1. Trang chủ
  2. » Giáo Dục - Đào Tạo

NGHIÊN cứu BỆNH GUMBORO TRÊN GÀ TẠI một số TỈNH ĐỒNG BẰNG SÔNG cửu LONG tt tiếng anh

26 100 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 26
Dung lượng 520,08 KB

Nội dung

MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY SUMMARY OF DOCTOR THESIS Major: PATHOLOGY AND TREATMENT OF ANIMALS Major code: 62640102 PhD student: NGO PHU CUONG STUDY ON CHICKEN GUMBORO DISEASE IN SOME PROVINCES OF THE MEKONG DELTA Can Tho, 2019 THESIS WAS COMPLETELY CONDUCTED AT CAN THO UNIVERSITY Scientific Supervisor: Assoc Prof TRAN NGOC BICH Thesis was defened with the doctoral thesis examinination committee of Can Tho University Meeting at: ………………………………, Can Tho University At … … … date … month … year … Opponent 1: Opponent 2: Thesis can be found at the library: Learning Resource Center, Can Tho University National Library of Vietnam LIST OF PUBLISHED SCIENTIFIC RESEARCH Ngô Phú Cường Trần Ngọc Bích, 2018 Epidemiological characteristics of chicken Gumboro disease in the Mekong Delta ISSN 1859-2333 Can Tho University Journal of Science, 54(4B): 40 – 44 Ngo Phu Cuong, Tran Ngoc Bich, and Tran Trung Tin, 2018 Some epidemiological characteristics of Gumboro disease in household chickens in provinces of the Mekong Delta ISSN 1859 – 4581 Science and Technology Journal of Agriculture and Rural Development, 21(1): 64 – 69 Ngo Phu Cuong, Le Thi Kim Xuyen, Le Thanh Hoa and Tran Ngoc Bich, 2018 Analysis of characteristic molecular and pedigree of virulent Gumboro virus strains isolated in 20172018 in Ben Tre and Vinh Long National Conference on Biotechnology 2018, 485-490 National Conference on Biotechnology 2018, Ha Noi Workshop on Science and Technology of Veterinary Medicine 2018, Hai Duong Chapter 1: INTRODUCTION 1.1 The importance of thesis Gumboro disease has been one of the avian diseases causing the huge economic loss for the poultry industry in many provinces of Vietnam for a long time Recently, Gumboro disease shows different mutant strains belonged to serotype I and II; among them, serotype I has a high virulence and pathogenicity (OIE, 2008) In Vietnam, Gumboro disease was officially found from the 1980s based on clinical symptoms, lesions, and epidemiology Isolated IBDV with different genotypes and phenotypes coexist causing the disease progress complicated and difficult for achieving the effective treatment with vaccination (Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a) The research of Ho Thi Viet Thu (2012a) indicated that Gumboro disease usually outbreaks in the flocks without vaccination (70,0%), following by one-time vaccinated chicken (62,5%) and two-time vaccinated chicken (28,6%) In Vietnam, as well as in the Mekong Delta, Gumboro virus is diverse and complicated because of importing chicken breeds from many countries on the world Moreover, IBDV with various genotypes and phenotypes makes the disease more severe and less effective in treatment by the vaccine Therefore, the thesis named “Study on chicken Gumboro disease in some provinces of the Mekong Delta” was conducted 1.2 The aim of research - Determining the prevalence of Gumboro virus in chickens raised in farms, households in the Mekong Delta The related factors such as breeds, ages, vaccinated times, raising methods, death chickens… and some clinical symptoms in the suspicious infected flocks were included - Determining the genetic characteristic of the Gumboro virus isolated in the Mekong Delta Comparing the gene encoding VP2 region with the gene bank, commercial vaccine strains, and creating the genetic dendrogram of virus in the field - Surveying the ratio of immune response and the difference in the immune response of three Gumboro vaccines in chicken breeds (Ben Tre “Noi” and Luong Phuong) 1.3 The meaning and practice of thesis Gumboro disease is an acute infectious disease caused by the virus in the poultry (mainly in chicken and turkey), considering as the classical disease of the poultry industry There are many studies on this disease, virus, and preventive vaccines; however, this disease still outbreaks Immunodeficiency significantly affects the preventive efficiency of many vaccination campaigns in chickens as well as increases the sensitivity of chickens to other opportunistic pathogens Some evidence indicated that IBDV infected