1. Trang chủ
  2. » Luận Văn - Báo Cáo

Nghiên cứu đặc điểm sinh học và tính kháng kháng sinh của neisseria meningitidis tại các ổ dịch lưu hành trong quân đội

80 7 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 80
Dung lượng 1,77 MB

Nội dung

ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - VŨ THỊ XUÂN THU NGHÊN CỨU ĐẶC ĐIỂM SINH HỌC VÀ TÍNH KHÁNG KHÁNG SINH CỦA Neisseria meningitidis TẠI CÁC Ổ DỊCH LƢU HÀNH TRONG QUÂN ĐỘI LUẬN VĂN THẠC SĨ KHOA HỌC Hà Nội - 2015 ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - VŨ THỊ XUÂN THU NGHÊN CỨU ĐẶC ĐIỂM SINH HỌC VÀ TÍNH KHÁNG KHÁNG SINH CỦA Neisseria meningitidis TẠI CÁC Ổ DỊCH LƢU HÀNH TRONG QUÂN ĐỘI Chuyên ngành: Vi sinh vật học Mã số: 60420107 LUẬN VĂN THẠC SĨ KHOA HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC: TS ĐOÀN TRỌNG TUYÊN GS TS PHẠM VĂN TY Hà Nội – 2015 LỜI CẢM ƠN Tôi xin chân thành cảm ơn Ban giám hiệu, Khoa Sinh Học-Trường Đại Học Khoa Học Tự Nhiên-Đại Học Quốc Gia Hà Nội, hết lịng tạo điều kiện để chúng tơi học tập tốt đạt thành ngày hơm Đặc biệt, với lịng biết ơn sâu sắc, xin gửi lời cảm ơn tới thầy hướng dẫn TS Đoàn Trọng Tuyên GS TS Phạm Văn Ty đã tâ ̣n tâm hướng dẫn , giúp đỡ, tạo điều kiện thuận lợi để tơi hồn thành luận văn tốt nghiệp Tôi cũng xin gửi lời cảm ơn chân thành nhấ t đế n cán bô ̣ nhân viên của khoa Vi sinh Vật viê ̣n Y họ c Dự phòng Quân đội và Lañ h đa ̣o huy viện đã giúp đỡ tạo điều kiện để thu thập số liệu , thực nghiên cứu hoàn thành luận văn tốt nghiệp Xin gửi tới Ban lãnh đạo Bệnh viện Phổi Hà Nội lời cảm ơn sâu sắc tạo điều kiện thời gian để tơi hồn thành khóa học Một lần nữa, xin gửi lời cảm ơn tới thầy cơ, bạn bè tồn người thân gia đình ln giúp đỡ nhiệt tình động viên tơi suốt q trình học tập Học Viên Vũ Thị Xuân Thu MỤC LỤC MỞ ĐẦU Chƣơng TỔNG QUAN 1.1 Một số đặc điểm dịch tễ học bệnh viêm màng não Neisseria meningitidis 1.1.1 Dịch tễ học bệnh viêm màng não 1.1.2 Dịch tễ học người mang mầm bệnh không triệu chứng 1.2 Đặc điểm sinh học N meningitidis 1.2.1 Danh pháp phân loại Não mô cầu [32] 1.2.2 Tính chất ni cấy 1.2.3 Sức đề kháng 1.2.4 Những kháng nguyên quan trọng Não mô cầu [2], [5], [9], [62] 1.3 Các kỹ thuật chẩn đoán phịng thí nghiệm 11 1.3.1 Kỹ thuật nhuộm soi 11 1.3.2 Kỹ thuật phân lập 11 1.3.3 Kỹ thuật điện di miễn dịch 12 1.3.4 Kỹ thuật ngưng kết 12 1.3.5 Kỹ thuật sinh học phân tử phát vi khuẩn gây viêm màng não 13 1.4 Đặc điểm gene đích phát N meningitidis 14 1.5 Đặc điểm gene đích (gene đặc hiệu) xác định nhóm huyết N meningitidis 16 1.6 Đáp ứng miễn dịch 19 1.7 Điều trị dự phòng 21 Chƣơng ĐỐI TƢỢNG, VẬT LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU 24 2.1 Đối tượng 24 2.2 Vật liệu nghiên cứu 24 2.2.1 Thiết bị 24 2.2.2 Sinh phẩm 24 2.3 Phương pháp nghiên cứu 25 2.3.1 Phương pháp dịch tễ học mô tả cắt ngang 25 2.3.2 Phương pháp thực nghiệm phịng thí nghiệm 25 2.4 Xử lý số liệu phần mềm Epi–info 3.2 34 Chƣơng KẾT QUẢ NGHIÊN CỨU VÀ BÀN LUẬN 35 3.1 Đặc điểm sinh học cấu nhóm huyết Neisseria meningitidis phân lập số đơn vị tân binh quân đội 35 3.1.1 Đặc điểm sinh học chủng Neisseria meningitidis phân lập đơn vị tân binh quân đội 35 3.1.2 Cơ cấu nhiễm Neisseria meningitidis nhóm huyết chủng Neisseria meningitidis phân lập đơn vị tân binh quân đội phương pháp PCR 38 3.1.3 Khảo sát đặc điểm sinh học phân tử chủng N.meningitidis phân lập cặp mồi đặc hiệu loài nhóm N.meningitidis thơng qua phản ứng PCR 44 3.2 Đánh giá nhậy cảm với kháng sinh chủng N meningitidis nhóm huyết B C 53 KẾT LUẬN 58 KHUYẾN NGHỊ 58 TÀI LIỆU THAM KHẢO 60 PHỤ LỤC 71 DANH MỤC BẢNG Bảng 1.1 Đặc điểm sinh học Neisseria meningitidis Bảng 1.2 : Dạng nhóm huyết capsule gene đích cho genotype N meningitidis 18 Bảng 1.3 Protein màng N meningitidis 20 Bảng 1.4 Đặc điểm lâm sàng, chẩn đoán, điều trị nhiễm N meningitidis 21 Bảng Các hóa chất gắn giếng thẻ định danh NH 26 Bảng 2.2: Trình tự mồi khảo sát phát gene đích N meningitidis nhóm huyết (A; B; C) 31 Bảng 2.3:Tiêu chuẩn đánh giá MIC theo hướng dẫn Viện lâm sàng chuẩn thức phịng thí nghiệm (CLSI) năm 2013 33 Bảng 3.1 Đặc điểm chuyển hóa axit amin N.meningitidis 35 Bảng 3.2 Đặc điểm chuyển hóa đường N.meningitidis 36 Bảng 3.3 Đặc điểm chuyển hóa axit amin N.meningitidis 37 Bảng 3.4 Đặc điểm chuyển hóa đường N.meningitidis 37 Bảng 3.5: Tỷ lệ nhiễm N meningitidis nhóm huyết lưu hành 03 đơn vị giám sát 38 Bảng 3.6: Tần suất nhiễm N meningitidis nhóm huyết 39 theo trung đoàn 39 Bảng 3.7: Tỷ lệ nhiễm N meningitidis nhóm huyết theo vị trí địa lý 41 Bảng 3.8 Kết kiểm tra chủng N meningitidis NH cấu nhóm huyết kỹ thuật Multiplex-PCR 42 Bảng 3.9: Xác định MIC chủng Neisseria meningitidis, nhóm huyết B (n=23) 53 Bảng 3.10: Kết thử nghiệm in vivo người nhiễm N meningitidis, nhóm huyết B 55 Bảng 3.11 : Xác định MIC (in vitro) chủng Neisseria meningitidis, nhóm huyết C (n=4) 55 Bảng 3.12: Kết thử nghiệm in vivo người nhiễm N meningitidis, nhóm huyết C 56 DANH MỤC HÌNH Hình 1.1: Hình ảnh nhuộm Gram N meningitidis từ dịch não tủy Hình 1.2:Khuẩn lạc N meningitidis thạch chocolate Hình 1.3: Khuẩn lạc N meningitidis thạch máu Hình 1.4: Hình ảnh màng tế bào N meningitidis cắt ngang Hình 1.5: Hình ảnh nuôi cấy N meningitidis môi trường thạch chocolate có kháng sinh 12 Hình1.6: Hình ảnh định danh N meningitidis định danh API NH 12 Hình 1.7 : Hình ảnh sinh phẩm Pastorex