Phân biệt thịt trâu và thịt bò bằng kỹ thuật PCR Nghiên cứu khoa học Giảng viên

i LỜI CẢM ƠN Tôi xin chân thành gởi lời cảm ơn với lòng biết ơn sâu sắc đến: * Ban Giám hiệu trường Đại học Lạc Hồng, Ban chủ nhiệm Khoa Công nghệ sinh học Môi trường – trường Đại học Lạc Hồng * PGS TS Nguyễn Ngọc Tuân, giảng viên Khoa Chăn Nuôi Thú Y trường ĐHNL TP HCM * TS Hồ Thị Kim Hoa, giảng viên Khoa Chăn Nuôi Thú Y trường ĐHNL TP HCM * Quý cán công chức Viện Công nghệ Sinh học Môi trường - trường ĐHNL TP HCM tận tình giúp đỡ tạo điều kiện để hoàn thành đề tài * Các bạn bè người thân quan tâm động viên suốt trình thực đề tài Chân thành cảm ơn, Đồn Thị Tuyết Lê ii TĨM TẮT Đề tài “Phân biệt thịt trâu thịt bò kỹ thuật PCR” tiến hành Viện Công nghệ Sinh học Môi Trường, trường Đại học Nông Lâm TP HCM từ ngày 15/10/2010 đến ngày 1/5/2011 Mục tiêu nghiên cứu là: xây dựng quy trình PCR phát thịt trâu, thịt bò sử dụng primer tự thiết kế; ứng dụng quy trình PCR-trâu PCR-bị để phát thịt trâu thịt bò hỗn hợp DNA, hỗn hợp thịt khơng xử lý nhiệt, có có xử lý nhiệt mẫu bột thịt thị trường nguyên liệu chế biến thức ăn gia súc Kết đạt sau: Quy trình PCR phát thịt trâu với forward primer reverse primer có trình tự sau 5’- CTACACATCCGA CACAACAACAGC-3’, 5’- ATGTAGCAGGGGCAT GAGAA-3’ Mẫu DNA biến tính 94oC phút sau khuếch đại qua 35 chu kỳ nhiệt: biến tính 94oC/1’, ủ bắt cặp 56oC/ 45’’, kéo dài 72oC/1’ kết thúc 72oC/5’ Nồng độ DNA trâu thấp mà PCR-trâu phát 0,001 ng/μl Tỷ lệ DNA thịt trâu thấp hỗn hợp DNA giảm dần trâu, bị, dê, cừu mà PCR-trâu phát 0,1% Tỷ lệ thịt trâu thấp mà PCR-trâu phát hỗn hợp thịt giảm dần trâu, bị, dê, cừu 0,1% Quy trình PCR-trâu có khả phát thịt trâu hỗn hợp thịt xử lý 80oC/15’, 120oC/15’, 130oC/15’, 180oC/15’ khơng có khả phát thịt trâu với tỷ lệ ≤ 10% hỗn hợp thịt xử lý 120oC/30’ 130oC/30’ Quy trình PCR phát thịt bò với forward primer 5’-CTACACATCCGA CACAACAACAGC-3’, reverse primer 5’-TCAGTAGGTCTGCTACTAGGGC -3’ Quy trình nhiệt sau: tiền biến tính 94oC/4’; 35 chu kỳ: biến tính 94oC/1’, bắt cặp 54oC/ 45’’, kéo dài 72oC/1’; kéo dài cuối 72oC/5’ Nồng độ DNA bò thấp mà PCR-bị phát 0,001 ng/μl Tỷ lệ DNA bò thấp hỗn hợp DNA giảm dần trâu, bị, dê, cừu mà PCR-bị phát 0,05% Tỷ lệ thịt bò thấp mà PCR-bị phát hỗn hợp thịt giảm dần trâu, bị, dê, cừu 0,1% PCR-bị có khả phát thịt bò hỗn hợp thịt xử lý 80oC/15’, 180oC/15’ khơng có khả phát thịt bò với tỷ lệ ≤ 10% hỗn hợp thịt xử lý 120oC/15’, 120oC/30’, 130oC/15’ 130oC/30’ iii SUMMARY Research project “Differentiation of meat species of buffalo, cattle by PCR techniques” was carried out at Institute of Biotechnology & Environment, Nong Lam University Ho Chi Minh city from October 15, 2010 to May 1, 2011 The project was aimed: (i) to establish PCR reactions for identification of beef and buffalo meat; (ii) consequently, to apply these reactions in identification of meat species in raw and processed meat mixtures The results were summarized as follows: PCR protocol for detection of buffalo meat (buffalo-PCR) using specific primers was accomplished A new set of primers for buffalo meat were designed and tested (Forward primer, 5'-CTACACATCCGACACAACAACAGC-3' and reverse primer, 5'-ATGTAGCAGGGGCATGAGAA-3') Amplification reaction was started with predenaturation step at 94oC/4', followed by 35 cycles including 94oC/1', 56oC/45'', 72oC/1’ and final extension at 72oC/5' The lowest concentration of buffalo DNA that could be detected by buffalo-PCR was 0.001 ng/μl The lowest rate of buffalo DNA in the DNA mixture reduced ratio of DNA from raw meat of buffalo, cattle, goat, sheep that buffalo-PCR could detect was 0.1%, which is the same as the lowest rate of buffalo meat that buffalo-PCR could detect in the meat mixture with reduced ratio of buffalo, beef, goat, sheep The PCR was successfully applied to detect buffalo meat in mixtures having been processed at 80oC/15’, 120oC/15’, 130oC/15’, 180oC/15’ but was not in the case of meat mixtures that had ≤ 10% buffalo meat and had been heated at 120oC/30’ and 130oC/30’ PCR protocol for detection of beef (cattle-PCR) was set up The new set of primers for the PCR to detect beef were: forward primer, 5'-CTACACATCCGACAC AACAACAGC-3’, and reverse primer, 5'-TCAGTAGGTCTGCTACTAGGGC-3' The thermal process was as follows: 94oC/4' for initial denaturation, 35 cycles of denaturation at 94oC/1’, annealing at 54oC/45'', enlongation at 72oC/1’ and final extension at 72oC/5’ The cattle-PCR could detect cattle DNA with the concentration as low as 0.001 ng/μl The lowest rate of cattle DNA in the mixture reduced ratio of DNA from the raw meat of the buffalo, cattle, goat, sheep that cattle-PCR could detect was 0.05% The lowest rate of cattle meat that cattle-PCR could detect in the reduced ratio mixture of buffalo, goats, sheep meat was 0.1% This PCR protocol was successfully to detect beef in meat mixtures which was processed at 80oC/15', 180oC/15' but was not to identify the