Nghiên cứu đặc điểm di truyền và tính kháng thuốc của Vibrio cholerae phân lập tại tỉnh Trà Vinh

MINISTRY OF EDUCATION CAN THO UNIVERSITY NGUYEN THI ĐAU STUDY ON GENETIC CHARACTERISTICS AND ANTIBIOTIC RESISTANCE OF VIBRIO CHOLERAE ISOLATES IN TRA VINH SUMMARY OF DOCTORATE THESIS MICROBIOLOGY CODE: 62 42 01 07 CAN THO, 2015 Thesis was completed at CanTho University Instructor: Assoc Prof Dr Ho Thi Viet Thu The Doctoral thesis was defended at the Can Tho University Time:…………………Date:………………… This thesis can be found at: National Library of Vietnam Learning Resource Centre of Can Tho University Chapter 1: INTRODUCTION 1.1 Imperative of the Subject Vibrio cholerae is a Gram-negative bacteria, the agent of cholera in humans, causing acute diarrhea and dehydration, diseases occur with other forms of local epidemic and the pandemic The world through seven cholera pandemics, from 1816 to 1923, there were pandemic occurred, these pandemics started from India caused by V cholerae O1, the classical biotype The 7th pandemic was different from the previous one, it caused by V cholerae El Tor, and was derived from the Indonesian island of Celebes in 1961 This was the longes pandemic and it had a greater of influence than the previous pandemic Until now, many countries notify the cholera outbreak caused by this case (Hayes, 2005) The Mekong Delta, up to 19/08/2010, has localities include Ben Tre, Tien Giang, Can Tho city and An Giang appear in patients with diarrhea caused by V cholerae (Nguyen Hoang Vu, 2011) Tra Vinh Province geography with numerous potential risks of cholera due to shoreline stretching for 65 km and in the province of Tra Vinh has major river systems with a total length of 578 km, including large rivers: the Hau, Co Chien and Mang Thit river, so it's easy for the circulation of Vibrio cholerae from Chien river adjacent to Ben Tre province, where the disease has occurred in 2010 Many of antibiotics used to treat cholera are resistant to bacteria, including V cholerae This is a concern for public health Chromosome is proven the genetic factors of antibiotic resistance genes in bacteria The acquisition and transmission of antibiotic resistance genes is due to genetic factors, such as plasmids, integrons and transposons (Ghosh et al., 2011) One of the genetic factors is integrated in the chromosome and transmit antibiotic resistance genes between species in the environment (Burrus et al., 2004) Therefore "The study of genetic characteristics and drug resistance of V cholerae isolates in Tra Vinh", helping medical deparments with strategically proper use of antibiotics to reduce the mortality rate, reducing the cost of treatment 1.2 Objective: Determine the infection rates and serotype of V cholerae on the isolated sample; determine the antibiotic characteristics and types of antibiotic resistance gene; assess the genetic relationships between the isolates strains and announced strains and immune response on rabbits with the current vaccine 1.3 The significance of Thesis: Identification of antibiotic susceptible to Vibrio cholerae to help Medical departments choosing the effective Cholera antibiotic treatment in humans The thesis result is the scientific basis for the selection of mutated bacteria to produce cholera vaccine in humans; provide information to help warn of pathogenicity of Vibrio spp in water, seafood in Tra Vinh province 1.4 New point of thesis As the first projects in Mekong Delta isolated strains of V cholerae from seafood, river and shrimp ponds; identify the type of V cholerae serotype: Ogawa and Inaba; identify the similarities in nucleotide sequences of isolatied V cholerae strains with the nucleotide sequences of the V cholerae strains in the other Southeast Asia countries ; indentify the tetracycline resistance gene of isolates V cholerae strains The layout The thesis consists of 108 pages (excluding annexes), divided into the following sections: Chapter 1: Introduction (4 pages); Chapter 2: Overview document (42 pages); Chapter 3: The contents, means and methods of study (18 pages); Chapter 4: Results and discussion (43 pages); Chapter 5: Conclusions and suggested (1 pages); Reference (page 16) The thesis has 35 tables, 40 Figure Total reference is 180, including 09 Vietnamese, 171 English and 11 references from the Web Chapter 2: OVERVIEW 2.1 History of cholera In 1816, the disease appeared in Europe and the US, in the early 20th century, there were pandemic cholera in the world In the 60s, range of pathogens of cholera have been zoned and until recent years, the disease mostly occurs