phát N meningitidis 13 Hình 1.8: Đặc điểm gene mã hóa kháng nguyên N meningitidis 15 Hình 1.9 : Bản đồ gene capsule (CPS) Nmen (14), ctrABCD operon mã hóa ATP-protein 19 Hình 2.1 : Thiết kế nghiên cứu đặc điểm sinh học N meningitidis 25 Hình 2.2 Thanh E test 33 Hình 2.3 Kết thử nghiệm MIC E test 33 Hình 3.1: Khảo sát gene CtrA 32 chủng N Meningitidis 45 Hình 3.2: Khảo sát gene ctrA 32 chủng N Meningitidis 46 Hình 3.3: Tiếp tục khảo sát xuất gene ctrA 32 chủng N Meningitidis 47 Hình 3.4: Kết khảo sát có mặt gene Por A 32 chủng N meningitidis phân lập 48 Hình 3.5: Khảo sát gene CrgA mã hóa LysR N meningitidis 32 49 Hình 3.6: Khảo sát gene SodC 32 chủng N meningitidis 50 Hình 3.7 : Khảo sát gene sac D phát N meningitidis nhóm huyết A, 51 Hình 3.8: Khảo sát gene sac Db phát N meningitidis nhóm B 52 Hình 3.9: Khảo sát gene sia Dc phát N meningitidis nhóm C 53 DANH MỤC CÁC TỪ VIẾT TẮT NMC: Não mô cầu VMN: Viêm màng não PS: Polysaccharide LOS: Lipo – oligosaccharide LPS: Lipopolysaccharide OMP: OuRer membrase protein PCR: Polymerase chain reaction MIC Minimum inhibition concentration VSV: Vi sinh vật MỞ ĐẦU Viêm màng não bệnh lý nhiễm trùng nghiêm trọng, tỷ lệ tử vong cao khơng nghĩ đến, khơng chẩn đốn điều trị kịp thời Sự hiểu biết tác nhân gây bệnh thường gặp, hỗ trợ cho cơng tác điều trị xây dựng chương trình phòng chống bệnh tật Quốc gia Hầu hết liệu dịch tễ viêm màng não mủ người lớn xuất phát từ quốc gia phát triển, tác nhân gây bệnh thường gặp là: Streptococcus pneumoniae (30%-60%), Neisseria meningitidis (13-37%), Listeria monocytogenes Haemophilus influenzae Neisseria meningitidis, Haemophilus influenzae type b (Hib) Streptococcus pneumoniae loại vi khuẩn có vỏ (polysaccharide-encapsuleated) nguyên nhân quan trọng gây bệnh tử vong giới [23] Hàng năm có từ 400.000 – 500.000 người chết viêm màng não (WHO, 2006) Trong thời gian cuối kỷ 20 đầu kỷ 21, có chuyển đổi việc chẩn đoán tác nhân sinh học, kết hợp kiểu hình huyết học với việc xác định kiểu gene kỹ thuật sinh học phân tử [39] Phân tích tính đa dạng tổ hợp trình tự nhiều vùng gene (MLST) tiêu chuẩn vàng cho việc xác định đặc điểm vi khuẩn N meningitidis phục vụ công tác giám sát dịch tễ học Sự phát triển kỹ thuật phân tử cho phép phân tích vi khuẩn gây viêm màng não từ mẫu nuôi cấy phân lập không phân lập để chẩn đốn xác định ca bệnh trở thành cơng cụ hữu ích cho nâng cao chất lượng giám sát, phát tiên lượng dịch, chiến lược phịng ngừa nước Châu âu [7] Nhằm nâng cao chất lược, hiệu việc phát tác nhân sở xác định đặc điểm kiểu hình kiểu gene Neisseria meningitidis quan trọng giúp tiên lượng, dự báo dịch đề xuất phác đồ dự phòng, điều trị nhằm hạn chế tỷ lệ nhiễm N meningitidis, mắc bệnh cộng đồng Với đề tài nghiên cứu: “ Nghiên cứu đặc điểm sinh học tính kháng kháng sinh Neisseria meningitidis ổ dịch lưu hành quân đội Với mục tiêu: Xác định đặc điểm sinh học cấu nhóm huyết Neisseria meningitidis phân lập số đơn vị tân binh quân đội Xác định tính nhạy cảm kháng sinh chủng Neisseria meningitidis phân lập từ người mang mầm bệnh không triệu chứng KẾT LUẬN Đặc điểm sinh học cấu nhóm huyết NMC phân lập số đơn vị tân binh quân đội: - 02 chủng NMC khơng lên men đường Maltose tập chung nhóm huyết B - 100% NMC nhóm C có gene SiaDc 01 chủng khơng có Gene CtrA - Cơ cấu nhóm huyết thanh: tỷ lệ nhiễm NMC chung 37,32 %, nhóm huyết B chiếm 85,90% Tính nhạy cảm kháng sinh chủng NMC phân lập từ người mang mầm bệnh không triệu chứng: - Amoxicilin: in vitro nhóm hyết B,C nhạy cảm giới hạn trung gian (87%-100%) in vivo nhóm huyết B,C tỉ lệ khuẩn lần lượt(53,33%-50%) - Ciprofloxacin: in vitro nhóm huyết B nhạy cảm 100%,trên nhóm huyết C kháng 100% in vivo nhóm huyết B khuẩn 72,22%, nhóm huyết C khuẩn 100% 58 KHUYẾN NGHỊ  Bộ Y tế cần có chương trình giám sát Não mơ cầu 59 TÀI LIỆU THAM KHẢO [1].Achtman M (1995), "Epidemic spread and antigenic variability of Neisseria meningitidis", Trends in Microbiology (5), pp 186-192 [2] Bentley, S D., G S Vernikos, L A Snyder, C Churcher, C Arrowsmith, T Chillingworth, A Cronin, P H Davis, N E Holroyd, K Jagels, M Maddison, S Moule, E Rabbinowitsch, S Sharp, L Unwin, S Whitehead, M A Quail, M Achtman, B Barrell, N J Saunders, and J Parkhill (2007), “Meningococcal genetic variation mechanisms viewed through comparative analysis of serogroup C strain FAM18”, PLoS Genetics 3, pp 23 [3] Boisier, P., P Nicolas, S Djibo, M K Taha, I Jeanne, H B Mainassara, B Tenebray, K K Kairo, D Giorgini, and S Chanteau (2007), “Meningococcal meningitis: unprecedented incidence of serogroup X-related cases in 2006 in Niger”, Clinical Infectious Diseases 44, pp 657-663 [4] Borel, T., A M Rose, M Guillerm, F Sidikou, S Gerstl, A Djibo, N Nathan, S Chanteau, and P J Guerin (2006), “High sensitivity and specificity of the Pastorex latex agglutination test for Neisseria meningitidis serogroup A during a clinical trial in Niger”, Transactions of the Royal Society of Tropical Medicine and Hygiene 100, pp 964-969 [5] Borrow, R., H Claus, U Chaudhry, M Guiver, E B Kaczmarski, M Frosch, and A J Fox (1998), “siaD PCR ELISA for confirmation and identification of serogroup Y and W135 meningococcal infections”, FEMS Microbiology Letters 159, pp 209-214 [6] Borrow, R., H Claus, M Guiver, L Smart, D M Jones, E B Kaczmarski, M Frosch, and A J Fox (1997), “Non-culture