meat in those had ≤ 10% buffalo meat and had been processed at 120oC/15’, 120oC/30’, 130oC/15’, and 130oC/30’ iv MỤC LỤC CHƯƠNG TRANG LỜI CẢM ƠN i TÓM TẮT ii SUMMARY iii DANH SÁCH CÁC CHỮ VIẾT TẮT vii DANH SÁCH CÁC HÌNH viii DANH SÁCH SƠ ĐỒ viii DANH SÁCH CÁC BẢNG ix Chương MỞ ĐẦU 1.1 Đặt vấn đề .1 1.2 Mục tiêu 1.3 Mục đích Chương TỔNG QUAN 2.1 Sơ lược thịt thịt chế biến .3 2.1.1 Giới thiệu sơ lược thịt 2.1.2 Giới thiệu sơ lược thịt chế biến 2.1.3 Tình hình gian lận thị trường thịt giới Việt Nam 2.1.3.1 Tình hình gian lận thị trường thịt tươi thịt chế biến giới 2.1.3.2 Tình hình gian lận thị trường thịt tươi thịt chế biến Việt Nam 2.2 Các phương pháp phát thịt 2.2.1 Phương pháp dựa vào protein 2.2.1.1 Phương pháp điện di .6 2.2.1.2 Phương pháp miễn dịch 2.2.1.3 Phương pháp sắc ký .8 2.2.2 Phương pháp dựa vào DNA 2.2.2.1 Phương pháp lai DNA 2.2.2.2 Phương pháp dựa vào PCR 11 2.3 DNA ty thể gen cytochrome b việc phát loài 21 2.3.1 DNA ty thể 21 2.3.2 Di truyền ty thể .25 2.3.3 Sử dụng gen cytochrome b để phát nguồn gốc loài sản phẩm thịt chế biến 25 2.4 Tổng quan công trình nghiên cứu phát lồi thịt phương pháp PCR 26 Chương .29 NỘI DUNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU .29 3.1 Thời gian địa điểm tiến hành 29 3.2 Nội dung nghiên cứu 29 3.3 Vật liệu .29 3.3.1 Nguồn mẫu tách chiết DNA 29 3.3.2 Primer 29 3.3.3 Hóa chất, thiết bị dụng cụ .29 v 3.4 Phương pháp tiến hành 30 3.4.1 Lấy bảo quản mẫu 30 3.4.2 Tách chiết DNA 30 3.4.3 Thiết kế kiểm tra primer phát thịt trâu thịt bò .31 3.4.3.1 Thiết kế primer .31 3.4.3.3 Kiểm tra thực tế độ đặc hiệu cặp primer F&RB, F&RC 32 3.4.4 Xác định quy trình PCR- trâu PCR-bị 33 3.4.5 Ứng dụng PCR-trâu, PCR-bò để phát thịt trâu, bò .33 3.4.5.1 Ứng dụng PCR-trâu 33 a Xác định giới hạn phát PCR-trâu 33 b PCR-trâu với hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu 33 c PCR-trâu phát thịt trâu hỗn hợp thịt không xử lý nhiệt .34 d PCR-trâu phát thịt trâu hỗn hợp thịt xử lý nhiệt 34 e PCR-trâu với bột thịt thị trường 34 3.4.5.2 Ứng dụng PCR-bò 36 a Xác định giới hạn phát PCR-bò 36 b PCR-bị với hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu 36 c PCR-bò phát thịt bò hỗn hợp thịt không xử lý nhiệt 36 d PCR-bò phát thịt bò hỗn hợp thịt xử lý nhiệt 36 e PCR-bò với bột thịt thị trường 36 Chương .38 KẾT QUẢ THẢO LUẬN .38 4.1 Kết thiết kế tổng hợp primer phát thịt trâu, thịt bò 38 4.2 Kết kiểm tra lý thuyết độ đặc hiệu cặp primer F&RB, F&RC .38 4.2.1 Kết kiểm tra FASTPCR .38 4.2.2 Kết kiểm tra Clustal W 39 4.2.3 Kết BLAST 39 4.3 Kết kiểm tra thực tế độ đặc hiệu cặp primer F&RB, F&RC 40 4.3.1 Bằng PCR 40 4.3.1.1 Kết kiểm tra tổ hợp primer A B 40 4.3.1.2 Kết kiểm tra tổ hợp primer C D 41 4.3.1.3 Kết kiểm tra tổ hợp primer E F 41 4.3.1.4 Kết kiểm tra tổ hợp primer G H 41 4.3.1.5 Kiểm tra độ đặc hiệu primer F2&RBU2 F2&RC2 với DNA template lúa, đậu phộng, đậu nành, mè, cà chua 43 4.3.2 Giải trình tự sản phẩm PCR cặp F&RB; F&RC đặc hiệu 43 4.3.3 Xác nhận sản phẩm khuếch đại thịt trâu bò 44 4.3.3.1 BLAST 44 4.3.3.2 Gởi mã số lên NCBI cho trình tự đoạn DNA thịt trâu bị 44 4.4 Xác định quy trình PCR-trâu .45 4.5 Xác định quy trình PCR-bị 45 4.6 Ứng dụng PCR-trâu, PCR-bò 45 4.6.1 Ứng dụng PCR-trâu 45 vi 4.6.1.1 Giới hạn nồng độ DNA trâu phát PCR-trâu .45 4.6.1.2 PCR-trâu hỗn hợp DNA có nồng độ giảm dần trâu, bị, dê, cừu 46 4.6.1.3 PCR-trâu phát thịt trâu hỗn hợp thịt không xử lý nhiệt 46 4.6.1.4 PCR-trâu phát thịt trâu hỗn hợp thịt xử lý nhiệt 47 4.6.1.5 PCR-trâu với bột thịt thị trường 48 4.6.2 Ứng dụng PCR-bò .49 4.6.2.1 Giới hạn nồng độ DNA bị phát PCR-bò .49 4.6.2.2 PCR-bò hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu 49 4.6.2.3 PCR-bò phát thịt bị hỗn hợp thịt khơng xử lý nhiệt 50 4.6.2.4 PCR-bò phát thịt bò hỗn hợp thịt xử lý nhiệt 50 4.6.2.5 PCR-bò với bột thịt thị trường 53 Chương .54 KẾT LUẬN VÀ ĐỀ NGHỊ 54 5.1 Kết luận 54 5.2 Đề nghị .54 TÀI LIỆU THAM KHẢO .55 PHỤ LỤC 65 vii DANH SÁCH CÁC CHỮ VIẾT TẮT BSE : bovine spongiform encephalophathy GC : gas chromatography HPLC : high performance liquid chromatography IEF : isoelectric focusing LC : liquid chromatography LTRs : long terminal repeats MT-ATP6 : mitochondrially encoded ATP synthase mtDNA : mitochondrial deoxyribonucleic acid MT-ND1 : mitochondrially encoded NADH dehydrogenase MT-ND4 : mitochondrially encoded NADH dehydrogenase MT-ND4L : mitochondrially encoded NADH dehydrogenase 4L MT-ND5 : mitochondrially encoded NADH dehydrogenase MT-ND6 : mitochondrially encoded NADH dehydrogenase MT-RNR1 : mitochondrially encoded 12S RNA MT-TH : mitochondrially encoded tRNA histidine MT-TL1 : mitochondrially encoded tRNA leucine (UUA/G) MT-TS1 : mitochondrially encoded tRNA serine (UCN) MT-TV : mitochondrially encoded tRNA valine NADH : Nicotinamide adenine dinucleotide PCR : polymerase chain reaction Prion : proteinaceous infectious particle RCB : reverse primer cattle &/ buffalo (theo Matsunaga & ctv, 1999) RP- HPLC : reverse phase high performance liquid chromatography SSRs : simple sequence repeats viii DANH SÁCH CÁC HÌNH Hình 2.1: Mơ hình kiểm tra mẫu kỹ thuật lai DNA 10 Hình 2.2: Genome ty thể .24 Hình 4.1: Kết kiểm tra tổ hợp primer A (F1-RBU1) B (F1-RBU2) 41 Hình 4.2: Kết kiểm tra tổ hợp primer C (F1-RC1) D (F1-RC2) 41 Hình 4.3: Kết kiểm tra tổ hợp primer E (F2-RBU1)và F (F2-RBU2) 42 Hình 4.4: Kết kiểm tra tổ hợp primer G ((F2-RC1) H (F2-RC2) 42 Hình 4.5: Kiểm tra độ đặc hiệu primer F2 &RBU2 (Ta=56oC) 42 Hình 4.6: Kiểm tra độ đặc hiệu primer F2&RBU2 F2&RC2 với DNA template lúa, đậu phộng, đậu nành, mè, cà chua 43 Hình 4.7: Giới hạn nồng độ DNA trâu phát PCR-trâu 45 Hình 4.8: PCR-trâu hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu .46 Hình 4.9: PCR-trâu phát thịt trâu hỗn hợp thịt khơng xử lý nhiệt .46 Hình 4.10: PCR-trâu phát thịt trâu hỗn hợp thịt xử lý nhiệt 80oC/15’(M2.1-M2.7) 180oC/15’ (M7.1-M7.7) .47 Hình 4.11: PCR-trâu phát thịt trâu hỗn hợp thịt xử lý nhiệt 130oC/30’(M6.1-M6.7) 120oC/15’ (M3.1-M3.7) 47 Hình 4.12: PCR-trâu phát thịt hỗn hợp thịt xử lý nhiệt 130oC/15’(M5.1-M5.7) 120oC/30’ (M4.1-M4.7) 48 Hình 4.13: PCR-trâu với bột thịt 48 Hình 4.14: Giới hạn nồng độ DNA bị phát PCR-bị 49 Hình 4.15: PCR-bị hỗn hợp DNA có nồng độ giảm dần trâu, bò, dê, cừu .49 Hình 4.16: PCR-bò phát thịt bò hỗn hợp thịt khơng xử lý nhiệt 50 Hình 4.17: PCR-bị phát thịt bò hỗn hợp thịt xử lý nhiệt 80oC/15’(M2.1-M2.7) 120oC/15’ (M3.1-M3.7) .51 Hình 4.18: PCR-bị phát thịt bịtrong hỗn hợp thịt xử lý nhiệt 120oC/30’(M4.1-M4.7) 130oC/15’ (M5.1-M5.7) 52 Hình 4.19: PCR-bị phát thịt bò hỗn hợp thịt xử lý nhiệt 130oC/30’(M6.1-M6.7) 180oC/15’ (M7.1-M7.7) 52 Hình 4.20: PCR-bị với bột thịt thị trường .53 DANH SÁCH SƠ ĐỒ Sơ đồ 2.1: Các phương pháp phân biệt loài thịt 20 Sơ đồ 3.1: Sơ đồ nghiên cứu 37 ix DANH SÁCH CÁC BẢNG Bảng 2.1 Tỉ lệ phần trăm (%) mơ loại thịt (tính theo khối lượng thịt xẻ) Bảng 2.2: 13 gen mã hóa protein chuỗi vận chuyển 21 Bảng 2.3: 22 gen mã hóa tRNA 23 Bảng 3.1: Thành phần hóa chất phản ứng PCR kiểm tra độ đặc hiệu primer .32 Bảng 3.2: Tỷ lệ DNA heo, gà, trâu, bò, dê, cừu hỗn hợp 34 Bảng 3.3: Hỗn hợp thịt chế biến không xử lý nhiệt xử lý nhiệt .35 Bảng 4.1: Các primer thiết kế 38 Bảng 4.2: Kết kiểm tra FASTPCR .39 Bảng 4.3: Kết gióng cột Clustal W primer với trình tự cytochrome b lồi trâu, bị, heo, gà, dê, cừu 39 Bảng 4.4: Các tổ hợp primer 40 Chương MỞ ĐẦU 1.1 Đặt vấn đề Ngày nay, nhu cầu lương thực thực phẩm tăng cao việc đảm bảo chất lượng vệ sinh an toàn thực phẩm điều cần thiết Trong đó, sản phẩm có nguồn gốc từ thịt mối quan tâm xã hội Sản phẩm thịt chế biến thường có nguồn gốc từ hay nhiều loại thịt khác Do đa dạng hình thức, chất lượng giá thành sản phẩm thịt chế biến gây vấn đề gian lận thương mại Trên thị trường có nhiều sản phẩm thịt ghi thành phần nhãn hiệu, công thức lệch với thực tế để nâng cao giá trị cho sản phẩm Đặc biệt, gian lận ảnh hưởng đến việc kiêng sử dụng hay vài lồi thịt lý sức khỏe (ví dụ bị dị ứng) hay lý tơn giáo (ví dụ, đạo Hindu khơng ăn thịt bị) Thịt chế biến thường xử lý nhiệt độ cao 1000C (khoảng 1200C thịt hộp, xúc xích tiệt trùng…) Đặc biệt bột xương thịt làm thức ăn cho gia súc xử lý nhiệt độ khoảng 1300C sản xuất từ phụ phế phẩm cơng nghiệp giết mổ heo, trâu, bị, cừu, gà, dê,…nên số mầm bệnh nguy hiểm tồn có khả gây bệnh Ví dụ bệnh BSE (Bovine spongiform encephalopathy) - bệnh bò điên - gây hại gia súc có khả lây lan sang người Vì lý này, nước giới có Việt Nam khơng cho nhập bột xuơng thịt có nguồn gốc từ thịt bị vùng lãnh thổ có mầm bệnh BSE Vì thế, việc phát triển ứng dụng phương pháp phát xác nhanh chóng loại thịt sản phẩm chế biến từ thịt gia súc, gia cầm khác nhu cầu cần thiết thị trường xã hội Có nhiều phương pháp để xác định nguồn gốc thịt phương pháp phát dựa vào protein (ví dụ điện di, miễn dịch, sắc ký), phương pháp phát dựa vào DNA (lai DNA, RAPD-PCR, PCR đặc trưng cho loài standard-PCR, multiplex-PCR, Realtime PCR, PCR-RFLP, PCR sequencing, PCR-SSCP.) Các phương pháp phát dựa vào protein chậm ứng dụng cho sản phẩm thịt xử lý nhiệt Do đó, phương pháp dựa vào DNA 52 M4.1 M4.2 M4.3 M4.4 M4.5 M4.6 M4.7 LAD M5.1 M5.2 M5.3 M5.4 M5.5 M5.6 M5.7 ĐCD Hình 4.18: PCR-bị phát thịt bịtrong hỗn hợp thịt xử lý nhiệt 120oC/30’(M4.1-M4.7) 130oC/15’ (M5.1-M5.7) M6.1 M6.2 M6.3 M6.4 M6.5 M6.6 M6.7 LAD M3.1 M3.2 M3.3 M3.4 M3.5 M3.6 M3.7 ĐCD 839bp Hình 4.19: PCR-bò phát thịt bò hỗn hợp thịt xử lý nhiệt 130oC/30’(M6.1-M6.7) 180oC/15’ (M7.1-M7.7) 53 4.6.2.5 PCR-bò với bột thịt thị trường Thực PCR-bò với mẫu bột thịt thị trường Kết hình 4.20 cho thấy khơng phát thịt bò mẫu bột thịt khảo sát lad ĐCD 839bp Hình 4.20: PCR-bị với bột thịt thị trường 54 Chương KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Xây dựng quy trình PCR phát thịt trâu với forward primer reverse primer có trình tự sau 5’- CTACACATCCGACACAACAACAGC-3’, 5’- ATG TAGCAGGGGCATGAGAA-3’ Mẫu DNA biến tính 94oC phút sau khuếch đại qua 