chicken flocks could become the host to transmitted other pathogenic viruses (Pham Hong Son et al., 2012; Ho Thi Viet Thu, 2012a) Recent reports reveal that IBDV has been one of the important pathogens causing the enormous economic loss for the poultry industry IBDV isolated strains harbor different genotypes and phenotypes to lead the disease complex and difficult in the effective treatment with the vaccine (Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a) IBDV’effective prevention contributes to the general health of chicken flocks and decreases economic loss Research for vaccine production based on the sequence of genetic nucleotides from IBDV isolated in the field has been conducted domestically and internationally However, up to now, in the Mekong Delta, the information of decoding the VP2 region in Gumboro virus was still limited Therefore, the nucleotide decryption of Gumboro virus isolated in the field was necessary for determining the pathogenic level, suitable vaccine selection to prevent Gumboro disease in chicken flocks, and increasing the economic efficiency of the poultry industry 1.4 The new of thesis By collecting virus strains causing Gumboro disease in the field of some provinces in the Mekong Delta, comparing the modification of gene sequence, the antigen and pathogenicity, the resource and genetic relationship of virus strains, it helps us to select the suitable vaccine strains to prevent this disease effectively On the other hand, it contributes to set up a reliable scientific basis for developing the preventive strategy against the IBD disease in the Mekong Delta and saving the health of chicken flocks in Vietnam Chapter 2: RESEARCH CONTENTS AND METHODS 2.1 Research contents, research time, and research places 2.1.1 Nội dung nghiên cứu Content 1: Study on the prevalence of chicken Gumboro disease in the Mekong Delta Content 2: Study on the genetic characteristics of Gumboro virus isolated in the Mekong Delta Content 3: Study on the immune response of three Gumboro vaccines selected from the result of Content towards two chicken breeds (Ben Tre “Noi” and Luong Phuong) 2.1.2 Research time: from 10/2015 to 10/2018 2.1.3 Research places Research was carried out in provinces of the Mekong Delta, including Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh About the poultry farming, these provinces have developed both raising methods: industrial chickens in big farms and household chickens They are relatively representative of the poultry production in the Mekong Delta For storage and examination of specimens, chicken sera: Department of Veterinary Medicine, College of Agriculture, Can Tho University For running RT – PCR: Institute of Biotechnology – Vietnam Academy of Science and Technology, Ha Noi For analyzing the sequence of VP2 genes from Gumboro virus in the field: Macrogen Company, Korea For setting the layout of investigated experiments about the immune response of Gumboro vaccines towards two chicken breeds (Ben Tre “Noi” and Luong Phuong): Dong Thap province 2.2 Research facilities Tools: sample bags, ml syringe, cotton, gloves, distilled tubes, tube racks, cool box, serum tube, micropipete, falcon tube, scissors, lancet Other important facilities: refrigerator, -20oC freezer, -80oC freezer, vortex, balance, UV-VIS spectrometer, centrifuge, PCR thermocycler, electrophoresis box, Gel doc Direct ELISA kit: IBDV Ag Test (originated from belgium) delivered from Thoi Dai Xanh company Indirect ELISA kit: IBDV Ab Test, Thinh A company 2.2.3 Research object 2.2.3.1 Content - All chickens were raised in Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh - No of examined chicken flocks: 131 flocks 2.2.3.2 Content - Fabricius specimens were collect from suspicious chicken flocks infected with Gumboro disease (Content 1) - The nucleotides sequence of VP2 genes from Gumboro virus collected in Ben Tre, Hau Giang, An Giang, Can Tho, Vinh Long, Tra Vinh 2.2.3.3 Content Experimental chickens were raised at the households in Dong Thap Ben Tre “Noi” chicks at a one-day age were bought from the local hatchery company Luong Phuong chicks at a one-day age were bought from Nong Nghiep Tri Viet L.L.C Chicks were vaccinated to prevent Marek disease before supplying for the farmers Experimental chickens were fully captive to ensure the