in Southeast Asia 1961, El Tor biotype caused pandemic in Philippines and begin the 7th pandemic From then, this bacteria continue to cause pandemic in Asia, the Middle East, Africa and parts of Europe (Colwell, 2004) Since 1991, the ratio of cholera caused by V cholerae O1 have occurred in Latin America (Levine, 1991; Ries et al., 1992), by 1992 the disease appeared and spreaded quickly by V cholerae O139 in South East Asia (Shimada et al., 1993) and recently outbreak in Africa, due to non-O1 serotype, non-O139, which was also an important cause of diarrhea (Sharma et al., 1998) The study of molecular evolution V cholerae O1 from 19911995 in Peru, India, and Thailand showed that V cholerae O1 has undergone genetic changes at a relatively high level These changes are important in understanding the epidemiology and evolution of V cholerae (Dalsgaard et al., 1999) In 12/1992 a large pandemic happened, the bacteria were identified as V cholerae O139 Bengal Genetically, O139 Bengal formed from biotype El Tor but their antigenic structure also changed People of all ages (even in the pandemic area ) can be infected, V cholerae O139 has caused disease in at least 11 countries in Southeast Asia to 2005 (Garg et al., 2003 ) In Vietnam, cholera is one of the main reasons causing diarrhea since the 1850s In 1885, a cholera outbreak occurred and from 1910-1930, cholera was reported annually (Nguyen, 1962) In 1964, V cholerae O1 El Tor biotype caused disease in the South of Vietnam Historically, the majority of cholera pandemic appeared in the coastal areas of central and Southern Vietnam V cholerae O1 El Tor biotype rarely seen in North Vietnam In 1976, the disease has occurred in the city of Hai Phong and Quang Ninh (Dalsgaard et al., 1999) From 2007 to 2008 and 2010, V cholerae O139 isolated from water, named V cholerae O139 Despite the rapid spread of O139 in the Southeast Asian region but in Vietnam, there is very little information about cholera caused by O139 (Dong Tu Nguyen, 2012) 2.2 Classification - Characteristics of Vibrio cholerae 2.2.1 Classification V cholerae V cholerae is a Gram-negative bacterium that causes cholera in humans, genus Vibrio and Gammaproteobacteria class V cholerae has two main biotype, the classical and biotype El Tor, and a group of other serotypes V cholerae is classified based on O antigen in the body and the serum group, so far it has been reported that at least 200 serogroups (Kaper et al., 1995) Before 1992, the serogroup O1 was the only cause pandemics From 1992, serogroup O139 caused outbreak pandemic in India and Bangladesh Currently, these serogroup causes cholera circulation and epidemic; the other V cholerae serogroup does not cause the epidemic are pooled into groups of V cholerae non-O1 and non-O139 V cholerae O1 is also divided into three serotypes, Ogawa, Inaba and Hikojima; these serotypes are divided into types of antigens: A, B and C 2.2.2 Characteristics of Vibrio cholerae V cholerae bacterium, also called V cholerae or cholera, 1μm to 3μm and 0.5 μm to 0.8μm width They have flagellum at one end to help them move very fast wobbly spirals The cholera bacterium has two major antigens: H antigen (flagellar) and O antigens from the bacteria body (somatic O antigen) Figure 2.1: V cholerae structure (Korinfo, 2000) 2.2.3 Genetic Characterization of virulence of Vibrio cholerae The presence of TCP and cholera toxin is controlled by genetic factors include toxR, Issuer, tcpP, and toxT All these factors combined into this virulence characteristic of V cholerae, this characteristics related to mobility, the ability to locate the intestine, and toxin production When V cholerae was found in the stool of patients, show that the genetic copy of V cholerae is highly toxic and very contagious The evolution of pathogens V cholerae has important stages: firstly, the V cholerae strains receive phage TCP and turn into V cholerae TCP+ After becoming TCP +, which means fringed bacteria,these serve as receptors for phage CTXΦ to get into bacterial, and attach its DNA into the chromosome of V cholerae phage (lysogenic) The nature of these CTX and TCP gene are bacteriophage from outside attached to the chromosome of V cholerae V cholerae is actually "gentle" bacteria but when they are infected by bacteriophage, they become toxins and cause disease V cholerae strains become toxins (toxicogenic V cholerae) and cause disease when they have pili help bacteria stick to the intestinal mucosa Figure 2.2: The formation of toxins V cholerae (Blake, 1994) 2.2.4 The virulence factors V cholerae uses