diagnosis and serogroup determination of meningococcal B and C infection by a sialyltransferase (siaD) PCR ELISA”, Epidemiology and Infection 118, pp.111-117 [7] Broome CV (1986),“The carrier state: Neisseria meningitidis” , J Antimicrob Chemother 18 (Suppl A), pp 25–34 60 [8] Bundle, D R., H J Jennings, and C P Kenney (1974), “Studies on the groupspecific polysaccharide of Neisseria meningitidis serogroup X and an improved procedure for its isolation”, Journal of Biological Chemistry 249, pp 4797-4801 [9] Bustin, S A (2004), “The PCR Revolution Basic technologies and Applications”, Cambridge University Press [10] Caugant DA, Høiby EA, Magnus P, Scheel O, Hoel T, Bjune G, Wedege E, Eng J & Frøholm LO (1994), “Asymptomatic carriage of Neisseria meningitidis in a randomly sampled population” J Clin Microbiol 32, pp 323–330 [11] Cartwright K (1995), “Meningococcal carriage and disease Meningococcal Disease” (CartwrightK, ed), pp 115–146 [12] Carvalho, M G., M L Tondella, K McCaustland, L Weidlich, L McGee, L W Mayer, A Steigerwalt, M Whaley, R R Facklam, B Fields, G Carlone, E W Ades, R Dagan, and J S Sampson (2007), “Evaluation and improvement of realtime PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA” Journal of Clinical Microbiology 45, pp 2460-2466 [13] Cedric Mims (1996), “The Pathogenesis of the Acute Exanthemst” Review in Medical Virology Vol 6, pp 1-8 [14] Clare L Bennett, Erwin van Rijn, Steffen Jung, Kayo Inaba, Ralph M Steinman, Martien L Kapsenberg, and Björn E Clausen (2005), “Inducible ablation of mouse langerhans cells diminishes but fails to abrogate contact hypersensitivity”, The Journal of Cell Biology, Vol 169, No 4,pp 569-576 [15] Claus, H., R Borrow, M Achtman, G Morelli, C Kantelberg, E Longworth, M Frosch, and U Vogel (2004), “Genetics of capsule O-acetylation in serogroup C, W-135, and Y meningococci”, Molecular Microbiology 51, pp 227-239 [16] Claus, H., M C Maiden, R Maag, M Frosch, and U Vogel (2002), “Many carried meningococci lack the genes required for capsule synthesis and transport”, Microbiology 148, pp 1813-1819 61 [17] Claus, H., U Vogel, M Muhlenhoff, R Gerardy-Schahn, and M Frosch (1997), “Molecular divergence of the sia locus in different serogroups of Neisseria meningitidisexpressing polysialic acid capsules”, Molecular and General Genetics 257, pp 28-34 [18] Corless, C E., M Guiver, R Borrow, V Edwards-Jones, A J Fox, and E B Kaczmarski (2001), “Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR”, Journal of Clinical Microbiology 39, pp 1553-1558 [19] Csako, G (2006) “Present and future of rapid and/or high-throughput methods for nucleic acid testing”, Clinica Chimica Acta 363, pp 6-31 [20] Dolan-Livengood, J M., Y K Miller, L E Martin, R Urwin, and D S Stephens (2003), “Genetic basis for nongroupable Neisseria meningitidis” Journal of Infectious Diseases 187, pp 1616-1628 [21] Dolan Thomas, J., C.P Hatcher, D.A Satterfield, M.J Theodore, M.C Bach, K.B Linscott, X Zhao, X Wang, R Mair, S Schmink, K.E Arnold, D.S Stephens, L.H Harrison, R.A Hollick, A.L Andrade, J Lamaro-Cardoso, A.P.S de Lemos, J Gritzfeld, S Gordon, A Soysal, M Bakir, D Sharma, S Jain, S.W Satola, N.E Messonnier, and L.W Mayer (2011), “sodC-Based Real-Time PCR for Detection of Neisseria meningitidis”, PLoS One 6, e19361 [22] Edwards, U., A Muller, S Hammerschmidt, R Gerardy-Schahn, and M Frosch (1994), “Molecular analysis of the biosynthesis pathway of the alpha-2,8 polysialic acid capsule by Neisseria meningitidis serogroup B”, Molecular Microbiology 14, pp.141-149 [23] Falla, T J., D W Crook, L N Brophy, D Maskell, J S Kroll, and E R Moxon (1994), “PCR for capsular typing of Haemophilus influenzae” Journal of Clinical Microbiology 32, pp 2382-2386 62 [24] Frosch, M., U Edwards, K Bousset, B Krausse, and C Weisgerber (1991), “Evidence for a common molecular origin of the capsule gene loci in gram-negative bacteria expressing group II capsular polysaccharides”, Molecular Microbiology 5, pp 1251-1263 [25] Frosch, M., and A Muller (1993), “Phospholipid substitution of capsular polysaccharides and mechanisms of capsule formation in Neisseria meningitidis” Molecular Microbiology 8, pp 483-493 [26] Gagneux, S P., A Hodgson, T A Smith, T Wirth, I Ehrhard, G Morelli, B Genton, F N Binka, M Achtman, and G Pluschke (2002), “Prospective study of a serogroup X Neisseria meningitidis outbreak in northern Ghana”, Journal of Infectious Diseases 185, pp 618-626 [27] Ganguli, S., G Zapata, T Wallis, C Reid, G Boulnois, W F Vann, and I S Roberts (1994), “Molecular cloning and analysis of genes for sialic acid synthesis in Neisseria meningitidis group B and purification of the meningococcal CMPNeuNAc synthetase enzyme”, Journal of Bacteriology 176, pp 4583-4589 [28] Goldacre M J, Trevor Lambert, Julie Evans, Gill Turner “Preregistrantion house officers’ views on whether their experience at medical school prepared them well for their jobs: national questionnaise survey” BMJ Volume 326, pp 10111012 [29] Hammerschmidt, S., C Birkholz, U Zahringer, B D Robertson, J van Putten, O Ebeling, and M Frosch (1994), “Contribution of genes from the capsule gene complex 53(cps) to lipooligosaccharide biosynthesis and serum resistance in Neisseria meningitidis” Molecular Microbiology 11, pp 885-896 [30] Hammerschmidt, S., A Muller, H Sillmann, M Muhlenhoff, R Borrow, A Fox, J van Putten, W D Zollinger, R Gerardy-Schahn, and M Frosch ( 1996), “Capsule phase variation in Neisseria meningitidis serogroup B by slipped-strand mispairing in the polysialyltransferase gene (siaD): correlation with bacterial invasion and the outbreak of meningococcal disease”, Molecular Microbiology 20, pp 1211-1220 63 [31] Hongfei Zhu, Quan Wang, Liuqing Wen ,Jianguo Xu,Zhujun Shao, Min Chen, Mingliang Chen, Peter R Reeves ,Boyang Cao,và Lei Wang “Development of a Multiplex PCR Assay for Detection and Genogrouping of Neisseria meningitidis” J Clin Microbiol 2012 January; 50(1): 46–51.: 10.1128/JCM.00918-11PMCID: PMC3256684” [31] Janson, H., M Ruan, and A Forsgren (1993), “Limited diversity of the protein D gene (hpd) among encapsulated and nonencapsulated Haemophilus influenzae strains”, Infection and Immunity 61, pp 4546-4552 [32] Kroll, J S (1992), “The genetics of encapsulation in Haemophilus influenzae” Journal of Infectious Diseases 165 Suppl 1, pp 93-96 [33] Kroll, J S., B M Loynds, and E R Moxon (1991), “The Haemophilus influenzae capsulation gene cluster: a compound transposon”, Molecular Microbiology 5, pp 1549-1560 [34] Kroll, J S., and E R Moxon (1988), “Capsulation and gene copy number at the cap locus of Haemophilus influenzae type b”, Journal of Bacteriology 170, pp 859-864 [35] Kroll, J S., S Zamze, B Loynds, and E R Moxon (1989), “Common organization of chromosomal loci for production of different capsular polysaccharides in Haemophilus influenzae”, Journal of Bacteriology 171, pp 3343-3347 [36] LaClaire, L L., M L Tondella, D S Beall, C A Noble, P L Raghunathan, N E Rosenstein, and T Popovic (2003), “Identification of Haemophilus influenzae serotypesby standard slide agglutination serotyping and PCR-based capsule typing”, Journal of Clinical Microbiology 41, pp.393-396 [37] Lee, L G., C R Connell, and W Bloch (1993), “Allelic discrimination by nicktranslation PCR with fluorogenic probes”, Nucleic Acids Research 21, pp 3761-3766 [38] Liu, T Y., E C Gotschlich, E K Jonssen, and J R Wysocki (1971), “Studies on the meningococcal polysaccharides I Composition and chemical properties of the group A polysaccharide”, Journal of Biological Chemistry 246, pp 2849-2858 64 [39] Martin C.J Maiden and Mathias Frosch (2001), “Molecular Techniques for the Investigation of Meningococcal Disease Epidemiology”, Molecular Biotechnology, Volume 18, pp 119-134 [40] Masson, L., and B E Holbein (1983), “Physiology of sialic acid capsular polysaccharide synthesis in serogroup B Neisseria meningitidis”, Journal of Bacteriology 154, pp 728-736 [41N] Marcelo Reyes, Juan Pablo Torres, Valeria Prado, Roberto Vidal “Multiplex PCR assay in spinal fluid to identify simultaneously bacterial pathogens associated to acute bacterial meningitis in Chilean children”, Rev Méd Chile 2008; 136, pp 338346 [41] Messmer, T O., J S Sampson, A Stinson, B Wong, G M Carlone, and R R Facklam (2004), “Comparison of four polymerase chain reaction assays for specificity in the identification of Streptococcus pneumoniae”, Diagnostic Microbiology and Infectious Disease 49, pp 249-254 [42] Moore, C E., A Sengduangphachanh, T Thaojaikong, J Sirisouk, D Foster, R Phetsouvanh, L McGee, D W Crook, P N Newton, and S J Peacock (2010), “Enhanced determination of Streptococcus pneumoniae serotypes associated with invasive disease in Laos by using a real-time polymerase chain reaction serotyping assay with cerebrospinal fluid”, American Journal of Tropical Medicine and Hygiene 83, pp 451-457 [43] Mothershed, E A., C T Sacchi, A M Whitney, G A Barnett, G W Ajello, S Schmink, L W Mayer, M Phelan, T H Taylor, Jr., S A Bernhardt, N E Rosenstein, and T Popovic (2004), “Use of real-time PCR to resolve slide agglutination discrepancies in serogroup identification of Neisseria meningitidis” Journal of Clinical Microbiology 42, pp 320-328 [43] Muhamed-kheir TaHa “Simultaneous approach for nonculture PCR base indentification and serogroup prediction of N” meningitidis journal of clinical microbiology.Feb, 2000, pp 855-857 65 [44] Mullis, K B., and F A Faloona (1987), “Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction”, Methods In Enzymology 155, pp 335-350 [45] Murdoch, D R., T P Anderson, K A Beynon, A Chua, A M Fleming, R T Laing, G I Town, G D Mills, S T Chambers, and L C Jennings (2003), “Evaluation of a PCR assay for detection of Streptococcus pneumoniae in respiratory and nonrespiratory samples from adults with community-acquired pneumonia” Journal of Clinical Microbiology 41, pp 63-66 [46] Pai, R., R E Gertz, and B Beall (2006), “Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates”, Journal of Clinical Microbiology 44, pp 124-131 [47] Parkhill, J., M Achtman, K D James, S D Bentley, C Churcher, S R Klee, G Morelli, D Basham, D Brown, T Chillingworth, R M Davies, P Davis, K Devlin, T Feltwell, N Hamlin, S Holroyd, K Jagels, S Leather, S Moule, K Mungall, M A Quail, M A Rajandream, K M Rutherford, M Simmonds, J Skelton, S Whitehead, B G Spratt, and B G Barrell (2000), “Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491”, Nature 404, pp 502-506 [48] Robert K Selander, Dominique A Caugant, Howard Ochaman, James M Musser, Marion N Gilmour, and Thomas