịng Kỹ thuật di truyền, Viện công nghệ sinh học biểu tinh protein fliC, fljB có nguồn gốc từ chủng S enterical nhằm tạo vaccine tái tổ hợp kit chẩn đoán bệnh vi khuẩn Salmonella gà Tƣơng tự cách tiếp cận này, nhóm nghiên cứu trƣờng ĐHKHTN, ĐHQGTPHCM biểu thành công protein fliC nguồn gốc từ chủng S Enteritidis Tuy nhiên nghiên cứu chủ yếu theo định hƣớng tạo protein flagellin làm kháng nguyên cho gia cầm Mức độ biểu tinh protein tái tổ hợp quy mơ nhỏ, hiệu suất chƣa cao Chính vậy, mục tiêu để tài nghiên cứu nhằm tạo nguồn cung cấp flagellin tái tổ hợp lớn, chủ động với định hƣớng sử dụng cho hỗ trợ tăng cƣờng miễn dịch ngƣời Chúng tiến hành thực đề tài luận văn: “Biểu gene fliC cải biến Salmonella dublin Escherichia coli đánh giá hoạt tính sinh học protein tái tổ hợp” Đề tài đƣợc thực phòng Độc học bệnh nhiệt đới – Viện Y sinh nhiệt đới – Trung tâm Nhiệt đới Việt Nga Mục tiêu nghiên cứu: - Tách dịng biểu gene fliC mã hóa protein flagellin E.coli - Tinh chế protein flagellin tái tổ hợp đáp ứng yêu cầu làm thuốc 10 16 Hajam IA, D P., Sekar SC, Nanda R, Kishore S, Bhanuprakash V, Ganesh K (2013), "Expression, purification, and functional characterisation of flagellin, a TLR5-ligand" Veterinaria Italiana, 49 (2), pp 181-186 17 Hatai H, L A., Zeng W, Hayden MS, Ghosh S (2016), "Toll-Like Receptor 11 (TLR11) Interacts with Flagellin and Profilin through Disparate Mechanisms" PLoS One, 11 (2), pp e0148987 18 Hayashi F, M T., Luster AD (2003), "Toll-like receptors stimulate human neutrophil function" Blood, 102 (7), pp 2660-2669 19 Imada, K (2018), "Bacterial flagellar axial structure and its construction " Biophysical Reviews, 10 (2), pp 559-570 20 Jeffrey G Marblestone, S C E., Yiting Lim, Peter Lim, Xun Zuo, Tauseef R Butt (2006), "Comparison of SUMO fusion technology with traditional gene fusion systems: Enhanced expression and solubility with SUMO" Protein Science, 15 (1), pp 182-189 21 Joseph BC, S P., S Srimeenakshi, M Murthy, K Selvakumar, M Ganesan, SR Manjunath (2015), "An overview of the parameters for recombinant protein expression in Escherichia coli" Journal of Cell Science & Therapy, (5), pp 22 K, T (2006), "Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems" Applied Microbiology and Biotechnology, 72 (2), pp 211-222 23 Kawashima H, H T., Ogawa T, Ogawa H (1984), "Functional domains of Escherichia coli recA protein deduced from the mutational sites in the gene" Molecular Genetics and Genomics 193 (2), pp 288-292 24 Kelly MG, A A., Chen R, Silasi DA, Abrahams VM, Chan S, Visintin I, Rutherford T, Mor G (2006), "TLR-4 signaling promotes tumor growth and paclitaxel chemoresistance in ovarian cancer" Cancer Research, 66 (7), pp 3859-3868 25 Kofoed EM, V R (2011), "Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity" Nature, 477 (7366), pp 592595 26 Krivokrysenko VI, S A., Singh VK, Bone F, Kononov Y, Shyshynova I, Cheney A, Maitra RK, Purmal A, Whitnall MH, Gudkov AV, Feinstein E (2012), "Identification of granulocyte colony-stimulating factor and interleukin-6 as candidate biomarkers of CBLB502 efficacy as a medical radiation countermeasure" Journal of Pharmacology and Experimental Therapeutics, 343 (2), pp 497-508 27 Krivokrysenko VI, T I., Gleiberman AS, Krasnov P, Shyshynova I, Bespalov I, Maitra RK, Narizhneva NV, Singh VK, Whitnall MH, Purmal AA, Shakhov AN, Gudkov AV, Feinstein E (2015), "The Toll-like receptor agonist entolimod mitigates lethal acute radiation syndrome in non-human primates" PLoS One, 10 (9), pp e0135388 28 Lightfield KL, P J., Brubaker SW, Witte CE, von Moltke J, Dunipace EA, Henry T, Sun YH, Cado D, Dietrich WF, Monack DM, Tsolis RM, Vance RE (2008), "Critical function for Naip5 in inflammasome activation by a conserved carboxy-terminal domain of flagellin" Nature Immunology, (10), pp 1171-1178 29 Liu Z, L X., Li X, Cai JM, Gao F, Yang YY (2018), "Toll-like receptors and radiation protection" European Review for Medical and Pharmacological Sciences, 22 (1), pp 31-39 30 Lu J, S P (2012), "The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling" Science Signaling, (223), pp 0e11 31 Maerten P, S C., Bullens DM, Van Assche G, Van Gool S, Geboes K, Rutgeerts P, Ceuppens JL (2005), "Effects of interleukin on CD25+CD4+ regulatory T cell function" Journal of Autoimmunity, 25 (2), pp 112-120 32 Malakhov MP, M M., Malakhova OA, Drinker M, Weeks SD, Butt TR (2004), "SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins" Journal of Structural and Functional Genomics, (1-2), pp 75-86 33 McDermott PF, C.-W F., Snipes JA, Mizel SB (2000), "High-affinity interaction between gram-negative flagellin and a cell surface polypeptide results in human monocyte activation" Infection and Immunity, 68 (10), pp 5525-5529 34 MM, C (1991), "The RecA protein as a recombinational repair system" Molecular Microbiology, (6), pp 1295-1299 35 Murthy KG, D A., Goonesekera S, Szabó C, Salzman AL (2004), "Identification of conserved domains in Salmonella muenchen flagellin that are essential for its ability to activate TLR5 and to induce an inflammatory response in vitro" Journal of Biological Chemistry, 279 (7), pp 5667-5675 36 Namba K, V F (1997), "Molecular architecture of bacterial flagellum" Quarterly Reviews of Biophysics, 30 (1), pp 1-65 37 Napolitani G, R A., Bertoni F, Sallusto F, Lanzavecchia A (2005), "Selected Toll-like receptor agonist combinations synergistically trigger a T helper type 1-polarizing program in dendritic cells" Nature Immunology, (8), pp 769776 38 Nithichanon A, R D., Gori A, Lassaux P, Peri C, Conchillio-Solé O, FerrerNavarro M, Gourlay LJ, Nardini M, Vila J, Daura X, Colombo G, Bolognesi M, Lertmemonkolchai G (2015), "Sequence- and Structure-Based Immunoreactive Epitope Discovery for Burkholderia pseudomallei Flagellin" PLOS Neglected Tropical Diseases, (7), pp e0003917 39 Peciak K, T R., Choi JW2, Brocchini S1, Laurine E (2014), "Expression of soluble and active interferon consensus in SUMO fusion expression system in E coli" Protein Expression and Purification, 99, pp 18-26 40 RG Taylor, D W., RR McInnes (1993), "E coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing" Nucleic Acids Research, 21 (7), pp 1677-1678 41 Roach JC, G G., Rowen L, Kaur A, Purcell MK, Smith KD, Hood LE, Aderem A (2005), "The evolution of vertebrate Toll-like receptors" Proceedings of the National Academy of Sciences of the United States of Americ, 102 (27), pp 9577-9582 42 Rosano GL, C E (2014), "Recombinant protein expression in Escherichia coli: advances and challenges" Frontiers in Microbiology, 5, pp 172 43 Salaun B, C I., Rissoan MC, Lebecque SJ, Renno T (2006), "TLR3 can directly trigger apoptosis in human cancer cells" Journal of Immunology, 176 (8), pp 4894-4901 44 Sambrook J, F E., Maniatis T, Molecular cloning: a laboratory manual Cold Spring Harbor Laboratory Press: New York, 2003 45 Schmausser B, A M., Endrich S, Müller-Hermelink HK, Eck M (2005), "Tolllike receptors TLR4, TLR5 and TLR9 on gastric carcinoma cells: an implication for interaction with Helicobacter pylori" International Journal of Medical Microbiology, 295 (3), pp 179-185 46 Sfondrini L, R A., Besusso D, Merlo A, Tagliabue E, Mènard S, Balsari A (2006), "Antitumor activity of the TLR-5 ligand flagellin in mouse models of cancer" Journal of Immunology, 176 (11), pp 6624-6630 47 Shi Z, C Z., Yu J, Zhang T, Zhao S, Smeds E, Zhang Q, Wang F, Zhao C, Fu S, Ghosh S, Zhang D (2012), "Toll-like receptor 11 (TLR11) prevents Salmonella penetration into the murine Peyer patches" Journal of Biological Chemistry, 287 (52), pp 43417-43423 48 Song WS, C S., Hong HJ, Park SC, Yoon SI () (2017), "Self Oligomerizing structure of the flagellar cap protein FliD and its implication in filament