hygiene livestock environment, nutrition source, caring, and vaccination in regular 2.3 Research method 2.3.1 Content 2.3.1.1 Method of the survey on the prevalence of chicken Gumboro disease in househols/farms Chicken breeds were mainly surveyed including hybrid “Noi”, Tau vang, Binh Dinh, Luong Phuong in raising methods: free grazing, halfgrazing, and captivity (Table 2.1) Table 2.1: The number of examined chicken flocks in the Mekong Delta No Province No of examined flocks Ben Tre 26 Hau Giang 15 Can Thơ 14 Tra Vinh 19 Vinh Long 28 Total An Giang 29 131 2.3.1.2 Method of the survey on the characteristic symptoms and lesions in the suspicious infected chicken flocks Information collection: recording the related information about the chicken flocks using the questionnaire, when the disease was announced Chickens infected Gumboro disease show the symptoms and lesions such as moodiness, withdrawing their beaks in the wings, falling to one side, lying down, half-closed eyes, stocking in the corner, picky or skip eating, drinking much, disorientation, white stools, loose or watery stools with blood, swollen or hemorrhagic Fabricius bursa, hemorrhagic in chest 2.3.1.3 Method of the Gumboro virus detection The suspicious infected chicken flocks with Gumboro disease were examined clinical symptoms and collected feces by using kit IBDV Ag Test (originated from Belgium) delivered by Thoi Dai Xanh company 2.3.2 Content 2.3.2.1 Method of detection of VP2 gene from Gumboro virus isolated in the field - Step 1: Selection of samples - Step 2: Extraction of ARN from samples A pair of primer using for RT-PCR: forward GVF: 5’ CAAACGATCGCAGCGATGACAAACCTGCAAGAT 3’ and reverse GVR: 5’ GGCTTCAAAGACATAATTCGGGCC 3’ Amplification of gene at “hypervariable region” with molecular weight: 0.47 kb - Step 3: Synthetic of c.DNA from ARN by using Themor kit - Step 4: Running PCR with c DNA - Step 5: Electrophoresis PCR products on agarose gel 2%, at 75V, 50 to check the amplification of gene 2.3.2.2 Method of decryption of the nucleotide sequence of VP2 gene and determination of pathogenicity of Gumboro virus After detection of the VP2 gene from Gumboro virus isolated in the field, ta total of 10 virus samples, which were good quality, bright DNA bands, single bands (marked for each province) were selected to analyze the homogeneous gene The sequence of VP2 gene was decoded in Macrogen Company, Korea The nucleotide sequence of VP2 gene was compared by using GENDOC2.7 software (http://www.nrbsc.org/gfx/gendoc/) 2.3.2.3 Method of comparison and creation of the genetic dendrogram from Gumboro virus isolated in the field with the gene bank and vaccine strains used in the Mekong Delta Access on the Gene bank to get the information of Gumboro virus strains which were announced in Vietnam and on the world, as well as in the Mekong Delta Table 2.2: List of virus Gumboro strains and vaccine strains in the Gene bank used in this research Registered Isolated *Country Pathogenic No Strain code code year group GTN FJ842498 2003 Vietnam vv GHUT12 FJ842493 2003 Vietnam vv GPT FJ842495 2002 Vietnam vv GT1ST DQ355815 2003 Vietnam vv GTG25 DQ355818 2003 Vietnam vv GTG FJ842499 2003 Vietnam vv HuN11 LM651367 China vv YS07 FJ695138 2007 China vv 9109 AY462027 2001 USA av 10 variantE AF133904 USA av 11 GLS AY368653 USA av 12 IM AY029166 USA av 13 STC D00499 USA av 14 Cu-1wt AF362747 Germany av 15 HN04 KC109816 2011 China at 16 D78 AF499929 Luxembourg at 17 HZ2 AF321054 1997 China at 18 JD1 AF321055 1997 China at 19 903-78 JQ411012 1978 Hungary at 20 IBD BLEN AY332560 USA av 21 BUR-706 EU544156 Brazil at 22 Cevac EU544158 Hungary at 23 Georgia KF573194 India at 24 Nobilis AJ586966 Netherland av vv: very virulent; av: antigenic variant; at: attenuated During the survey, vaccine brandnames were frequently used including IBD Blen, Bur 706, Ceve Gumboro, Georgia, Nobilis; therefore, they are applied in this research: - Vaccine 1: IBD BLEN (MERIAL – USA) - Vaccine 2: BUR 706 (MERIAL – France) - Vaccine 3: Cevac Gumboro L (Hungary) - Vaccine 4: Georgia (India) - Vaccine 5: Nobilis (MSD – Netherland) 2.3.3 Content 2.3.3.1 Method of survey on the immune response of Gumboro vaccines on Ben Tre “Noi” and Luong Phuong chickens a Experimental henhouses The henhouses were the soil-floor with an area of 3.5 m2 prepared