0

Chủng virus Begomovirus

12 680 4

Đang tải.... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

Tài liệu liên quan

Thông tin tài liệu

Ngày đăng: 18/08/2012, 23:49

Chủng virus Begomovirus I. MỞ ĐẦU1.1. Đặt vấn đềCây cà chua bị tấn công bởi rất nhiều loài virus. Trong số bệnh virus hại cà chua ở vùng nhiệt đới và cận nhiệt đới, bệnh xoăn vàng lá được xem là bệnh quan trọng nhất (Pico et al., 1996).Nguyên nhân gây bệnh xoăn vàng lá cà chua khá phức tạp. Bệnh được xem là một bệnh phức, có nghĩa là một bệnh nhưng do nhiều virus thuộc chi Begomovirus, họ Geminiviridae gây ra (Moriones & Navas-Castillo, 2000). Các begomovirus có hình thái phân tử dạng hình cầu kép (hình chuỳ), không truyền qua hạt giống nhưng lan truyền trên đồng ruộng bằng bọ phấn (Bemisia tabaci) theo kiểu bền vững tuần hoàn (Pico et al., 1996).Begomovirus là các virus có bộ gien DNA sợi vòng đơn, kích thước khoảng 2.6 – 2.8 kb. Begomovirus có thể có bộ gien đơn (gồm một phân tử DNA-A) hoặc có bộ gen kép (gồm hai phân tử DNA-A và DNA-B). Cấu trúc của một phân tử DNA-A điển hình gồm có 6 gien được sắp xếp theo hai chiều ngược nhau (Hình 1). Theo chiều kim đồng hồ có hai gien AV1 và AV2. Gen AV1(CP) mã hóa vỏ protein, qui định tính đặc hiệu vector và nhập nhân tế bào. Gen AV2 mã hóa 1 protein có chức năng cảm ứng triệu chứng, di chuyển hệ thống và tích lũy DNA của virus. Ngược chiều kim đồng hồ có 4 gien AC1, AC2, AC3 và AC4. Gien AC1 (Rep) mã hóa 1 protein có vai trò quan trọng trong quá trình tái sinh virus và tương tác với các protein ký chủ điều khiển chu kỳ tế bào. Gien AC2 (TrAP) mã hóa 1 protein hoạt hóa phiên mã và ức chế phản ứng phòng thủ của cây. Gien AC4 (REn) mã hóa 1 protein tăng cường sự tái sinh virus và tương tác với các protein ký chủ điều khiển chu kỳ tế bào. Gien AC4 mã hóa 1 protein có chức năng cảm ứng triệu chứng và di chuyển hệ thống (Stanley et al., 2005)Hiện nay, có tới hơn 50 begomovirus phân lập từ cà chua (có từ tomato ở đầu tên virus) đã được công bố trên thế giới (Fauquet et al., 2008). Trên cây cà chua, các begomovirus tạo triệu chứng giống nhau, điển hình là: cuốn lá (cong lại hình thìa); mép lá (đặc biệt ở lá non) biến vàng; lá nhỏ hẹp; cây nhiễm sớm còi cọc với tỷ lệ đậu quả rất thấp. Danh tính virus gây bệnh chỉ có thể biết được dựa vào các phân tích phân tử (Moriones & Navas-Castillo, 2000). Tại Việt Nam, bệnh xoăn vàng lá được xem là bệnh virus quan trọng nhất trên cà chua với tỉ lệ nhiễm bệnh trên các ruộng trồng cà chua thường rất cao, có khi tới 100 %. Bệnh đã được phát hiện thấy trên cà chua từ những năm 80. Một số nghiên cứu về tạo kháng huyết thanh chẩn đoán, lây nhiễm nhân tạo đã được thực hiện trong thời gian này nhưng bản chất thật sự của virus vẫn