two virulence factors, virulence of pili/rod (TCP) and cholera toxin CTX TCP, encode of pathogenic factor, a protein from pilus (Kirn et al., 2000), TCP is also essential for the formation of V cholerae colonies located in the small intestine of newborn rats (Taylor et al., 1987) and human (Herrington et al., 1988) When the formation of colonies in the small intestine success, V cholerae secretes toxins that cause cholera The toxin stimulates the intestine epithelial cells secrete fluid inside the small intestine, from which cause diarrheal dehydration Therefore, mutations in flagella of some strains of V cholerae will affect virulence factors TCP, Figure below show the variation of a flagella r a Long-Flagella b Non-Flagella c Short-Flagella a Wild strains; b Mutant Bacteria; c Mutant Bacteria Figure 2.3: The Flagella -mutant bacteria (Ewen, 2008) Bacteria with mutant-gene will lead to defects in flagellar Through this Figure, for wild species Figure (2.3a), not carry the mutant-gene so the length of flagellum is easily seen through electron microscope; picture Figure (2.3b) bacteria carry mutant-gene flgT not formed flagellum; Figure (2.3c) short-flagella bacteria caused by mutant-gene flagella fliA Chapter 3: CONTENTS, MEANS AND METHODS of RESEARCH 3.1 Content of research Isolation, identification Vibrio spp on the samples in Tra Vinh province; evaluate the serotype of the isolated V cholerae bacteria; analyze the nucleotide sequence of V cholerae according to the 16S rDNA gene; determine antibiotic resistance genes V cholerae isolated; experiment the isolated V cholerae strains in rabbits to evaluate the mutation of V cholerae and the immune response ability to the current vaccine The study period from January 10/2012 - 4/2014 at the College of Agriculture and Applied Biology Can Tho University; Hospital Central Can Tho; Research and Development Institute for Biotechnology Can Tho University; School of Agriculture - Aquaculture Tra Vinh University; samples sequenced at Macgrogen Korean company 3.2 Means and methods of research 3.2.1 Means of research 3.2.1.1 Chemical, bacterial culture medium Distilled water, saline (0.9% NaCl), reagent Kowacs, alcohol 960, 700, alkaline saline peptone water (ASPW) with concentrations from 0-10%; Cary- Blair (India); TCBS: thiosulfate-citrate-Thach Bile-salt-sucrose (Merck); SNA: Saline Nutrient Agar (Merck); MHA: Muller Hinton Agar, antibiotic discs (Nam Khoa., HCMC) Biochemical test: oxidase, ONPG, TSI agar (triple sugar iron agar Saline), ADH (Arginine Dihydrolase), Tryptophan saline; IDS 14GNR, Nam Khoa, HCMC) disk type antibiotic: streptomycin (10μg), norfloxacin (10μg), ampicillin (10μg), tetracycline (30μg), azithromycin (30μg), amoxicillin-clavulanic acid (30μg), trimethoprim-sulfamethoxazole (25μg) and vancomycin (30μg) 3.2.1.2 Chemical and biological for PCR Identifying bacteria based on 16S rRNA gene segments Table 3.1: Nucleotide sequences of primers for PCR-based 16S rDNA gene Nucleotide sequences of primers (5'3') Primers Length (bp) forward primer // reverse primer 27F AGAGTTTGATCCTGGCTC’ 1492R TACGGTTACCTTGTTACGACT ctxA-F CTCAGACGGGATTTGTTAGGCACG TCTATCTCTGTAGCCCCTATTACG ctxA-R O139rfb-F AGCCTCTTTATTACGGGTGG O139rfb-R GTCAAACCCGATCGTAAAGG 1500 302 449 (1) Weisburg et al., (1991); (2)-(3): Alam et al., (2006) Determination of antibiotic resistance genes Reagents for DNA extraction: Tris-HCl, EDTA, H20; chemical PCR Buffer, MgCl2, dNTPS, DMSO, Taq polymerase and primers determine antibiotic resistance genes Table 3.2: Nucleotide sequences of primers in PCR determine antibiotic resistance genes Antibiotic group β-Lactam Aminoglycosid Tested Gene blaSHV aac(3)IV Tetracycline tetA Trimethoprim dhfrI Nucleotide sequences of primers (5'3') Length (bp) forward primer // reverse primer TCGCCTGTGTATTATCTCCC CGCAGATAAATCACCACAATG GTGTGCTGCTGGTCCACAGC AGTTGACCCAGGGCTGTCGC GTGAAACCC AACATACCCC GAAGGCAAGCAGGATGTAG AAGAATGGAGTTATCGGGAATG GGGTAAAAACTGGCCTAAAATTG 768 286 888 931 (Maynard et al., 2005) 3.2.1.3 Materials Research 160 clam samples collected from Duyen Hai, Cau Ngang district; 100 pig blood samples collected from the slaughterhouse in Tra Vinh City, Chau Thanh, Duyen Hai, Cau Ngang and Cang Long District; 40 stool samples from patients with diarrhea in hospital of Tra Vinh Province; 150 water samples collected from rivers, the sea and the shrimp farming; 50 shrimp samples collected from Duyen Hai districts All samples were stored in cold storage tanks and transferred to the laboratory for isolation Oral cholera vaccine (mORCVAX) prepared from the strain of