before stocking The floor was covered with a layer of sand about 20 cm thick, 15 - 20 cm thick of rice husk on the paddled layer; the roof is made of nipa leaves It were fenced with B40 net around, and covered with canvas to avoid drafts with a feeding light and feeder system for chickens Cages, breeding equipment were disinfected before putting chickens into the experimental henhouses b Experimental arrangment The experiment were arranged in a completely random block with experiments and replicates (Table 2.3) Each experiment was 30 chickens/tratment At day-old, chicks were collected the heart blood to check the maternal antibodies; thus, a total of 60 chicks were used Chickens were continuously raised in the experiments to collect the vein blood of wings The total of chickens were used: experiment x breeds x replicates = 720 chickens Table 2.3: Experimental arrangement No of chickens used in the No of experiment (chickens) Breed replicates EX1 EX2 EX3 EX4 Ben Tre “Noi” times 30 30 30 30 Luong Phuong times 30 30 30 30 EX1: the control treatment (without vaccination); EX2: IBD BLEN (MERIAL – USA); EX3: Cevac Gumboro L (Hungary); EX4: Nobilis (MSD – Netherland) - The difference of immune response between chicken breeds, used vaccine, and vaccination times 2.5 Data analysis The experimental data were analyzed by using the Excel software The statistics and variance were analyzed by using Minitab 16 The comparison of the experimental avergaes were examined by Chi-Square and Tukey method of Minitab 16 Chapter 3: RESULTS AND DISCUSSIONS 3.1 Content 1: Survey on the prevalence of chicken Gumboro disease in some provinces of the Mekong Delta 3.1.1 Characteristics of chicken flocks infected Gumboro disease 3.1.1.1 The ratio of Gumboro infected chicken flocks among chicken breeds Table 3.1: The ratio of Gumboro infected chicken flocks among chicken breeds Suspicious Percentage Breed Infected flocks infected flocks (%) Hybrid “Noi” 52 15 28,8 Tau Vang 19 13 68,4 Binh Dinh 31 17 54,8 Luong Phuong 29 14 48,3 Total 131 59 45,0 P = 0,012 The suspicious Guboro infected flocks showed the symptoms: ruffled feathers, moodiness, drinking much, less or skip eating, white-stools diarrhea, stocking in the corner, increasing temperature before falling down The feces were collected to examine the infected flocks by using the IBDV Ag Test kit (Thoi Dai Xanh Company) The results of Table 3.1 showed that the infected chicken flocks were respective in each chicken breeds as 15 flocks of hybrid “Noi”, 14 flocks of Luong Phuong, 13 flocks of Tau Vang, and 17 flocks of Binh Dinh The total rate of infected chicken flocks was 45% The ratio of infected chickens was significantly different among chicken breeds (P0,05) On the other hand, the immune response of chickens vaccinated times were higher than in chickens vaccinated time; it was significantly different (P=0,001) Table 3.15: The difference of the immune response in chickens at and 28 days old by using different vaccines Vaccine Vaccine No of chickens No of chickens having antibodies Percent -age (%) No of chickens No of chickens having antibodies Percent -age (%) No of chickens No of chickens having antibodies Percent -age (%) time 60 36 60,0 60 38 63,3 60 38 63,3 times 60 48 80,0 60 52 86,7 60 56 93,3 Vaccination times Vaccine P = 0,887 Vaccine 1: IBD BLEN; Vaccine 2: Cevac Gumboro L; Vaccine 3: Nobilis The results of Table 3.15 showed that all vaccines cause the immune response to chickens after vaccination Chickens vaccinated one time had the same immune response towards used vaccine (60,0% – 63,3%) (P>0,05) Chickens vaccinated two times had the most immune response with vaccine (93,3%), and the least ones with vaccine (80,0%); however, this difference was not statiscal significance (P>0,05) 23 Table 3.16: The difference of the immune response by used vaccines and chicken breeds Vaccine Breed Nòi Bến Tre Lương Phượng Vaccin -ation times No of chickens No of chickens having antibodies Lần Lần Lần Lần 30 30 30 30 20 26 16 22 Vaccine Percentage (%) No of chickens No of chickens having antibodies 66,7 86,7 53,3 73,3 30 30 30 30 20 27 18 25 Vaccine Percentage (%) No of chickens No of chickens having antibodies Percentage (%) 66,7 90,0 60,0 83,3 30 30 30 30 20 27 18 29 66,7 90,0 60,0 96,7 Vaccine 1: IBD BLEN; Vaccine 2: Cevac