chưa rõ. Gần đây, dựa vào các phân tích phân tử, có ít nhất 3 begomovirus được phát hiện gây ra bệnh xoăn vàng lá cà chua ở Việt Nam gồm tomato leaf curl Vietnam virus (ToLCVV) (Green et al. 2001), tomato yellow leaf curl Vietnam virus (TYLCVNV) và tomato yellow leaf curl DNA-A~2.7kbAC4AC2 (TrAP)AC1 (Rep) (Rep)AV1 (CP)AC3 (REn)AV21Hình 1. Tổ chức bộ gien phân tử DNA-A của begomovirus. CP = coat protein. REn = replication enhancer. TrAP = transcriptional activator protein. Rep = replication associated protein.Kanchanaburi (TYLCKaV) (Hà et al. 2008). Trong số 3 virus trên, 2 virus được phân lập trên mẫu cà chua gây bệnh xoăn vàng lá ở miền Bắc là ToLCVV và TLCVNV.Cũng dựa trên các phân tích phân tử, Việt Nam dường như là trung tâm đa dạng của begomovirus (Ha et al. 2006, 2008). Mặc dù vậy số lượng begomovirus được xác định trên thực vật của Việt Nam vẫn còn ít, chỉ gồm 19 virus được phân lập từ nhiều loài cây, trong đó nhiều loài là cây dại (Green et al., 2001; Revill et al., 2003; Ha et al., 2006, 2008). Kết quả trên gợi ý rằng nhiều begomovirus nữa đang gây hại trên cà chua và các cây trồng khác ở Viêt Nam và cần phải được xác định.Việc phòng trừ begomovirus trên cà chua nhìn chung là khó và chủ yếu hiện nay dựa vào các chiến lược sau: (i) tạo giống kháng bệnh dựa vào nguồn gen kháng bệnh có nguồn gốc từ cà chua dại; (ii) tạo giống kháng bệnh dựa vào gen của tác nhân gây bệnh, trong đó gen của begomovirus được chuyển vào cây và thông qua cơ chế siRNA để tạo tính kháng; và (iii) phòng chống tổng hợp, trong đó thành phần chủ chốt là tiêu diệt bọ phấn, cắt nguồn ký chủ của virus, nhổ bỏ cây bệnh, sử dụng giống kháng (Czosnek, 2007). Việc xác định đầy đủ thành phần begomovirus trên cà chua luôn cần thiết cho bất cứ chiến lược phòng chống nào1.2. Mục đích và yêu cầuMục đích: Xác định thành phần loài Begomovirus hại cà chua tại Hà Nội và phụ cận.Yêu cầu:− Thu mẫu và xử lý mẫu cà chua bị bệnh xoăn vàng lá.− Xác định sự có mặt của các begomovirus bằng PCR dùng mồi chung (degenerate primers) đặc hiệu cho DNA-A của virus .− Xác định thành phần begomovirus tại các điểm điểu tra dùng cặp mồi đặc hiệu với 2 loài virus đã được xác định trước tại miền Bắc là tomato leaf curl Vietnam virus (ToLCVV) và tomato yellow leaf curl Vietnam virus (TYLCVNV).− Giải trình tự sản phẩm PCR của các mẫu virus có khả năng là loài mới.II. VẬT LIỆU VÀ PHƯƠNG PHÁP2.1. Thu mẫu và xử lý mẫuMẫu bệnh cây cà chua có triệu chứng điển hình của bệnh xoăn vàng lá được thu thập tại các ruộng trồng thuộc Hà Nội và phụ cận.Mẫu sau khi thu thập được số liệu hóa và xử lý khô bằng silicagel hoặc sấy ở 37 OC. Mẫu sau khi xử lý khô được bảo quản lâu dài trong lọ chứa silicagel ở 4 OC.2.2. Thời gian và địa điểm nghiên