35 chu kỳ nhiệt; quy trình nhiệt cho chu kỳ 94oC/1’, 56oC/ 45’’, 72oC/1’ 72oC/5’ sau kết thúc 35 chu kỳ nhiệt Xây dựng quy trình PCR phát thịt bị với forward primer 5’- CTACAC ATCCGACACAACAACAGC-3’, reverse primer 5’-TCAGTAGGTCTGCTACT AGGGC -3’ Quy trình nhiệt sau: tiền biến tính 94oC/4’; 35 chu kỳ: biến tính 94oC/1’, bắt cặp 54oC/ 45’’, kéo dài 72oC/1’; kéo dài cuối 72oC/5’ Phân biệt loài thịt sản phẩm thịt chế biến phương pháp PCR bị ảnh hưởng thời gian, nhiệt độ, kích thước đoạn DNA mục tiêu 5.2 Đề nghị Kiểm tra độ đặc hiệu cặp primer F2&RBU2, F2&RC2 với nhiều loài khác Ứng dụng PCR-trâu, PCR-bò để khảo sát thêm nhiều hỗn hợp thịt chế biến nhiều mẫu bột thịt 55 TÀI LIỆU THAM KHẢO TIẾNG VIỆT Bùi Thị Cúc (2006), Tình hình xuất nhập động vật sản phẩm động vật Cục Thú y Hồ Huỳnh Thùy Dương (2002), Sinh học phân tử Nhà xuất Giáo dục Thành phố Hồ Chí Minh Hồ Thị Nguyệt Thu (2003), Chế biến thịt Giáo trình học tập trường Đại học Nông Lâm TP HCM Lương Quý Phương (2006), Sản xuất kit tách chiết DNA kit PCR phát gen halothan heo, Khóa luận tốt nghiệp kỹ sư công nghệ sinh học, Trường Đại học Nông Lâm TP HCM Lưu Phúc Lợi (2005), Bài giảng Sinh tin học, Đại học Nông Lâm TPHCM Nguyễn Ngọc Tuân, Lê Thanh Hiền (2004), Chế biến bảo quản thịt sữa, Nhà xuất Nông Nghiệp Tp Hồ Chí Minh, 163 trang Trịnh Thị Thanh Huyền (2007), Phân biệt loại thịt heo, bò, cừu phương pháp multiplex PCR, Khóa luận tốt nghiệp kỹ sư công nghệ sinh học, Trường Đại học Nông Lâm TP HCM TIẾNG NƯỚC NGOÀI Alberts B., Bray D., Lewis J., Raf M., Roberts K and Watson J.D (1994), Molecular Biology of the Cell (3rd ed.), Garland Publishing Inc, New York and London Arslan A., Ilhak O I Calicioglu M (2006), Effect of method of cooking on dentification of heat processed beef using polymerase chain reaction (PCR) technique, Meat Science 72: 326–330 10 Ashoor S H., Monte W G., Stiles P G (1998), Liquid chromatographic identification of meats, Journal of Association of Official Analytical Chemists 71:397–403 11 Behrens M., Untham., Brinkmann Y., Buchholz R., and Latus N (1999), Identification of Animal Species in Heated and Complex Meat Products Using Species Specific PCR Reactions, Fleischwirtsch 79: 97 – 100 56 12 Bellagamba F., Valfre F., Panseri S., & Moretti V M (2003), Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal, Journal of Food Protection 66(4): 682–685 13 Beneke B and Hagen M (1998), Applicability of PCR (Polymerase Chain Reaction) for the Detection of Animal Species in Heated Meat Products, Fleischwirts 78: 1016 – 1019 14 Bogenhagen D., Clayton D.A (1974) The number of mitochondrial deoxyribonucleic acid genomes in mouse L and human HeLa cells, Journal of Biological Chemistry 249:7791 15 Borgo R., Souty Grosset C., Bouchon & Gomot D L (1996), PCR-RFLP analysis of mitochondrial DNA for identification of quail meat species, Journal of Food Science 61: 1–4 16 Bossier P (1999), Authentication of seafood products by DNA pattern, Journal Food Science 64:1899–1993 17 Brodmann P D., Moor D (2003), Sensitive and semi quantitative TaqMan real time polymerase chain reaction systems for the detection of beef (Bos taurus) and the detection of the family mammalia in food and feed, Meat Science 65:599–607 18 Brodmann P D., Nicholas G., Schaltenbrand P., Ilg E C (2001), Identifying unknown game species: experience with nucleotide sequencing of the mitochondrial cytochrome b gene and a subsequent basic local alignment search tool search, European Food Research and Technology 212:491– 496 19 Burgener M., Hubner P (1998) Mitochondrial DNA enrichment for species identification and revolutionary analysis, Z Lebensm Unters Forsch 207:261–263 20 Carnegie P R., Illic M Z., Etheridge M.O., Collins M G (1983), Improved high performance liquid chromatographic method for analysis of histidine dipeptides anserine, camosine and balenine present in fresh meat, Journal of Chromatography 261:153–157 21 Chow S., Inogue S (1993), Intra- and Interspecifc Restriction Fragment Length Polymorphism in Mitochondrial Genes of Thun- nus Tuna Species, National Research Institute of Far Seas Fisheries 30: 207-224 57 22 Chung G.S., Lee M H., Kim J M., Park J M (1998), Differentiation the species of origin of meats on the basis of the contents of histidine dipeptides in muscle, Journal of Veterinary Science 40:1–6 23 Collins S.J., Lawson V A Masters C.L (2004), Transmissible spongiform encephalopathies, Lancet 363 (9402): 51–61 24 Colombo F., Viacava R., Giaretti M (2000), Differentiation of the species ostrich (Struthio camelus) and emu (Dromaius novaehollandiae) by polymerase chain reaction using an ostrich-specific primer pair, Meat Science 56:15–17 25 Cushwa W T., Medrano J F (1996), Applications of the random amplified polymorphic DNA (RAPD) assay for genetic analysis of livestock species, Animal Biotechnology 7:11–31 26 Dalmasso A., Fontanella E., Piatti P., Civera T., Rosati S., Bottero M.T (2004), A