Gumboro L;Vaccine 3: Nobilis 1st vaccination at days old; 2nd vaccination at 28 days old The experiment of vaccines with chicken breeds (Ben Tre “Noi”, Luong Phuong) was shown in Table 3.16 Ben Tre “Noi” chickens had a higher immune response than Luong Phuong chickens had at both vaccinated times Vaccine caused the highest immune response in chicken breeds and vaccinated times, and vaccine was the least ones Chapter 4: CONCLUSIONS AND SUGGESTIONS 4.1 Conclusions The infected rate of chicken Gumboro disease in the Mekong Delta was the highest in Tau vang chickens (68,4%), and the lowest in hybrid “Noi” chickens (28,8%) This disease usually occurs in chickens raised in the captive method and half-grazing method (57,1% and 55,0% respectively), and less occurs in free grazing chickens (28,0%) The age of infected chickens was mainly from to weeks old (21 - 42 days old) The unvaccinated chickens were infected Gumboro disease at the highest rate (66,7%) while the chickens vaccinated times were the least ones (24,5%) In surveyed provinces, chicken flocks got the highest infected rate in Hau Giang (60,0%), and the lowest rate in An Giang (37,9%) The death rate of Gumboro infected chickens was not much high (4,81%) The clinical symptoms were skip eating, moodiness, ruffled feather, drinking much, down head Besides, chickens got watery white-green stools (94,9%), smeared feces on the cloaca (77,9%), dry skin of shanks (76,3%), and the lowest symptom was self-pecking on the cloaca (35,6%) The Gumboro infected chickens showed the characteristic lesions on the organs, especially in Fabricius bursa and muscles The analyzed results of nucleotide and amino acid sequence at the 634-1022 region of the hypervariable region of VP2 gene revealed that the 24 isolated virus strains in the surveyed provinces belonged to the high pathogenicity group These strains were homogeneous with strains of GTG, GTG25, GTN, GT1ST, GPT, GHUT12 isolated in Việt Nam, and strains of HuN11, YS07 originated from China The amino acid of the hypervariable region of VP2 gene from samples of M5, VC2, VC3, VC4 belonged to the attenuated group while VC1 and VC5 were the variant pathogenicity group The immune response of vaccines towards chicken breeds (Ben Tre “Noi”, Luong Phuong) was clarified The passive immune of Luong Phuong chickens was higher than that in Ben Tre “Noi” chickens with 86,6% and 73,3%, respectively The chickens had the highest immune response for the second time (86,6%) and 62,2% for the first time Ben Tre “Noi” chickens showed a high immune response in comparison to Luong Phuong chickens at both 2-time vaccination; however, there was no significant difference All vaccines could cause the immune response to chickens after vaccination At the first vaccinated time, the rate of chickens having the immune response were relatively similar among those vaccines (60,0% – 63,3%) At the second vaccinated time, the imune response had the highest rate with vaccine (93,3%) and the lowest rate with vaccine (80,0%); however, there was not significantly different among those experiments 4.2 Suggestions Farmers should take care of chicken flocks well in each age stage, especially at – weeks old It was necessary to vaccinate for chicken parents to produce passive antibodies for the chicks Vaccine at content was recommended for vaccination because it belongs to the variant virulence group of increasing pathogenicity Further research of the hypervariable region of VP2 gene should be done with the isolated Gumboro virus strains in the field to make the new generation of vaccine which is suitable for the prevalent virus 25 ... Ben Tre 2; M9: Vinh Long 1; M10: Vinh Long 2; VC1: IBD Blen; VC2: Bur 706; VC3: Cevac Gumboro L; VC4: Georgia; VC5: Nobilis vv: very virulent; av: antigenic variant; at: attenuated IBDV strains... importance of thesis Gumboro disease has been one of the avian diseases causing the huge economic loss for the poultry industry in many provinces of Vietnam for a long time Recently, Gumboro disease... with vaccination (Nguyen Ba Thanh et al., 2007; Le Thi Kim Xuyen and Le Thanh Hoa, 2008; Ho Thi Viet Thu, 2012a) The research of Ho Thi Viet Thu (2012a) indicated that Gumboro disease usually outbreaks

Ngày đăng: 13/05/2020, 06:05

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

w