cứu.Nghiên cứu được thực hiện từ 24/06/2008 đến 15/01/2009 tại TT BCNĐ, ĐHNNHN2.3. Chiết DNA từ mô lá cà chuaDNA tổng số từ mô lá được chiết theo 2 phương pháp:Phương pháp chiết nhanh nhanh bằng NaOH (Wang et al., 1993): Cho khoảng 50 mg mô lá cà chua vào tube 1,5 mL. Cho 0,5 mL dung dich NaOH 0,5 M vào tube. Dùng chày nhựa chuyên dụng để nghiền nhuyễn mẫu lá. Hòa loãng dịch nghiền 50 - 100 lần với đệm Tris 0,1 M, pH = 8 (5 μL dịch nghiền hòa loãng với 495 μL đệm Tris). Dịch hòa loãng này được dùng để chạy PCR.Phương pháp chiết dùng CTAB (Doyle & Doyle (1987). Khoảng 100 mg mô lá bệnh tươi (hoặc 20 mg mô lá bệnh khô) được nghiền với 1 mL đệm CTAB. DNA được chiết 2 lần với Chloroform: isoamyl alcohol (24:1). Căn DNA được rửa 2 lần bằng ethanol 70% và hòa trong 50 uL nước cất 2 lần vô trùng. Dịch chiết DNA được giữ ở -20OC (CEGPCKVQS) BegoARev1 DNA-A22.4. PCR (Polymerase Chain Reaction)Các phản ứng PCR được thực hiện trong tube 0.5 mL với tổng thể tích phản ứng 25 μL chứa 2.5 μL dung dịch đệm PCR X10 (Fermantas), 0.5 μL dNTPS (10 mM môi loại A, T, G, C, Roche), 0.5 μL mỗi loại mồi đặc hiệu xuôi dòng và ngược dòng hoặc 1 μL cho mỗi mồi chung (đều đươc chuẩn bị ở nồng độ 20 μM), 1.5 µL MgCl2, 0.25 µL Taq polymerase (Fermentas) và 0.5 μL DNA. Phản ứng PCR được thực hiện trên máy PCR PTC-100 (MJ Research Inc.) với điều kiện sau: khởi đầu biến tính ở 94 OC trong 5 phút; tiếp theo là 35 chu trình PCR (biến tính ở 94 OC 30 - 40 giây, gắn mồi ở 50 OC 35 - 45 giây và tổng hợp sợi ở 72 OC 1 – 1.5 phút). Phản ứng được kết thúc với 5 phút ở 72 OC.Sản phẩm PCR được điện di trên gel agarose 1 % đươc chuẩn bị bằng đệm TAE và chứa 0.5 mg/mL ethidium bromide. Gel được chạy trên thiết bị điện di là Mini-Sub Cell (Biorad) với đệm TAE ở điện thế 100 V trong 30 - 40 phút. Bản gel được kiểm tra dưới ánh sáng tử ngoại và được chup bằng máy ảnh số.2.5. Mồi PCRBa cặp mồi đã được sử dụng trong nghiên cứu. Chi tiết của các mồi được trình bày ở Bảng 1 và Hình 2.Căp mồi thứ nhất là cặp mồi chung (universal/degenerate primers) BegoAFor1 / BegoARev1. Cặp mồi này được thiết kế trên vùng bảo thủ của gien CP và Rep và đã được chứng minh có khả năng phát hiện DNA-A của nhiều begomovirus (Ha et al., 2006, 2008)Hai cặp mồi còn lại là các mồi đặc hiệu cho TYLCVNV (TYLCVNV-sp-F1 / TYLCVNV-sp-R1) và ToLCVV (ToLCVV-sp-F2 / ToLCVV-sp-R2). Các mồi này đã được thiết kế dựa trên trình tự chuỗi gien đã công bố của 2 virus này.Bảng 1. Các mồi được sử dụng trong nghiên cứuMồi Trình tự (5’ – 3’) Vị tríKích thước (bp)Tham khảoTYLCVNV-Sp-F1TGTGTTACATATTCTGTGTTTTCC 1094-11171386Mã GeneBank DQ641697TYLCVNV-Sp-R1AAATACATCAAAATCTGCAGAGAGC2456-2480ToLCVV-Sp-F2 GACCAGTCTGAAGGTGTGAGTTC 1254-1276454Mã GeneBank