multiplex PCR assay for the identification of animal species in feedstuffs, Molecular and Cellular Probes 18: 81–87 27 Desmarais E., Lanneluc I., Lagne J (1998), Direct amplification of length polymorphism (DALP) or how to get and characterize new genetic markers in many species, Nucleic Acids Research 26:1458–1465 28 Ellen H., Hans T., Gottfried S (1964), Deoxyribonucleic Acid Associated with Yeast Mitochondria, Biochemical and Biophysical Research Communication 15: 127 - 132 29 Fairbrother K S., Hopwood A J., Lockley A K., Bardsley R G (1998) Meat speciation by restriction fragment length polymorphism analysis using an actin cDNA probe, Meat Science 50:105–114 30 Fairbrother K.S., Hopwood A.J., Lockley A.K and Bardsley R.G (1998) The Actin Multigene Family and Livestock Speciation Using the Polymerase Chain Reaction, Animal Biotechnology 9: 89 – 100 31 Fontaine K.M., Cooley J.R., Simon C (2007), Evidence for paternal leakage in hybrid periodical cicadas (Hemiptera: Magicicada spp.), PloS one 2(9): e892 32 Fukall L., Kas J (1989), The advantages of immunoassay in food analysis, Trends in Analytical Chemistry 8: 112 – 116 33 Guoli Z., Mingguang Z., Zhijiang Z., Hongsheng O., Qiang L (1999), 58 Establishment and application of a polymerase chain reaction for the identification of beef, Meat Science 51:233–236 34 Gyllesten, U B., Wharton, D., Josefsson, A and Wilson, A C (1991), Paternal inheritance of mitochodrial DNA in mice, Nature 352: 255-257 35 Haushi S., Basumatary R., Girish P S., Doley S., Bardoloi R K., Kumar A (2009), Identification of chicken, duck, pigeon and pig meat by speciesspecific markers of mitochondrial origin, Meat science Article in Press 36 Hayashi K (1996), PCR SSCP Single Strand Conformation Polymorphism Analysis of PCR Products, Laboratory Proto- cols for Mutation Detection (Landegren, U., ed.), Oxford University Press pp 14 – 22 37 Herman L (2000), Determination of the animal origin of raw food by speciesspecific PCR, Journal of Dairy Research 68:429–436 38 Hird H., J., Chisholm A.,Sanchez M., Hernandez R., Goodier K., Schneede C., Boltz and Popping B (2006), Effect of heat and pressure processing on DNA fragmentation and implications for the detection of meat using a realtime polymerase chain reaction, Food Additives and Contaminants 23:645–650 39 Hitchcock C H S (1998), Immunoassays for veterinary and food analysis, Elsevier Applied Science Publishers Ltd., London, New York, p3 40 Hoeh W.R., Blakley K.H., Brown W.M (1991), Heteroplasmy suggests limited biparental inheritance of Mytilus mitochondrial DNA, Science 251:1488– 1490 41 Hofmann K (1997), Nachweis der Tierart bei Fleisch und Fleischerzeugnissen, Mitteilung Fleischwirtschaft 77 (2):151-154 In: Detection of meat of different animal species in meat products P Review of applicable methods Mieso i Wedliny 1998, 3, 74-79 [in Polish] 42 Holland P M., Abramson R D., Watson R., Gelfand D H (1991), Detection of specific polymerase chain reaction product by utilization the 5_ to 3_ exonuclease activity of Thermus aquaticus, Proceedings of the National Academy of Sciences USA 88:7276–7280 43 Hong W., Gao D B., Zhang A H., Pan W Q., Lian, C Z L (2004), Multiplex Polymerase Chain Reaction Method for Detection of Bovine Materials in Foodstuffs, Journal of Association of Official Analytical Chemists 59 International 86(4): 764-767 44 Hopwood A.J., Fairbrother K.S., Lockley A.K and Bardsley R.G (1999), An Actin Gene-Related Polymerase Chain Reaction (PCR) Test for Identification of Chicken in Meat Mixtures, Meat Science 53: 227 – 231 45 Hsieh H.M., Chiang H.L., Tsai L.C., Lai S.Y., Huang N.E., Linacre A., Lee J.C.I (2001), Cytochrome b gene for species identification of the conservation animals, Forensic Science International 122: 7-18 46 Hsing M H., Chin C T., Li C T., Hsiao L C., Nu E H., Rocky T P S., Adrian L., James C L (2005), Species identification of meat products using the cytochrome b gene, Forensic science Journal 4: 29-36 47 Hui Y H (2006), Handbook of Food science technology and engineering, CRC Press Taylor & Francis Group 48 Irfan O I (2007), Identification of meat species by polymerase chain reaction (PCR) teachnique, Turkish Journal of Veterinary and Animal Sciences 31(3): 159-163 49 Irwin D.M., Kocher T.D., Wilson A.C (1991), Evolution of the cytochrome b gene of mammals, Journal of Molecular Evolution 32: 128-44 50 Kesmen Z., Sahin F., Yetim H (2007), PCR assay for the identification of animal species in cooked sausages, Meat Science 77: 649–653 51 Kocher T D., Thomas W K., Meyer A., Edwards S V., Paabo S., Villablanca F X., et al (1989), Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing of conserved primers, Proceedings of the National Academy Sciences of the United States of America 86: 6196-200 52 Koh M C., Lim C H., Chua S B., Chew S T., Phang S T W (1998), Random amplified polymorphic DNA (RAPD) fingerprints for