Whittam (1986), “Methods of Multilocus Enzyme Electrophoresis for Bacterial Population Genetics and Systematics”, Applied and Enviromental Microbiology, pp 873-884 [49] Resti, M., M Moriondo, M Cortimiglia, G Indolfi, C Canessa, L Becciolini, E Bartolini, F M de Benedictis, M de Martino, and C Azzari (2010), “Communityacquired bacteremic pneumococcal pneumonia in children: diagnosis and serotyping by real-time polymerase chain reaction using blood samples”, Clinical Infectious Diseases 51, pp 1042-1049 [50] Sadler, F., A Fox, K Neal, M Dawson, K Cartwright, and R Borrow ( 2003), “Genetic analysis of capsular status of meningococcal carrier isolates”, Epidemiology and Infection 130, pp 59-70 66 [51] Saiki, R K., S Scharf, F Faloona, K B Mullis, G T Horn, H A Erlich, and N Arnheim (1985), “Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia”, Science 230, pp 1350-1354 [52] Satola, S W., P L Schirmer, and M M Farley (2003), “Complete sequence of the cap locus of Haemophilus influenzae serotype b and nonencapsulated b capsulenegative variants”, Infection and Immunity 71, pp 3639-3644 [53] Satola, S W., P L Schirmer, and M M Farley (2003), “Genetic analysis of the capsule locus of Haemophilus influenzae serotype f”, Infection and Immunity 71, pp 7202-7207 [54] Song, X M., A Forsgren, and H Janson (1995), “The gene encoding protein D (hpd) is highly conserved among Haemophilus influenzae type b and nontypeable strains” 63, pp 696-699 [55] Steven M Pollard, Koichi Yoshikawa, Ian D Clarke, Davide Danovi, Stefan Strieker, Roslin Russell, Jane Bayani, Renee Head, Marco Lee, Mark Bernstein, Jeremy A Squire, Austin Smith, and Peter Dirks (2009), “Glioma Stem Cell Lines Expanded in Adherent Culture Have Tumor- Specific Phenotypes and Are Suiable for Chemical and Genetic Screens”, Cell stem cell 4, pp 568-580 [56] Stratagene (2006), “Introduction to Quantitative PCR: Methods and Application Guide” [57] Suzuki, N., M Yuyama, S Maeda, H Ogawa, K Mashiko, and Y Kiyoura (2006), “Genotypic identification of presumptive Streptococcus pneumoniae by PCR using four genes highly specific for S Pneumoniae”, Journal of Medical Microbiology 55, pp 709-714 [58] Swartley, J S., J H Ahn, L J Liu, C M Kahler, and D S Stephens (1996), “Expression of sialic acid and polysialic acid in serogroup B Neisseria meningitidis: divergent transcription of biosynthesis and transport operons through a common promoter region”, Journal of Bacteriology 178, pp 4052-4059 67 [59] Swartley, J S., L J Liu, Y K Miller, L E Martin, S Edupuganti, and D S Stephens (1998), “Characterization of the gene cassette required for biosynthesis of the (alpha1 >6)-linked N-acetyl-D-mannosamine-1-phosphate capsule of serogroup A Neisseria meningitidis”, Journal of Bacteriology 180, pp 1533-1539 55 [60] Swartley, J S., A A Marfin, S Edupuganti, L J Liu, P Cieslak, B A Perkins, J D Wenger, and D S Stephens (1997), “Capsule switching of Neisseria meningitidis”, Proceedings of the National Academy of Sciences of the United States of America 94, pp 271-276 [61] Swartley, J S., and D S Stephens (1994), “Identification of a genetic locus involved in the biosynthesis of N-acetyl-D-mannosamine, a precursor of the (alpha >8)-linked polysialic acid capsule of serogroup B Neisseria meningitidis”, Journal of Bacteriology 176, pp 1530-1534 [62].Taha, M.-K (2000), “Simultaneous approach for nonculture PCR-based identification and serogroup prediction of Neisseria meningitidis”, Journal of Clinical Microbiology 38, pp 855-857 [63] Taha, M K., J M Alonso, M Cafferkey, D A Caugant, S C Clarke, M A Diggle, A Fox, M Frosch, S J Gray, M Guiver, S Heuberger, J Kalmusova, K Kesanopoulos, A M Klem, P Kriz, J Marsh, P Mölling, K Murphy, P Olcén, O Sanou, G Tzanakaki, and U Vogel (2005), “Interlaboratory comparison of PCRbased identification and genogrouping of Neisseria meningitidis”, Journal of Clinical Microbiology 43, pp 144-149 [64] Tarrago, D., A Fenoll, D Sanchez-Tatay, L A Arroyo, C Munoz-Almagro, C Esteva, W P Hausdorff, J Casal, and I Obando (2008), “Identification of pneumococcal serotypes from culture-negative clinical specimens by novel realtime PCR”, Clinical Microbiology and Infection 14, pp 828-834 [65] Tettelin, H., N J Saunders, J Heidelberg, A C Jeffries, K E Nelson, J A Eisen, K A Ketchum, D W Hood, J F Peden, R J Dodson, W C Nelson, M L Gwinn, R DeBoy, J D Peterson, E K Hickey, D H Haft, S L Salzberg, O 68 White, R D Fleischmann, B A Dougherty, T Mason, A Ciecko, D S Parksey, E Blair, H Cittone, E B Clark, M D Cotton, T R Utterback, H Khouri, H Qin, J Vamathevan, J Gill, V Scarlato, V Masignani, M Pizza, G Grandi, L Sun, H O Smith, C M Fraser, E R Moxon, R Rappuoli, and J C Venter (2000), “Complete genome sequence of Neisseria meningitidis serogroup B strain MC58”, Science 287, pp 1809-1815 [66] Tzeng, Y.