0

Chuyển gen GmEXP1 vào cây thuốc lá Nicotinana tabacum

14 300 0
  • Chuyển gen GmEXP1 vào cây thuốc lá  Nicotinana tabacum

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 18/05/2016, 21:06

Hoạt động của gen GmEXP1 (xác định protein expansin) liên quan đến sự kéo dài rễ cây đậu tương, làm tăng cường khả năng chịu hạn của cây đậu tương. Trong bài báo này, chúng tôi trình bày kết quả của việc thiết kế vector mang cấu trúc gen GmEXP1 được lai với 1 đoạn mã hoá peptide cmyc và KDEL, dưới sự điều khiển của CaMV35S promoter; chuyển cấu trúc trên cây thuốc lá mô hình (Nicotinana tabacum) nhờ A.tumefaciens. Chuyên đề: Nghiên cứu thực nghiệm: Hoạt động gen GmEXP1 (xác định protein expansin) liên quan đến kéo dài rễ đậu tương, làm tăng cường khả chịu hạn đậu tương Trong báo này, trình bày kết việc thiết kế vector mang cấu trúc gen GmEXP1 lai với đoạn mã hoá peptide c-myc KDEL, điều khiển CaMV35S promoter; chuyển cấu trúc thuốc mô hình (Nicotinana tabacum) nhờ A.tumefaciens  Tên trình tự DNA: Glycine max expansin (EXP1) mRNA, complete cds  Accession: AF516879  GI: 27464176  Kích thước (bp): 1089 bp  Sinh vật: Glycine max (soybean)  Gene trình tự DNA: Tên gene Từ nu đến nu Kích thước (bp) EXP1 52… 819 768  Thông tin cặp mồi thiết kế: Mồi Mồi xuôi Trình tự mồi Từ nu đến nu TCTCACCTTCTGGATGGACCA 71…92 Kích thước Tm ( C) sản phẩm (bp) 63.0°C 685bp Mồi ngược GGGCTAGAGAAAGTTTGGCCG 735…755 64.4°C Phương pháp Kết luận: Thiết kế thành công vector tái tổ hợp pCB301 mang promoter CaMV35S cấu trúc chứa gen đích (GmEXP1_cmyc_KDEL_polyA) xác định protein expansin kéo giãn thành tế bào Thực chuyển thành công cấu trúc vào mô thuốc N.tabacum K326, tái sinh thành hoàn chỉnh Kiểm tra có mặt gen chuyển thuốc tái sinh cho thấy 32/44 dòng mang gen GmEXP1 Qua thấy, gen GmEXP1 vector tái tổ hợp thiết kế sử dụng để chuyển vào trồng quan tâm nhằm cải thiện khả chịu hạn phát triển mạnh hệ rễ [...]... trúc chứa gen đích (GmEXP1_ cmyc_KDEL_polyA) xác định protein expansin kéo giãn thành tế bào Thực hiện chuyển thành công cấu trúc trên vào mô thuốc lá N .tabacum K326, tái sinh thành cây hoàn chỉnh Kiểm tra sự có mặt của gen chuyển trên cây thuốc lá tái sinh cho thấy 32/44 dòng mang gen GmEXP1 Qua đó có thể thấy, gen GmEXP1 trong vector tái tổ hợp đã thiết kế có thể được sử dụng để chuyển vào các cây trồng
- Xem thêm -

Xem thêm: Chuyển gen GmEXP1 vào cây thuốc lá Nicotinana tabacum, Chuyển gen GmEXP1 vào cây thuốc lá Nicotinana tabacum, Chuyển gen GmEXP1 vào cây thuốc lá Nicotinana tabacum