identification of red meat animal species, Meat Science 48:275–285 53 Kondo R., Matsuura E.T., Chigusa S.I (1992), Further observation of paternal transmission of Drosophila mitochondrial DNA by PCR selective amplification method, Genetical Research 59 (2): 81–4) 54 Kremar P and Rencova E (2003), Identification of species specific DNA in feedstuffs Journal of Agricultural and Food Chemistry, 51(26): 76557658 60 55 Lahiff S., Glennon M., Lyng J., Smith T, Shilton N., Maher M (2002), Real-time polymerase chain reaction detection of bovine DNA in meat and bone meal samples, Journal of Food Protection 65:1158–1165 56 Laube L., Spiegelberg A., Butschke A., Zagon J., Schauzu M., Kroh L., Broll H., (2003), Methods for the detection of beef and pork in foods using real-time polymerase chain reaction, International Journal of Food Science & Technology 38:111–118 57 Lee J.C.I and Chang J.G (1994), Random Amplified Poly-morphic DNA Polymerase Chain Reaction (RAPD PCR) Finger-prints in Forensic Species Identification, Forensic Science International 67: 103 – 107 58 Lockley A K., Bardsley R G (2000), DNA-based methods for food authentication, Trends in Food Science & Technology 11: 67 – 77 59 Maede, D (2006), A strategy for molecular species detection in meat and meat products by PCR-RFLP and DNA sequencing using mitochondrial and chromosomal genetic sequences, European Food Research and Technology 224(2): 209–217 60 Martin, I., Garcia T., Fajardo V., Lopez-Calleja I., Hernández P E., Gonzalez I., and Martín R (2007), Species-specific PCR for the identification of ruminant species in feedstuffs, Meat Science 75:120–127 61 Martinez I (1997), DNA typing of fish products for species identification In: Seafood from Product to Consumer: Integrated Approach to Quality, J Luten, T Borresen, J Oehlenschlager (eds.) Amsterdam: Elsevier Science 497–506 62 Martinez I., Yman M (1999), Species identification in meat products by RAPD analysis, Food Research International 31:459–466 63 Matsunaga T., Chikuni K., Tanabe R., Muroya S., Shibata K., Yamad J., Shinmura Y (1999), A quick and simple method for the identification of meat species cow meat product by PCR assay, Meat Science 51: 143-148 64 McPherson M J and Moller S G (2006), PCR Taylor and Francis Group 65 Meusel M.S., Moritz R.F (1993), Transfer of paternal mitochondrial DNA during fertilization of honeybee (Apis mellifera L.) eggs, Cureent Genetics 24 (6): 539–43) 61 66 Meyer R., Candrian U and Luethy J (1994), Detection of Pork in Heated Meat Products by Polymerase Chain Reaction (PCR), Journal AOAC International 77: 617 – 622 67 Meyer R., Hoefelein C., Luethy J., & Candrian U (1995), Polymerase chain reaction-restriction fragment length polymorphism analysis: a simple method for species identification in food, Journal of Association of Official Analytical Chemists International 78: 1542–1551 68 Michael A I., David H G (1990), PCR protocol: A guide to methods and application, Academic Press, San Diego, CA p 3-12 69 Michele L (2003), Food authenticity traceability, Woodhead Publishing Limited Abington Hall, Abington Cambridge CB1 6AH England 70 Miguel A R., Teresa G., Isabel G., Luis A., Pablo E H and Rosario M (2004), PCR identification of beef, sheep, goat and pork in raw and heat treated meat mixtures, Journal of Food Protection 67: 172-77 71 Minkiewicz P., Dziuba J., Nałecz D (2000), Modern methods of separation and research of peptides structure and proteins of food, Przem Spo 12: 34-37 72 Montiel-Sosa J.F., Ruiz E., Montoya J., Roncales P., Lopez-Perez M.J., PerezMartos A (2000), Direct and highly species-specific detection of pork meat and fat in meat products by PCR amplification of mitochondrial DNA, Journal of Agricultural and Food Chemistry 48(7):2829-2832 73 Murray B W., McClymont R A., & Strobeck C (1995), Forensic identification of ungulate species using restriction fragment digests of PCR amplified mitochondrial DNA, Journal of Forensic Science 40: 943–951 74 Nass M.M., Nass S (1963), Intramitochondrial Fibers with DNA characteristics, Journal of Cell Biology 593–629 75 Partis L., Croan D., Guo Z., Clark R., Coldham T and Murby J (2000), Evaluation of a DNA Fingerprinting Method for Determining the Species of Origin of Meats, Meat Science 54: 369 – 376 76 Pascoal A., Prado M., Calo P., Cepeda A., & Barros-Velazquez J (2005), Detection of bovine DNA in raw and heat-processed foodstuffs, commercial foods and specific risk materials by a novel specific polymerase chain reaction method, European Food Research and 62 Technology 220(3–4): 444–450 77 Penman & Danny (2002), Mitochondria can be inherited from both parents, NewScientist.com 5/2/2008 78 Pyz L R (1998), Methods of species identification of meat, Med Wet 54 (11): 732-736 [in Polish] 79 Rea S., Chikuni K., Avellini P (1996), Possibility of using single strand conformation polymorphism (SSCP) analysis for discriminating European