-L., C Noble, and D S Stephens (2003), “Genetic basis for biosynthesis of the (alpha >4)-linked N-acetyl-D-glucosamine 1-phosphate capsule of Neisseria meningitidis serogroup X”, Infection and Immunity 71, pp 6712-6720 [67] Tzeng, Y L., A K Datta, C A Strole, M A Lobritz, R W Carlson, and D S Stephens (2005), “Translocation and surface expression of lipidated serogroup B capsular Polysaccharide in Neisseria meningitidis”, Infection and Immunity 73, pp 1491-1505 [68] Vogel, U., H Claus, and M Frosch (2000), “Rapid serogroup switching in Neisseria meningitidis”, New England Journal of Medicine 342, pp 219-220 [69] Waggoner-Fountain, L A., J O Hendley, E J Cody, V A Perriello, and L G Donowitz (1995), “The emergence of Haemophilus influenzae types e and f as significant pathogens” 21, pp 1322-1324.56 [70] Wang, X., R Mair, C Hatcher, M J Theodore, K Edmond, H M Wu, B H Harcourt, G Carvalho Mda, F Pimenta, P Nymadawa, D Altantsetseg, M Kirsch, S W Satola, A Cohn, N E Messonnier, and L W Mayer (2011), “Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae”, International Journal of Medical Microbiology 301, pp 303-309 [71] Weber, M V., H Claus, M C Maiden, M Frosch, and U Vogel (2006), “Genetic mechanisms for loss of encapsulation in polysialyltransferase-genepositive meningococci isolated from healthy carriers”, International Journal of Medical Microbiology 296, pp 475-484 69 [72] Whatmore, A M., A Efstratiou, A P Pickerill, K Broughton, G Woodard, D Sturgeon, R George, and C G Dowson (2000), “Genetic relationships between clinical isolates of Streptococcus pneumoniae, Streptococcus oralis, and Streptococcus mitis: Characterization of “atypical” pneumococci and organisms allied to S mitis harboring S pneumoniae virulence factor-encoding genes”, Infection and Immu [73]Claus, H., M C Maiden, R Maag, M Frosch, and U Vogel (2002), “Many carried meningococci lack the genes required for capsule synthesis and transport”, Microbiology 148, pp 1813-1819 70 PHỤ LỤC (Trình tự Nucleotide vùng gene kết so sánh ngân hàng gene ) [1]Query 541 TTGGAAGATTTAGTTGCAAATCCGCGACAAAATATTTTGCTGCGTCGCGGTGATGTGGTT 600 Sbjct 583 TTGGAAGATTTGGTGGCCAATCCGCGGCAAAATATTTTGTTGCGCCGTGGTGATGTGGTG 642 Query 601 ACCATGATTACCAATCCCTATACCTTTACGTCTATGGGTGCGGTGGGGAGAACACAAGAA 660 Sbjct 643 ACGATGATTACCAATCCCTACACTTTTACGTCTATGGGTGCGGTGGGGAGAACACAAGAA 702 Query 661 ATCGGTTTTTCAGCCAGAGGCTTATCGCTTTCTGAAGCCATTGGCCGTATGGGCGGTTTG 720 Sbjct 703 ATCGGTTTTTCAGCCAGAGGCTTATCGCTTTCTGAAGCCATTGGCCGTATGGGCGGTTTG 762 Query 721 CAAGATCGCCGTTCTGATGCGCGTGGTGTGTTTGTGTTCCGCTATACGCCATTGGTGGAA 780 Sbjct 763 CAAGATCGCCGTTCTGATGCGCGTGGTGTGTTTGTGTTCCGTTACACGCCTTTGGTGGAA 822 Query 781 TTGCCGGCAGAACGTCAGGATAAATGGATTGCTCAAGGTTATGGCAGTGAGGCAGAGATT 840 Sbjct 823 TTGCCGGCAGAACGTCAGGATAAATGGATTGCGCAAGGCTATGGCAGTGAGGCGGAGATT 882 [2]Query 421 CCGCTGACGGCAGCCGGTGAGCGTGTGTTGGATGCGGTGGCTGCGGTAGGTGGTTCAACG 480 Sbjct 463 CCGCTGACGGCAGCCGGTGAGCGTGTGTTGGATGCGGTGGCTGCGGTAGGTGGTTCAACG 522 Query 481 GCAAATGTGCAGGATACGAATGTGCAGCTGACACGTGGCAATGTAGTACGAACTGTTGCC 540 Sbjct 523 GCAAATGTGCAGGATACCAATGTGCAGCTAACACGTGGCAATGTGGTGCGCACGGTGGCT 582 Query 541 TTGGAAGATTTAGTTGCAAATCCGCGACAAAATATTTTGCTGCGTCGCGGTGATGTGGTT 600 Sbjct 583 TTGGAAGATTTGGTGGCCAATCCGCGGCAAAATATTTTGTTGCGCCGTGGTGATGTGGTG 642 [3]Query 766 GATGCGGTGGCTGCGGTAGGTGGTTCAACGGCAAATGTGCAGGATACGAATGTGCAGCTG Sbjct 601 GATGCGGTGGCTGCGGTAGGTGGTTCAACGGCAAATGTGCAGGATACGAATGTGCAGCTG 825 660 Query 826 ACACGTGGCAATGTAGTACGAACTGTTGCCTTGGAAGATTTAGTTGCAAATCCGCGACAA 885 Sbjct 720 661 ACACGTGGCAATGTAGTACGAACTGTTGCCTTGGAAGATTTAGTTGCAAATCCGCGACAA Query 886 AATATTTTGCTGCGTCGCGGTGATGTGGTTACCATGATTACCAATCCCTATACCTTTACG 945 Sbjct 780 721 AATATTTTGCTGCGTCGCGGTGATGTGGTTACCATGATTACCAATCCCTATACCTTTACG Query 946 TCTATGGGTGCGGTGGGGAGAACACAAGAAATCGGTTTTTCAGCCAGAGGCTTATCGCTT 1005 Sbjct 840 781 TCTATGGGTGCGGTGGGGAGAACACAAGAAATCGGTTTTTCAGCCAGAGGCTTATCGCTT Query 1006 TCTGAAGCCATTGGCCGTATGGGCGGTTTGCAAGATCGCCGTTCTGATGCGCGTGGTGTG 1065 Sbjct 900 841 TCTGAAGCCATTGGCCGTATGGGCGGTTTGCAAGATCGCCGTTCTGATGCGCGTGGTGTG Query 1066 TTTGTGTTCCGCTATACGCCATTGGTGGAATTGCCGGCAGAACGTCAGGATAAATGGATT 1125 Sbjct 901 960 TTTGTGTTCCGCTATACGCCATTGGTGGAATTGCCGGCAGAACGTCAGGATAAATGGATT Query 1126 GCTCAAGGTTATGGCAGTGAGGCAGAGATTCCAACGGTATATCGTGTGAATATGGCTGAT 1185 Sbjct 961 1020 GCTCAAGGTTATGGCAGTGAGGCAGAGATTCCAACGGTATATCGTGTGAATATGGCTGAT [4]Query 661 AAAAATGGCGGTTTTGCCGGGAACTATGCCTTTAAATACGCGAAACACGCCAATGTGGGC 720 Sbjct 661 AAAAATGGCGGTTTTGCCGGGAACTATGCCTTTAAATACGCGAAACACGCCAATGTGGGC 720 Query 721 CGTGATGCTTTTGAGTTGTTCTTGCTCGGCAGCGGGAGTGATGAAGCCAAAGGTACCGAT 780 Sbjct 721 CGTGATGCTTTTGAGTTGTTCTTGCTCGGCAGCGGGAGTGATGAAGCCAAAGGTACCGAT 780 Query 781 CCCTTGAAAAACCATCAGGTACACCGCCTGACGGGCGGCTATGAGGAAGGCGGCTTGAAT 840 Sbjct 781 CCCTTGAAAAACCATCAGGTACACCGCCTGACGGGCGGCTATGAGGAAGGCGGCTTGAAT 840 Query 841 CTCGCCTTGGCGGCTCAGTTGGATTTGTCTGAAAATGGCGACAAAACCAAAAACAGTACG 900 71 [5]Query 497 CTGCTGGCGCCGCTGGCAACAAAATTCAACGAACGCTATCCGCATATCCGACTTTCGCTC 556 Sbjct 1930503CTGCTGGCGCCGCTGGCAACAAAATTCAACGAACGCTATCCGCATATCCGACTTTCGCTC 1930444 Query 557 616 GTTTCTTCCGAAGGCTATATCAATCTGATTGAACGCAAAGTCGATATTGCCTTACGGGCC Sbjct 1930443GTTTCTTCCGAAGGCTATATCAATCTGATTGAACGCAAAGTCGATATTGCCTTACGGGCC 1930384 Query 617 676 GGAGAATTGGACGATTCCGGGCTGCGTGCACGCCATCTGTTTGACAGCCGCTTCCGCGTA Sbjct 1930383 GGAGAATTGGACGATTCCGGGCTGCGTGCACGCCATCTGTTTGACAGCCGCTTCCGCGTA 1930324 Sbjct 1930323 ATCGCCAGTCCTGAATACCTGGCAAAACACGGCACGCCGCAATCTACAGAAGAGCTTGCC 1930264 [6]Query 1427411 TGCAAAACAACATGGTTACCCATGGCAAGATGATGCACACTTAGGTGATTTACCTGCATT Sbjct 904201 TGCAAAACAACATGGTTACCCATGGCAAGATGATGCACACTTAGGTGATTTACCTGCATT 1427470 904142 Query 1427471 AACTGTATTGCATGATGGCACAGCAACAAATCCTGTTTTAGCACCACGTCTTAAACATTT 1427530 Sbjct 904141 AACTGTATTGCATGATGGCACAGCAACAAATCCTGTTTTAGCACCACGTCTTAAACATTT 904082 Query 1427531 