cholera bacteria including biotype Classical and El Tor biotype and strain of V cholerae O139 (Company Limited Vaccine and Biologicals No 1, Hanoi); 24 New Zealand white rabbits, weight 2-2,5kg 3.2.1.4 Equipment Drying cabinet, incubator, refrigerator, autoclave, shaker, sterile chamber and a microscope, electronic scales, test tubes, petri dishes, bottles, cylinder, nozzle, slide, pinch, pull, swab wealth repellent, gloves, alcohol lamps, plastic bags 3.2.2 Research Methods 3.2.2.1 Methods of isolation, identification of bacteria * Sampling method Clam samples: Clam collected at the markets of Cau Ngang and Duyen Hai District, fresh clams (25gram/piece), cleaned, cut meat (1g), enrichment in ml of ASPW Pig blood samples: Obtained from the slaughterhouse of Tra Vinh City and the districts of Chau Thanh Duyen Hai, Cau Ngang and Cang Long 25 ml blood/ times each facility with 0,5 % salt water, the sample is transferred to the laboratory, then suck 1ml in 9ml ASPW Water samples: Collected on the surface water of shrimp ponds, river, sea (25 ml each), then take 1ml water in 9ml ASPW Shrimp samples: Collected from Duyen Hai districts, fresh shrimp (150gram / piece), cleaned and took the head, gram sample of finely cut, extract fluid in ml ASPW Stool samples of diarrhea patients: Sterilize swab with sample of patient's diarrhea stool preserved in Carry-Blair transporting, and transferred to the laboratory for isolation * Method Samples were cumulative culture twice in the ASPW 1ml in 9ml ASPW incubated at 37 0C from 6-8 hours Then take ml above into ml ASPW for 2nd incubated at 41,5 0C from 16-18 hours; after isolated in TCBS at 37 0C /24 hours: colonies may have yellow/green colour 3.2.2.3 Determine antibiotic resistance of bacteria V cholerae a Determination of antibiotic resistance by Kirby Bauer method * Select 08 antibiotic used to treat intestinal diseases, especially cholera After incubation for 18 to 24 hours, measure the diameter of the zone of inhibition, including the diameter of the disk and read the results of antibiotics based on standard tables the antibiotic susceptibility of enteric bacteria (CLSI, 2010) b Determine antibiotic resistance of V cholerae by PCR (Polymerase Chain Reaction) After DNA extraction, continued to identify antibiotic resistance genes by PCR with primers sequences corresponding to the antibiotic resistance genes include blaSHV, aac (3)-IV, tetA and dhfrI PCR products were analyzed on agarose gel 1.5% in TBE 1X buffer at 100V for 90 minutes and taken with camera Biorad gel UV 2000 Standard 100bp (company Fermentas) 3.2.2.4 Sequence analysis of antibiotic resistance genes and establish phylogenetic tree The PCR product (DNA) determine antibiotic resistance genes, then sequenced in the company Macrogen Inc The sequences were analyzed, read by software Bio.Edit, compared with nucleotide sequences homologous on GenBank and establish genetic tree 3.2.2.5 Experiment of V cholerae strains isolated and the immune response in rabbits against cholera vaccine Experiment method * Virulence and immune response experiment : 12 experimental rabbits given a dose of 1.5 ml cholera vaccine / rabbit, repeated on day 14th Surgery after 28 days of oral vaccines, 12 rabbits without vaccine but the same feeding Inject the isolated bacteria (N8, O3.2, O1.2, Ng3, 85V1 81V1) to the intestines of rabbits of un-vaccine rabbit and the same to oral-vaccine rabbit, then surgery to determine the immune response of these above experimen Rabbits are anesthetized for surgery, the small intestine is tied into sections, each section 10 cm, cm apart Use 1ml bacteria needle (containing 1x 105-5 x 107 CFU) on segments intestine, peritoneal cavity closed, check the fluid at the time of 3, 6, 9, and 16 hours after injection 10 The targets : (i) Fluid accumulation (FA): Fluid accumulation in the intestine segments are determined by the amount of fluid (ml) / length of the intestines of rabbits (cm) (ii) The adhesion of bacteria to the intestinal surface : Cut segments intestine, shaved the intestinal mucosa or fluid in the intestine, then diluted liquid into decimal (log 10) Results are calculated by the formula: Mi (CFU/ ml) = Ai x D1 / v (Mi: the number of bacteria in the initial solution; Who: The average number of colonies / plate; D1: dilution; v: suspension volume/disk) Prepare the dilution series: (iii) Rate of bacterial adhesion to intestinal mucosa of rabbit Percent (%) of Adhesion = 100 x intestine surface bacteria/ intestine surface bacteria + CFU fluid (Richardson, 1991) Data processing: Excel: calculate the