pig and wild boar meat samples, Italian Journal of Food Science 3:211– 220 80 Roa K.B.C.A., Bhat V and Totey S.M (1996), Detection of Species-Specific Genetic Markers in Farm Animals Through Random Amplified Polymorphic DNA (RAPD), Genetic Analysis: Biomolecular Engineering 13: 135 – 138 81 Rodriguez M A., Garcia T., Gonzalez I., Asensio L., Mayoral B., Lopez-Calleja I., Hernandez P E., Martin R (2003), Identification of goose, mule duck, turkey, and swine in foie grass by species-specific polymerase chain reaction, Journal of agriculture and food chemistry 51:1524–1529 82 Saeed T., Ali S G., Rahman H A.A., Sawaya W N (1989), Detection of pork and lard as adulterants in processed meat: Liquid chromatographic analysis of derivatized triglycerides, Journal - Association of Official Analytical Chemists 72:921–925, 1989 83 Saez R., Sanz Y., Toldra F (2004), PCR-based fingerprinting techniques for rapid detection of animal species in meat products, Meat Science 66:659– 665 84 Sambrook J., Russell W D (2001), Molecular cloning (A laboratory manual)Cold Spring Harbor laboratory press, New York, USA 85 Sawyer M., Rensen G., Smith W., Yee M., Wong A., Osburn B., Cullor J (1997), Overcoming RNA inhibition in the fluorescent polymerse chain reaction assay to enhance detection of bovine DNA in cattle feeds, Department of Population Health and Reproduction, School of Veterinary Medicine, University of California 86 Sutovsky, P., et Al (1999), Ubiquitin tag for sperm mitochondria Nature 402: 63 371–372 87 Tajima K., Enishi O., Amari M., Mitsumori M., Kajikawa H., Kurihara M., Yanai S., Matsui H., Yasue H., Mitsuhashi T., Kawashima T., Matsumoto M (2002), PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements, Bioscience, Biotechnology, and Biochemistry 66(10):2247–2250 88 Tartaglia M., Saulle E., Pestalozza S., Morelli L., Antonucci G., Battaglia P.(1998), Detection of bovine mitochondrial DNA in ruminant feeds: A molecular approach to test for the presence of bovine-derived materials, Journal of Food Protection 61:513–518 89 Too H P (2001), Demystifying the new genetics, Molecular aspects of biomedical sciences, Biochemistry Department, Faculty of medicine, National University of Singapore 244 pages 90 Toorop R M., Murch S J., Ball R O (1997), Development of a rapid and accurate method for separation and quantification of myofibrillar proteins in meat, Food Research International 30:619–627 91 Verbeke R., Brabander H D (1985), Differentiation of meat species in processed meat products through identification of animal fat species, Biochemical Identification of Meat Species, R L S Patterson (ed.) New York: Elsevier Science Publishing, Inc pp 145–154 92 Wallace R.B., Shaffer J., Murphy R.F., Bonner J., Hirose T., Itakura K (1979), Hybridization of synthetic oligodeoxyribonucleotides to phi chi 174 DNA: the effect of single base pair mismatch, Nucleic Acids Research 6: 35433557 93 Wayne R.K., Geffen E., Girman D.J., Koepfli K.P., Lau L.M., Marshall C.R (1997), Molecular systematics of the Canidae Syst Biol 46(4):622-53 94 Weighardt F (2004), The analysis of food samples for the presence of genetically modified organisms, Session 10 “Quantitative PCR for the detection of GMOs”, European Commission Joint Research Centre, 19 pages 95 Wiesner R.J., Ruegg J.C., Morano I (1992), Counting target molecules by exponential polymerase chain reaction, copy number of mitochondrial DNA in rat tissues, Biochimistry Biophysica Acta 183: 553–559 96 Wolf C., Rentsch J and Huebner P.(1999), PCR-RFLP Analysis of 64 Mitochondrial DNA: A Reliable Method for Species Identification, Journal of Agricultural and Food Chemistry 47:1350 – 1355 97 Zouros E., Freeman K R., Ball A O and Pogson G H (1992), Direct evidence for extensive paternal mitochondrial DNA inheritance in the marine mussel Mytilus, Nature 359: 412-414 TRANG WEB 98 http://archive.food.gov.uk 99 http://www.cucthuy.gov.vn/index.php?option=com_content&task=view&id=182 &Itemid=65 100 http://www.ncbi.nlm.nih.gov 101 http://align.genome.jp 102 http://www.thuvienkhoahoc.com 103 http://www.mitomap.org/MITOMAP/mitomapgenome 104 Protocol online: http://www.protocol-online.org/prot/Molecular-Biology/PCR/ Multiplex- PCR 105 http://www.vcn.vnn.vn/PrintPreview.aspx?ID=4227 106 http://www.biocenter.helsinki.fi/bi/Programs/download.htm 107 http://www.biocenter.helsinki.fi/bi/Programs/manual.htm 65 PHỤ LỤC VỊ TRÍ CÁC PRIMER THIẾT KẾ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATGACCAACATCCGAAAATCCCACCCACTAATAAAAATTCTAAACAATGC ATGACTAACATTCGAAAGTCCCACCCACTAATAAAAATTGTAAACAATGC ***** ***** *****.********************* ********** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATTCATTGACCTCCCTGCTCCATCAAACATCTCATCATGATGAAACTTTG 100 ATTCATCGACCTTCCAGCCCCATCAAACATTTCATCATGATGAAATTTCG ****** ***** **:** *********** ************** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GCTCTCTCCTAGGCATCTGCCTAATCCTGCAAATCCTCACCGGCCTATTC GTTCCCTCCTGGGAATCTGCCTAATCCTACAAATCCTCACAGGCCTATTC * ** *****.