AGATGATGTTCGCGGTCACTCTATTATGATCCACACGGGTGGTGATAATCACTCCGATCA 1427590 Sbjct 904081 AGATGATGTTCGCGGTCACTCTATTATGATCCACACGGGTGGTGATAATCACTCCGATCA 904022 [7]Query 76681 tttttttAGCATATTCAGGAAAGGGGACATGCAATATGTCAAAATGATCTATATATCCTT 76740 Sbjct 76681 TTTTTTTAGCATATTCAGGAAAGGGGACATGCAATATGTCAAAATGATCTATATATCCTT 76740 Query 76741 TAATATTAAGATTATTTCCAATCAAATAACGTTCTAATTTTGTTGGATGATATGAAAATG 76800 Sbjct 76741 TAATATTAAGATTATTTCCAATCAAATAACGTTCTAATTTTGTTGGATGATATGAAAATG 76800 Query 76801 ATTCTAATAAAGGAGCATATGTTCCAGTCCCTTCATCAATTAAATGAGTCGTAATATTCt 76860 Sbjct 76801 ATTCTAATAAAGGAGCATATGTTCCAGTCCCTTCATCAATTAAATGAGTCGTAATATTCT 76860 Query 76861 ttttttttGCAATACTAATCAGATAGGAGTAGTGGCCTGTAAAAGACAGCATATAGAGAT 76920 Sbjct 76861 TTTTTTTTGCAATACTAATCAGATAGGAGTAGTGGCCTGTAAAAGACAGCATATAGAGAT 76920 Query 76921 GAGCAGGCTGTATAATATTAAGGAtttttttGTAACTTCTATAAATATAAAGTAATTTTT 76980 Sbjct 76921 GAGCAGGCTGTATAATATTAAGGATTTTTTTGTAACTTCTATAAATATAAAGTAATTTTT 76980 Query 76981 TAGGAGTTATATTATTAGGGCTTCTAGGAAGCTCAAATAGATAAATAGATTCAAATAGAT 77040 Sbjct 76981 TAGGAGTTATATTATTAGGGCTTCTAGGAAGCTCAAATAGATAAATAGATTCAAATAGAT 77040 Query 77041 TCTTGTTAGCTGATTGATGAACTAACTTAGGCATTTTTAAGTTTTTAGAAGTATATAAAA 77100 Sbjct 77041 TCTTGTTAGCTGATTGATGAACTAACTTAGGCATTTTTAAGTTTTTAGAAGTATATAAAA 77100 Query 77101 TTACTAGTAAATTATTGGTTAATTTTTGTATTTTAATTAGGCTTTGGACTTGGTTAAGCT 77160 Sbjct 77101 TTACTAGTAAATTATTGGTTAATTTTTGTATTTTAATTAGGCTTTGGACTTGGTTAAGCT 77160 Sbjct 77161 GACCTAAATTAGATATGACAAATAAATTGTTACGTGGGGGGGTAAGATAAAATGGAGATG 77220 Query 7221 TTGTCAACCACATTGAATCTTGAAAAAACTTTTTAGGCTGAAAAAGAGCtttttttATTT 77280 Sbjct 77221 TTGTCAACCACATTGAATCTTGAAAAAACTTTTTAGGCTGAAAAAGAGCTTTTTTTATTT 77280 72 ...ĐẠI HỌC QUỐC GIA HÀ NỘI TRƢỜNG ĐẠI HỌC KHOA HỌC TỰ NHIÊN - VŨ THỊ XUÂN THU NGHÊN CỨU ĐẶC ĐIỂM SINH HỌC VÀ TÍNH KHÁNG KHÁNG SINH CỦA Neisseria meningitidis TẠI CÁC Ổ DỊCH LƢU HÀNH TRONG. .. cứu: “ Nghiên cứu đặc điểm sinh học tính kháng kháng sinh Neisseria meningitidis ổ dịch lưu hành quân đội Với mục tiêu: Xác định đặc điểm sinh học cấu nhóm huyết Neisseria meningitidis phân lập... KẾT QUẢ NGHIÊN CỨU VÀ BÀN LUẬN 35 3.1 Đặc điểm sinh học cấu nhóm huyết Neisseria meningitidis phân lập số đơn vị tân binh quân đội 35 3.1.1 Đặc điểm sinh học chủng Neisseria meningitidis

Ngày đăng: 17/04/2021, 17:08

Nguồn tham khảo

Tài liệu tham khảo Loại Chi tiết
[1].Achtman M. (1995), "Epidemic spread and antigenic variability of Neisseria meningitidis", Trends in Microbiology. 3 (5), pp. 186-192 Sách, tạp chí
Tiêu đề: Epidemic spread and antigenic variability of Neisseria meningitidis
Tác giả: Achtman M
Năm: 1995
[4]. Borel, T., A. M. Rose, M. Guillerm, F. Sidikou, S. Gerstl, A. Djibo, N. Nathan, S. Chanteau, and P. J. Guerin (2006), “High sensitivity and specificity of the Pastorex latex agglutination test for Neisseria meningitidis serogroup A during a clinical trial in Niger”, Transactions of the Royal Society of Tropical Medicine and Hygiene 100, pp. 964-969 Sách, tạp chí
Tiêu đề: High sensitivity and specificity of the Pastorex latex agglutination test for Neisseria meningitidis serogroup A during a clinical trial in Niger”, "Transactions of the Royal Society of Tropical Medicine and "Hygiene
Tác giả: Borel, T., A. M. Rose, M. Guillerm, F. Sidikou, S. Gerstl, A. Djibo, N. Nathan, S. Chanteau, and P. J. Guerin
Năm: 2006
[5]. Borrow, R., H. Claus, U. Chaudhry, M. Guiver, E. B. Kaczmarski, M. Frosch, and A. J. Fox (1998), “siaD PCR ELISA for confirmation and identification of serogroup Y and W135 meningococcal infections”, FEMS Microbiology Letters 159, pp. 209-214 Sách, tạp chí
Tiêu đề: siaD PCR ELISA for confirmation and identification of serogroup Y and W135 meningococcal infections”, "FEMS Microbiology Letters
Tác giả: Borrow, R., H. Claus, U. Chaudhry, M. Guiver, E. B. Kaczmarski, M. Frosch, and A. J. Fox
Năm: 1998
[7]. Broome CV ( 1986 ),“ The carrier state : Neisseria meningitidis” , J Antimicrob Chemother 18 (Suppl. A), pp. 25 – 34 Sách, tạp chí
Tiêu đề: ),“"The carrier state: Neisseria meningitidis” ", J Antimicrob "Chemother "18 (Suppl. A), pp.25"–
[8]. Bundle, D. R., H. J. Jennings, and C. P. Kenney (1974), “Studies on the group- specific polysaccharide of Neisseria meningitidis serogroup X and an improved procedure for its isolation”, Journal of Biological Chemistry 249, pp. 4797-4801 Sách, tạp chí
Tiêu đề: Studies on the group-specific polysaccharide of Neisseria meningitidis serogroup X and an improved procedure for its isolation”, "Journal of Biological Chemistry
Tác giả: Bundle, D. R., H. J. Jennings, and C. P. Kenney
Năm: 1974
[9]. Bustin, S. A (2004), “The PCR Revolution. Basic technologies and Applications”, Cambridge University Press Sách, tạp chí
Tiêu đề: The PCR Revolution. Basic technologies and Applications”
Tác giả: Bustin, S. A
Năm: 2004
[10]. Caugant DA , Hứiby EA , Magnus P , Scheel O , Hoel T , Bjune G , Wedege E , Eng J & Frứholm LO ( 1994 ), “ Asymptomatic carriage of Neisseria meningitidis in a randomly sampled population” . J Clin Microbiol 32 , pp. 323 – 330 Sách, tạp chí
Tiêu đề: ), “"Asymptomatic carriage of "Neisseria meningitidis" in a randomly sampled population”. "J Clin Microbiol"32, pp. "323"–
[11]. Cartwright K ( 1995), “ Meningococcal carriage and disease . Meningococcal Disease ” ( CartwrightK , ed), pp. 115 – 146 Sách, tạp chí