average value of the prevalence rate V.cholerae and antibiotic resistance; Software BioEdit: analyzing the nucleotide sequences; MEGA software (Treeview): drawing tree genealogical diagram; Minitab version 16.0: analysis of FA and CFU values Chapter 4: RESULTS AND DISCUSSION 4.1 Results of Isolation and identification of Vibrio spp 4.1.1 Results of Isolation Vibrio spp Vibrio spp can grow in thiosulfate-citrate-bile salts-sucrose agar (TCBS): yellow or green colonies depending on the species Overall, colonies of the species V.cholerae, V vulnificus; V fluvialis V alginolyticus are all yellow, but colonies V paraheamolyticus is blue; Colony size is different from different species (Tran Linh Thuoc, 2009) 4.1.2 Result of identifying Vibrio spp by biochemical reactions Observing biochemical characteristics to distinguish between species of Vibrio spp Most are oxidase and catalase producing, fermented sugar: V cholerae, V paraheamolyticus, V vulnificus and V alginolyticus not ferment lactose, but V cholerae and V alginolyticus are capable of bacteria tryptophan oxidation into metabolic products with indole origin: including indole, sketole and formed a red complex (Tran Linh Thuoc, 2009) 11 All species such as V cholerae, V vulnificus, V fluvialis and V alginolyticus were negative with urea, V parahaemolyticus are positive reaction with urea Vibrio spp Grow in saline at 0-2%, 2-6%, 2-8% and 2-10% Table 4.1: The results of biochemical of Vibrio spp Test SH V.cholerae Colonies Oxidase Yellow (+) Vibrio spp V.paraheamolyticus V.vulnificus Green Yellow (+) (+) V.fluvialis V.alginolyticus Green Yellow (+) (+) TSI (+) Glucose (+) (+) (+) Lactose (-) (-) (+) (-) (-) Sucrose + (-) (-) (+) (+) LDC (+) (+) (+) (-) (+) Di động (+) (+) (+) (+) (+) ONPG (+) (+) (+) (+) Indole (+) (-) (-) (-) (+) Urease (-) (+) (-) (-) (-) PAD (-) (-) (-) (-) Citrate (-) (-) (-) (-) (+) V cholerae bacteria under electron microscope at 5,000 and 10,000 Figure 4.1: Bacteria under the electron microscope at 5,000 and 10,000 12 Figure of V cholerae bacteria strain O3.2 through electron microscope curved shape, - 3µm, short-fragella V cholerae uses two virulence factors from pili / pili (TCP) and cholera toxin CTX TCP is also essential for the formation of V cholerae colonies located in the intestine of rats (Taylor et al., 1987) and human (Herrington et al., 1988) The bacteria in this study all had short-fragella,it may be due to defects in flagellar and mutant-gene so the fragella length is invisible through the electron microscope 4.1.3 Result of identifying Vibrio spp by PCR Figure 4.2: Amplifying the gene segments 16S-27F and 1492Rbp The electrophoresis result of the above figure shows the 1500 bp length PCR product, equivalent to the 16S rRNA gene in all strains of Vibrio spp 1500 bp length (Williams et al., 1991) including high conservation areas and present in most branched bacteria but close relationship To compare the test results with the biochemical characteristics of PCR products, the study recorded the species of Vibrio respectively: V cholerae from line 1-6 ; V fluvialis from 7-11; V paraheamolyticus from 12-19; V vulnific from 20-23; V alginolyticus from 24-25 Also in this study, unable to detect any strain of Vibrio carrying the gene O139rfb and strain carrying the cholera toxins gene CTXA on water samples and seafood Thus, the results of PCR detected strains that not carry the gene of Vibrio O139rfb and cholera toxin genes CTX on samples from water and seafoods This demonstrates Vibrio O139 not appear in Tra Vinh province 13 4.1.5 Detection rate of Vibrio spp isolated On the clams, have very diverse presence of Vibrio spp., as these are species that live in salt water, very suitable for Vibrio spp., including V cholerae are 1, 9% In pig blood, due to the use of water from the river for use in the process of slaughtering as washing meat, blood mixing, positive 2% with V cholerae corresponding with V cholerae isolated from river water (Table 4.3) This result is comparable with the isolation results in Ho Chi Minh City, which rate 1.1% in water samples and 2.2% in food samples; in Ben Tre, t he rate in water samples was 5.7% (Nguyen Hoang Vu, 2013), because there was a cholera epidemic in Ben Tre province in 2010 Table 4.2: Rate of Vibrio spp infection on samples Samples Vibrio species (n = 500) Clam (n = 160) Number of samples Positive Samples Rate (%) V cholerae 160 03 1,9 V paraheamolyticus 160 03 1,9 V vulniticus 160 04 2,5 V fluvialis 160 05 3,1 V alginolyticus 160 01 0,63 V cholerae 100 02 2,0 V paraheamolyticus 100 02 2,0 + River V cholerae 50 01 2,0 + Sea V alginolyticus 50 01 2,0 + Shrimp pond V paraheamolyticus 50 02 4,0 V paraheamolyticus 50 01 2,0 40 0,0 Pig Blood (n = 100) Water(n = 150) Shrimp (n = 50) Stool (n = 40) Sum 25 In 25 isolated strains including strains of V cholerae (24%); strains of V paraheamolyticus (32%); strains of V vulnificus (16%); strains of V fluvialis (20%) and strains of V alginolyticus (8%) Results from the above table shows the isolated rate of V paraheamolyticus was highest (32%), they appear on the clams, in the river, particularly in the shrimp pond with salinity from 6-8% and on 14 shrimp, consistent with their habitat Clams are also frequently hosts of V vulniticus; V fluvialis and V alginolyticus 4.2 Results of serotyping Results for serological isolated V cholerae strains by agglutination showed 100% (6/6) positive strain with polyclonal antisera (Ogawa, Inaba, O139), of which 50% (3/6) strains of Ogawa and 50% (3/6) of Inaba strains 4.3 Results of the homology between species of Vibrio on GenBank using BLAST In this study, the isolated strains were Vibrio spp., including Ng3, O3.2, O1.2, N8 and O9.1 have similar rates of nucleotide sequences of gene segments 16S-27F and 1492R of analysis strains with other strains of V cholerae was very high Figure 4.3: Tree performances evolutionary relationship based on 16srDNA of isolated Vibrio spp and some reference strains Figure above shows the isolated strains had the same characteristics as the strain originated from the environment, showing the strains of Vibrio 15 spp always have potential of risks and will easily cause the disease by receiving the gene from the virulent strain of CTX 4.4 The antibiotic resistance of V cholerae 4.4.1 The survey result of V cholerae antibiotic resistance by Kirby Bauer method (CLSI, 2010) Table 4.3: The sensitive and antibiotic resistance of V cholerae antibiotic Streptomycin Norlfoxacin Ampicillin Tetracyclin Azithromycin Amoxicillinclavulanic axit Trimethoprimsulfamethoxazole Vancomycin code Sm Nr Am Te Az Ac SXT/Bt Van Number of sample Sensitive samples Anti % Samples % 6 6 6 4 50 10 83 67 67 83 2 50 17 33 33 17 67 33 33 67 These results showed that V cholerae strains in this study are highly sensitive to many antibiotics such as norfloxacin (100%), ampicillin (83%) and amoxicillin-clavulanic acid (83%) Also, V cholerae is resistant to vancomycin (67%), streptomycin (50%), tetracycline (33%) This result is consistent with the studies of Nguyen Thi Xuan Trang and Nguyen Ngoc Tuan (2012); Tran Huu Dat (2012) 4.4.3 Results of antibiotic resistance of V cholerae by PCR M tetA (880bp) 900bp M: standard 100bp, 1: V.cholerae (T1), 2: V cholerae (T3) Figure 4.4: Amplifying 16 of gene segment tetAF and testAR The electrophoresis results on the above Figure shows that the 880bp length PCR products corresponding to genes segment tetA discovered in V cholerae strains Gene tetA has a speciality conservation sequence, so the PCR products were all V cholerae T1 and T2 Through research, did not dicover V cholerae strains carry antibiotic resistance genes blaSHV, aac (3) -IV and dhfrI V cholerae strains (T1) and V cholerae strains (T3) are isolated from the water environment and they all carry genes resistant to tetracycline, Aminoglycoside group Thus some strains in the study did not contain tetracycline resistance gene (tetA), but they are resistant to tetracycline, may be due to the presence of other genes encoding resistance to tetracycline as blaSHV, aac (3)-IV and dhfrI This result is similar to the results of Dang et al., (2006) 4.4.5 Results of comparing the nucleotide sequences of the strains of V cholerae T1, T3 with wild V cholerae strain N16961 The nucleotide position is inserted and loss corresponds to the position of amino acid changes in the sequence of the V cholerae strains, from which inferences about the mutant type isolated V cholerae strains Table 4.4: Comparing the amino acid position of the wild-type V cholerae strains N16961 with V cholerae strains T1 Codon 14 51 52 69 71 74 105 106 121 142 160 161 164 165 166 Nucleotide changes Amino Acid changes nucleotide T1 loss AGT→CTG CCT→TGA TGG→TCA CGT→TAG GTT→TAA A-T→TCA CA - →CG - TG→-TG GCT→TAG GGT→TGA AAA→TGA GTA→TGA CTT→TGA GAA→TGA TCA→TGA Ser→Leu Pro →End Trp→Ser Arg→End Val→End → Ser Loos → → Ala→End Gly →End Gly →End Val →End Leu →End Glu→End Ser→End 17 Adding Mutant type Replication error Recombination error Replication error Recombination error Recombination error Error Error Error Recombination error Recombination error Recombination error Recombination