assembly" Journal of Molecular Biology, 429 (6), pp 847-857 49 Song WS, Y S (2014), "Crystal structure of FliC flagellin from Pseudomonas aeruginosa and its implication in TLR5 binding and formation of the flagellar filament" Biochemical and Biophysical Research Communications, 444 (2), pp 109-115 50 Szczepanski MJ, C M., Szajnik M, Harasymczuk M, Boyiadzis M, KrukZagajewska A, Szyfter W, Zeromski J, Whiteside TL (2009), "Triggering of Toll-like receptor expressed on human head and neck squamous cell carcinoma promotes tumor development and protects the tumor from immune attack" Cancer Research, 69 (7), pp 3105-3113 51 UK, L (1970), "Cleavage of structural proteins during the assembly of the head of bacteriophage T4" Nature, 227 (5259), pp 680-685 52 Vijay-Kumar M, A J., Sanders CJ, Frias A, Sloane VM, Xu J, Neish AS, Rojas M, Gewirtz AT (2008), "Flagellin treatment protects against chemicals, bacteria, viruses, and radiation" Journal of Immunology, 180 (12), pp 82808285 53 William Wu, H H Z., Michael J Welsh, Peter B Kaufman, Gene Biotechnology CRC Press: 2003 54 WN, B (1981), ""Western blotting": electrophoretic transfer of proteins from sodium dodecyl sulfate polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A" Analytical Biochemistry, 112 (2), pp 195-203 55 Wyant TL, T M., Sztein MB (1999), "Salmonella typhi flagella are potent inducers of proinflammatory cytokine secretion by human monocytes" Infection and Immunity, 67 (7), pp 3619-3624 PHỤ LỤC Phụ lục 1: Sơ đồ cấu trúc vector pSUMO3 (Lifesensor) Phụ lục 2: Mật độ tế bào mội trƣờng khác Chú thích: 1: Mơi trường LB; 2: Mơi trường TB; 3: Môi trường SB; 4: Môi trường M9+0,5%YE; 5: Môi trường M9+0,5%YE+1%glucose; 6: Môi trường M9+1%glucose Phụ lục 3: Mật độ tế bào nồng độ IPTG khác Mật độ tế bào nồng độ IPTG: 0; 0,05; 0,1; 0,25; 0,5; 1; 2mM (trái qua phải) Phụ lục 4: Kết giải trình tự gen fliC vector biểu pSUMO3 Phụ lục 5: Trình tự nucleotide gen fliC sau giải xong: ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAG AATAACCTGAACAAATCTCAGTCCTCACTGAGTTCCGCTATTGAGCGTCT GTCCTCTGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGCCAG GCGATTGCTAACCGCTTCACTTCTAATATCAAAGGTCTGACTCAGGCTTC CCGTAACGCTAACGACGGCATTTCTATTGCGCAGACCACTGAAGGTGCG CTGAATGAAATCAACAACAACCTGCAGCGTGTGCGTGAGTTGTCTGTTC AGGCCACTAACGGGACTAACTCTGATTCCGATCTGAAATCTATCCAGGA TGAAATTCAGCAACGTCTGGAAGAAATCGATCGCGTTTCTAATCAGACT CAATTTAACGGTGTTAAAGTCCTGTCTCAGGACAACCAGATGAAAATCC AGGTTGGTGCTAACGATGGTGAAACCATTACCATCGATCTGCAAAAAAT TGATGTGAAAAGCCTTGGCCTTGATGGGTTCAATGTTAATTCCCCGGGA ATTTCCGGTGGTGGTGGTGGAATTCTAGACTCCATGGGTACATTAATCA ATGAAGACGCTGCCGCAGCCAAGAAAAGTACCGCTAACCCACTGGCTTC AATTGATTCTGCATTGTCAAAAGTGGACGCAGTTCGTTCTTCTCTGGGGG CAATTCAAAACCGTTTTGATTCAGCCATTACCAACCTTGGCAATACGGT AACCAATCTGAACTCCGCGCGTAGCCGTATCGAAGATGCTGACTATGCA ACGGAAGTTTCTAATATGTCTAAAGCGCAGATTCTGCAGCAGGCTGGTA CTTCCGTTCTGGCGCAGGCTAACCAGGTTCCGCAAAACGTCCTCTCTTTA CTGCGTTAA Phụ lục 6: Kết BLAST trình tự gen fliC giải đƣợc với trình tự thiết kế ban đầu: Phụ lục 7: Kết dựng đƣờng chuẩn hàm lƣợng protein sau tinh sạch: Phụ lục 8: Giải trình tự protein flagellin tái tổ hợp từ fliC Phụ lục 9: Trình tự đoạn gen fliC cải biến Trình tự đoạn gen flic1 kích thước 813 bp Trình tự đoạn gen flic có kích thước 861 bp Trình tự đoạn gen flic có kích thước 891 bp ...ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN ***** NGUYỄN THỊ NHUNG BIỂU HIỆN GENE fliC CẢI BIẾN CỦA Salmonella dublin TRONG Escherichia coli VÀ ĐÁNH GIÁ HOẠT TÍNH SINH HỌC CỦA PROTEIN. .. 3.2 Biểu protein FliC tái tổ hợp 27 3.2.1 Biến nạp pSUMO _fliC vào E coli Rosetta so sánh kích thước gene fliC chủng E coli 27 3.2.2 Biểu flagellin dạng dung hợp tế bào E .coli. .. Tổng hợp protein tái tổ hợp đòi hỏi sử dụng hệ thống biểu phù hợp với cấu trúc hoạt tính protein Trong nghiên cứu này, lựa chọn chủng biểu E coli Rosetta vector pE_SUMO3 để tạo dòng tế bào biểu FliC