**.**************.***********.********* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ F2 CTAGCAATACACTACACATCCGACACAACAACAGCATTCTCCTCCGTCGC 200 CTAGCAATACACTACACATCCGACACAACAACAGCATTCTCCTCTGTTAC ******************************************** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CCACATCTGCCGGGACGTGAACTATGGATGAATTATTCGATACATACACG CCATATCTGCCGAGACGTGAACTACGGCTGAATCATCCGATACATACACG *** ********.*********** **.***** ** ************* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CAAACGGAGCTTCAATATTTTTCATCTGCTTATATATACACGTAGGACGA 300 CAAACGGAGCTTCAATGTTTTTTATCTGCTTATATATGCACGTAGGACGA ****************.***** **************.************ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGCATATACTACGGATCATATACCTTTCTAGAAACATGAAACATCGGAGT GGCTTATATTACGGGTCTTACACTTTTCTAGAAACATGAAATATTGGAGT ***:**** *****.**:** ** ***************** ** ***** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ F1 AATCCTACTATTCGCAGTAATAGCCACAGCATTTATAGGATACGTACTGC 400 AATCCTTCTGCTCACAGTAATAGCCACAGCATTTATAGGATACGTCCTAC ******:** **.*******************************.**.* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ cggcacaaatttagtcgaatgaatctgag Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CATGAGGACAAATATCATTCTGAGGGGCAACAGTCATCACCAACCTTCTC CATGAGGACAAATATCATTCTGAGGAGCAACAGTCATCACCAACCTCTTA *************************.******************** * TCAGCAATCCCATACATTGGTACAAGTCTGGTTGAATGAATTTGAGGGGG 500 RC1 TCAGCAATCCCATACATCGGCACAAATTTAGTCGAATGAATCTGAGGCGG ***************** ** ****.* *.** ******** ***** ** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ ATTCTCAGTAGACAAAGCAACCCTCACCCGATTCTTCGCATTTCACTTCA ATTCTCAGTAGACAAAGCAACCCTTACCCGATTCTTCGCTTTCCATTTTA ************************ **************:** ** ** * Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TCCTCCCATTCATTATCGCAGCACTTGCAATAGTCCACCTATTATTTCTC 600 TCCTTCCATTCATCATCATAGCAATTGCCATAGTCCACCTACTATTCCTC **** ******** *** ****.****.************ **** *** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CACGAAACAGGATCCAACAACCCAACAGGAATCTCATCAGACACAGACAA CACGAAACAGGCTCCAACAACCCAACAGGAATTTCCTCAGACGTAGACAA ***********.******************** **.****** ****** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ AATCCCATTCCACCCCTATTACACCATTAAAGACATCCTAGGCGCCCTAC 700 AATCCCATTCCACCCCTACTATACCATTAAGGACATCTTAGGGGCCCTCT ****************** ** ********.****** **** ***** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TATTAATCCTAGCCCTAATACTATTAGTACTATTCGCACCCGACCTCCTC TACTAATTCTAGCTCTAATACTACTAGTACTATTCGCACCCGACCTCCTC ** **** ***** ********* ************************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGGGACCCAGACAACTACACCCCAGCAAACCCACTCAACACACCTCCCCA 800 GGAGACCCAGATAACTACACCCCAGCCAATCCACTCAACACACCCCCTCA **.******** **************.** ************** ** ** Trau-gi|1813366|dbj|D82894.1|_RBU1 Bo-gi|58489534|gb|AY885304.1|_ CATCAAGCCTGAATGGTACTTCCTATTCGCATACGCAATCTTACGATCAA CATCAAACCCGAGTGATACTTCTTATTTGCATACGCAATCTTACGATCAA ******.** **.**.****** **** ********************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ TTCCTAACAAACTAGGAGGGGTTCTAGCCCTAGTTCTCTCTATCCTAATC 900 TCCCCAACAAACTAGGAGGAGTACTAGCCCTAGCCTTCTCTATCCTAATT * ** **************.**:********** ************* 66 Trau-gi|1813366|dbj|D82894.1| RBU2 Bo-gi|58489534|gb|AY885304.1|_ Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CTCATTCTCATGCCCCTGCTACATACATCCAAACAACGAAGTATGATGTT CTTGCTCTAATCCCCCTACTACACACCTCCAAACAACGAAGCATAATATT ** ***.** *****.***** **.************** **.**.** CCGGCCATTCAGCCAATGCCTATTCTGAATTCTAGTAGCAAACCTGCTAA 1000 RC2 CCGACCACTCAGCCAATGCCTATTCTGAGCCCTAGTAGCAGACCTACTGA ***.*** ******************** *********.****.**.* Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ CACTCACATGGATTGGAGGACAGCCAGTCGAACACCCATATATTATCATT CACTCACATGAATTGGAGGACAACCAGTCGAACACCCATATATCACCATC **********.***********.******************** * *** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ GGACAACTAGCATCTATCACATACTTCCTCCTCATCCTAGTGCTAATACC GGACAACTAGCATCTGTCCTATACTTTCTCCTCATCCTAGTGCTAATACC ***************.** ****** *********************** Trau-gi|1813366|dbj|D82894.1|_ Bo-gi|58489534|gb|AY885304.1|_ AACGGCCAGCATAATCGAAAATAATCTCTTAAAATGAAGA AACGGCCGGCACAATCGAAAACAAATTACTAAAATGAAGA *******.*** ********* **: * *********** ... DNA trâu thấp mà PCR -trâu phát 0,001 ng/μl Tỷ lệ DNA thịt trâu thấp hỗn hợp DNA giảm dần trâu, bò, dê, cừu mà PCR -trâu phát 0,1% Tỷ lệ thịt trâu thấp mà PCR -trâu phát hỗn hợp thịt giảm dần trâu, ... thịt trâu thịt bị 3.2.1.2 Xác định quy trình PCR -trâu phát thịt trâu 3.2.1.3 Xác định quy trình PCR- bị phát thịt bị 3.2.2 Ứng dụng quy trình PCR- trâu, PCR- bị Khảo sát quy trình PCR- trâu, PCR- ... bột thịt 37 - Chuẩn bị mẫu: Thịt tươi, thịt chế biến, bột thịt - Ly trích DNA Xây dựng quy trình PCR -trâu, PCR- bị PCR -trâu, PCR- bị Ứng dụng quy trình PCR -trâu, PCR- bị hỗn hợp DNA từ: Thịt tươi Thịt