error Recombination error Recombination error Recombination error When comparing the nucleotide position of wild V cholerae strain N16961 with nucleotide position isolated V cholerae strains T1, found that V cholerae strain T1 has the mutation of adding or loss from 1- nucleotides in multiple codons, to change position and alter the amino acid protein structure V cholerae strains T1 has codon ending at 10 positions, corresponding to 10 amino acid positions, this is a frameshift mutation by adding or loss or nucleotides, to stop codons, that will stop the polypeptide synthesis chain and these enzyme activity will be stopped (Nguyen Hoang Loc, 2007) Table 4.5: Comparing the nucleotide position of wild V cholerae strain N16961 with nucleotide position isolated V cholerae strains T3 Codon Nucleotide changes Amini Acid change Nnucleotide T3 loss Mutant type 14 17 19 23 TAA→TGA AGT→CTG TGA→ATC ACA→CCC GAT→CTC End →End Ser→Leu End→Ile Thr→Pro Asp→Leu Ading Loos Loos Loos Loos Recombination error Replication error Error Replication error Replication error 24 32 48 52 53 54 55 63 71 74 95 100 106 124 161 TCA→TAC AAC→ATC ACA→CGC TGG→CTA GAT→GCG CTA→GCG AAA→TAT GGA→GAA GTT→GAG A-T→G- AAA →TGA TT→TGA GAA → TAA CA→TAA TA→TAA Ser→Tyr Asn→Met Thr→Ala Trp→Leu Asp→Gly Leu→Gly Lys→Tyr Gly→Glu Val→Glu → Lys →End Ile→End Glu→End Ala→End Val→End Loos Loos Loos Loos Loos Loos Loos Loos Loos 2 Replication error Replication error Replication error Replication error Replication error Replication error Replication error Replication error Replication error Error Recombination error Recombination error Recombination error Recombination error Recombination error The same with T1, When comparing the nucleotide position of wild V cholerae strain N16961 with nucleotide position isolated V cholerae strains T3, shows that V cholerae strain T3 has the mutation of adding or 18 loss from 1- nucleotides in multiple codons, leading to change position and alter the amino acid protein structure V.cholerae strains T3 has codon ending at positions, corresponding to amino acid positions, this is a frameshift mutation by adding or loss or nucleotides, to stop codons, that will stop the polypeptide synthesis chain and these enzyme activity will be stopped (Nguyen Hoang Loc, 2007) 4.4.6 Genetic relationship of V cholerae strains based on antibiotic resistance genes tetA In this study, two strains of V cholerae isolated in Tra Vinh carried tetracycline antibiotic resistance Isolated from water and clams with similar of nucleotide sequence with other strains in Thailand, Japan, China, Indonesia, Brazil and India, 97% similarity with 10 strains; 96% similarity with strains and 94% similarity with other strains Figure 4.5: Genetic relationship of V cholerae strains based on antibiotic resistance genes tetA Results of genetic tree also showed that two strains of V cholerae isolates from T1 and T3 in Tra Vinh river water carries antibiotic resistance genes had close ralationship of nucleotide sequences (97%) with other isolated strains of V cholerae in Indonesia in 2008; Brazil, 2012; Haiti in 2010; China in 2008; Bangladesh 2009; Thailand in 2014 and V cholerae non-O1 isolates vcmD in Japan in 2005 19 Thus, strains in this study had antibiotic resistance mechanisms similar to comparative strains and risk of genetic antibiotic resistance genes is very high in the V cholerae strains 4.5 Experiment of virulent V cholerae mutant strain and evaluate of immune response in rabbits 4.5.1 Evaluation results of V cholerae mutant strains for rabbits without cholera vaccine 4.5.1.1 Fluid accumulation After putting the inoculum in the small intestine rabbits at doses of 105-107, the amount of secreted fluid is withdrawn through the following chart: Fluid (ml) Time Figure 4.6: Chart of liquid rate after injection of bacteria in the intestine of rabbit Through the results, found that wild V cholerae N1strain 6961 starting fluid accumulation at the time of hours and 16 hours after injection of bacteria 1.45 ml - 2.3 ml / cm higher than V cholerae strains T1 and V cholerae strains T3 in this study, that carried the tetracycline resistance gene when injected into the small intestine of rabbits did not stimulate the rabbit intestinal mucosa secrete fluid, only secreted from 0.8 - 0.9 ml / cm at hours, then decreased to 0:15 - 0.2 ml / cm at the time of 16 hours This difference was statistically significant (p [...]