Tiêu đề: “"Meningococcal carriage and disease. Meningococcal Disease"” ("CartwrightK", ed), "pp. 115"–
[13]. Cedric Mims (1996), “The Pathogenesis of the Acute Exanthemst”. Review in Medical Virology. Vol 6, pp. 1-8 Sách, tạp chí
Tiêu đề: The Patho"gene"sis of the Acute Exanthemst”. "Review "in Medical Virology
Tác giả: Cedric Mims
Năm: 1996
[15]. Claus, H., R. Borrow, M. Achtman, G. Morelli, C. Kantelberg, E. Longworth, M. Frosch, and U. Vogel (2004), “Genetics of capsule O-acetylation in serogroup C, W-135, and Y meningococci”, Molecular Microbiology 51, pp. 227-239 Sách, tạp chí
Tiêu đề: Gene"tics of capsule O-acetylation in serogroup C, W-135, and Y meningococci”, "Molecular Microbiology
Tác giả: Claus, H., R. Borrow, M. Achtman, G. Morelli, C. Kantelberg, E. Longworth, M. Frosch, and U. Vogel
Năm: 2004
[16]. Claus, H., M. C. Maiden, R. Maag, M. Frosch, and U. Vogel (2002), “Many carried meningococci lack the genes required for capsule synthesis and transport”, Microbiology 148, pp. 1813-1819 Sách, tạp chí
Tiêu đề: Many carried meningococci lack the "gene"s required for capsule synthesis and transport”, "Microbiology
Tác giả: Claus, H., M. C. Maiden, R. Maag, M. Frosch, and U. Vogel
Năm: 2002
[17]. Claus, H., U. Vogel, M. Muhlenhoff, R. Gerardy-Schahn, and M. Frosch (1997), “Molecular divergence of the sia locus in different serogroups of Neisseria meningitidisexpressing polysialic acid capsules”, Molecular and General Genetics 257, pp. 28-34 Sách, tạp chí
Tiêu đề: Molecular divergence of the sia locus in different serogroups of Neisseria meningitidisexpressing polysialic acid capsules”, "Molecular and General Genetics
Tác giả: Claus, H., U. Vogel, M. Muhlenhoff, R. Gerardy-Schahn, and M. Frosch
Năm: 1997
[19]. Csako, G. (2006) “Present and future of rapid and/or high-throughput methods for nucleic acid testing”, Clinica Chimica Acta 363, pp. 6-31 Sách, tạp chí
Tiêu đề: Present and future of rapid and/or high-throughput methods for nucleic acid testing”, "Clinica Chimica Acta
[24]. Frosch, M., U. Edwards, K. Bousset, B. Krausse, and C. Weisgerber (1991), “Evidence for a common molecular origin of the capsule gene loci in gram-negative bacteria expressing group II capsular polysaccharides”, Molecular Microbiology 5, pp. 1251-1263 Sách, tạp chí
Tiêu đề: Evidence for a common molecular origin of the capsule "gene" loci in gram-negative bacteria expressing group II capsular polysaccharides”, "Molecular Microbiology
Tác giả: Frosch, M., U. Edwards, K. Bousset, B. Krausse, and C. Weisgerber
Năm: 1991
[25]. Frosch, M., and A. Muller (1993), “Phospholipid substitution of capsular polysaccharides and mechanisms of capsule formation in Neisseria meningitidis”.Molecular Microbiology 8, pp. 483-493 Sách, tạp chí
Tiêu đề: Phospholipid substitution of capsular polysaccharides and mechanisms of capsule formation in Neisseria meningitidis”. "Molecular Microbiology
Tác giả: Frosch, M., and A. Muller
Năm: 1993
[28]. Goldacre M J, Trevor Lambert, Julie Evans, Gill Turner. “Preregistrantion house officers’ views on whether their experience at medical school prepared them well for their jobs: national questionnaise survey”. BMJ Volume 326, pp. 1011- 1012 Sách, tạp chí
Tiêu đề: Preregistrantion house officers’ views on whether their experience at medical school prepared them well for their jobs: national questionnaise survey”. "BMJ Volume
[29]. Hammerschmidt, S., C. Birkholz, U. Zahringer, B. D. Robertson, J. van Putten, O. Ebeling, and M. Frosch (1994), “Contribution of genes from the capsule gene complex 53(cps) to lipooligosaccharide biosynthesis and serum resistance in Neisseria meningitidis”. Molecular Microbiology 11, pp. 885-896 Sách, tạp chí
Tiêu đề: Contribution of "gene"s from the capsule "gene" complex 53(cps) to lipooligosaccharide biosynthesis and serum resistance in Neisseria meningitidis”. "Molecular Microbiology
Tác giả: Hammerschmidt, S., C. Birkholz, U. Zahringer, B. D. Robertson, J. van Putten, O. Ebeling, and M. Frosch
Năm: 1994
[31]. Hongfei Zhu, Quan Wang, Liuqing Wen ,Jianguo Xu,Zhujun Shao, Min Chen, Mingliang Chen, Peter R. Reeves ,Boyang Cao,và Lei Wang “Development of a Multiplex PCR Assay for Detection and Genogrouping of Neisseria meningitidis” J Clin Microbiol. 2012 January; 50(1): 46–51.: 10.1128/JCM.00918-11PMCID:PMC3256684” Sách, tạp chí
Tiêu đề: “Development of a "Multiplex PCR Assay for Detection and Genogrouping of Neisseria meningitidis” J Clin "Microbiol. 2012 January; 50(1): 46–51.: 10.1128/JCM.00918-11PMCID: "PMC3256684
[31]. Janson, H., M. Ruan, and A. Forsgren (1993), “Limited diversity of the protein D gene (hpd) among encapsulated and nonencapsulated Haemophilus influenzae strains”, Infection and Immunity 61, pp. 4546-4552 Sách, tạp chí
Tiêu đề: Limited diversity of the protein D "gene" (hpd) among encapsulated and nonencapsulated Haemophilus influenzae strains”, "Infection and Immunity
Tác giả: Janson, H., M. Ruan, and A. Forsgren
Năm: 1993
[32]. Kroll, J. S. (1992), “The genetics of encapsulation in Haemophilus influenzae”. Journal of Infectious Diseases 165 Suppl 1, pp. 93-96 Sách, tạp chí
Tiêu đề: The "gene"tics of encapsulation in Haemophilus influenzae”. "Journal of Infectious Diseases
Tác giả: Kroll, J. S
Năm: 1992

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

w