... sequences of 6 Vibrio strains: V choleraeNg3, V cholerae- O3.2, V cholerae- O1.2, V cholerae- 81V1, V choleraeN8 and V cholerae- 85V1, was sequenced in the company Macrogen Inc (South Korea) The sequences were analyzed and read by software Bio.Edit, then compared with similar nucleotide sequences set on GenBank and establishing the genetic tree 9 3.2.2.3 Determine antibiotic resistance of bacteria V cholerae. .. wild V cholerae strain N16961 with nucleotide position isolated V cholerae strains T3, shows that V cholerae strain T3 has the mutation of adding or 18 loss from 1- 3 nucleotides in multiple codons, leading to change position and alter the amino acid protein structure V .cholerae strains T3 has codon ending at 6 positions, corresponding to 6 amino acid positions, this is a frameshift mutation by adding... and cholera toxin genes CTX on samples from water and seafoods This demonstrates Vibrio O139 do not appear in Tra Vinh province 13 4.1.5 Detection rate of Vibrio spp isolated On the clams, have very diverse presence of Vibrio spp., as these are species that live in salt water, very suitable for Vibrio spp., including V cholerae are 1, 9% In pig blood, due to the use of water from the river for use in... colonies depending on the species Overall, colonies of the species V .cholerae, V vulnificus; V fluvialis và V alginolyticus are all yellow, but colonies V paraheamolyticus is blue; Colony size is different from different species (Tran Linh Thuoc, 2009) 4.1.2 Result of identifying Vibrio spp by biochemical reactions Observing biochemical characteristics to distinguish between species of Vibrio spp Most... V cholerae by PCR M 1 2 tetA (880bp) 900bp M: standard 100bp, 1: V .cholerae (T1), 2: V cholerae (T3) Figure 4.4: Amplifying 16 of gene segment tetAF and testAR The electrophoresis results on the above Figure shows that the 880bp length PCR products corresponding to genes segment tetA discovered in 2 V cholerae strains Gene tetA has a speciality conservation sequence, so the PCR products were all V cholerae. .. average value of the prevalence rate V .cholerae and antibiotic resistance; Software BioEdit: analyzing the nucleotide sequences; MEGA software (Treeview): drawing tree genealogical diagram; Minitab version 16.0: analysis of FA and CFU values Chapter 4: RESULTS AND DISCUSSION 4.1 Results of Isolation and identification of Vibrio spp 4.1.1 Results of Isolation Vibrio spp Vibrio spp can grow in thiosulfate-citrate-bile... products were all V cholerae T1 and T2 Through research, did not dicover V cholerae strains carry antibiotic resistance genes blaSHV, aac (3) -IV and dhfrI V cholerae strains (T1) and V cholerae strains (T3) are isolated from the water environment and they all carry genes resistant to tetracycline, Aminoglycoside group Thus some strains in the study did not contain tetracycline resistance gene (tetA),... nucleotide position isolated V cholerae strains T1, found that V cholerae strain T1 has the mutation of adding or loss from 1- 3 nucleotides in multiple codons, to change position and alter the amino acid protein structure V cholerae strains T1 has codon ending at 10 positions, corresponding to 10 amino acid positions, this is a frameshift mutation by adding or loss 1 or 2 nucleotides, to stop codons, that will... Select 08 antibiotic used to treat intestinal diseases, especially cholera After incubation for 18 to 24 hours, measure the diameter of the zone of inhibition, including the diameter of the disk and read the results of antibiotics based on standard tables the antibiotic susceptibility of enteric bacteria (CLSI, 2010) b Determine antibiotic resistance of V cholerae by PCR (Polymerase Chain Reaction) After... variation for V cholerae related to pathogenic for humans 23 LIST OF PROJECTS ANNOUNCEMENT RELATING TO THE THESIS 1 Nguyen Thi Dau, Ha Thanh Toan, Ho Thi Viet Thu và Nguyen Thuy Linh, 2014 Prevalence and antibiotic resistance of Vibrio spp isolated from swine blood sample, clam and patient with diarrhea in Tra Vinh Province Journal of Science Can Tho University, 33b: 61 - 67 2 Nguyen Thi Dau và Ho Thi Viet ... phylogenetic tree The PCR product (DNA) sequences of Vibrio strains: V choleraeNg3, V cholerae- O3.2, V cholerae- O1.2, V cholerae- 81V1, V choleraeN8 and V cholerae- 85V1, was sequenced in the company Macrogen... non-O139 V cholerae O1 is also divided into three serotypes, Ogawa, Inaba and Hikojima; these serotypes are divided into types of antigens: A, B and C 2.2.2 Characteristics of Vibrio cholerae V cholerae. .. Characteristics of Vibrio cholerae 2.2.1 Classification V cholerae V cholerae is a Gram-negative bacterium that causes cholera in humans, genus Vibrio and Gammaproteobacteria class V cholerae has two