DQ641705ToLCVV-Sp-R2ACTCAAGCTATAAAGAATACCTAGAC1683-1708BegoAFor1TGYGARGGiCCiTGYAARGTYCARTC*Hình 2 ~1200Ha et al., 2006BegoARev1ATHCCMDCHATCKTBCTiTGCAATCC** Y (C / T), R (G / A), H (A / C / T), M (A / C), B (C / G / T), D (A / G / T), K (G / T) và i = inosine (CEGPCKVQS) BegoARev1 DNA-A3 2.6. Giải trình tựSản phẩm PCR được tinh chiết từ gel agarose dùng kít tinh chiết PureLinkTM Quick Gel Extraction Kit (Invitrogen) theo hướng dẫn của nhà sản xuất. Hàm lượng DNA được ước lượng bằng điện di agarose với lượng DNA tham khảo là 2µl, 1µl, 0.5µl tương ứng với 1µg, 0.5 µg, 0.25 µg DNA (marker GeneRuler, Fermantas).Sản phẩm PCR tinh chiết được giải trình tự trực tiếp cả 2 chiều bằng mồi PCR tại Viện Công nghệ sinh học (Hà Nội)2.7. Phân tích trình tự và xây dựng cây phả hệ.Các chuỗi mẫu được xác định danh tính khi so sánh với các chuỗi đã công bố từ trước nhờ phần mềm tìm kiếm BLAST tại NCBI (the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/BLAST/).Phân tích chuỗi và xây dựng cây phả hệ được thực hiện với các phần mềm miễn phí BioEdit 7.0, ClustalX1.83, Mega 4.0 và gói phần mềm thương mại DNASTAR.III. KẾT QUẢ NGHIÊN CỨU3.1. Điều tra thu thập mẫu bệnhChúng tôi đã tiến hành điều tra bệnh xoăn vàng lá trên các ruộng trồng cà chua thuộc Hà Nội, Bắc Ninh và Hưng Yên. Tổng số 50 mẫu cà chua đã được thu thập, số liệu hóa và xử lý khô để bảo quản lâu dài. Các mẫu này đều tạo triệu chứng đặc trưng của bệnh xoăn vàng lá. 3.2. Kiểm tra PCR dùng mồi đặc hiệu begomovirrusDo số lượng mẫu thu thập khá lớn nên chúng tôi đã chọn 19 mẫu bệnh đại diện cho các địa điểm khác nhau để kiểm tra PCR. Đầu tiên, chúng tôi sử dụng cặp mồi chung đặc hiệu cho DNA-A của nhiều loài begomovirus (BegoaFor1/BegoARev1) nhằm phát hiện sự có mặt của virus trong mẫu cây bệnh. Phản ứng PCR đều tạo ra 1 sản phẩm có kích thước khoảng 1200 bp trên tất cả 19 mẫu thử, chứng tỏ sự có mặt của begomovirus trong mẫu (Hình 3A, Bảng 2)3.3. Kiểm tra PCR dùng mồi đặc hiệu ToLCVV và TYLCVNV Hiện nay, tại miền Bắc Việt Nam mới chỉ công bố sự có mặt của 2 begomovirus gây bệnh xoăn vàng lá cà chua là ToLCVV và TYLCVNV. Để kiểm tra sự có mặt của 2 virus này trên 19 mẫu cà chua nhiễm begomovirus, chúng tôi đã sử dụng 2 cặp mồi đặc hiệu cho mỗi virus (phần 2.5). Kiểm tra PCR với cặp mồi ToLCVV-sp-F2 / ToLCVV-sp-R2 (đặc hiệu ToLCVV) cho thấy 10/19 mẫu thử tạo các băng đơn và rõ với kích thước khoảng 450 bp (Hình 3B, Bảng 2), xác nhận sự có mặt của ToLCVV. (CEGPCKVQS)(IPT/A/SIF/VLCNP)AV1AV2AC3AC2AC1AC4BegoAFor1 BegoARev1~ 1.2 kb DNA-AHình 2. Sơ đồ tổ chức bộ gien DNA-A (biểu diễn dưới dạng mạch thẳng) của begomovirus và vị trí tương đối của cặp mồi BegoAFor1 và BegoARev1. Mũi tên dạng hộp biểu diễn vị trí và hướng của các ORF. Dãy chữ trong 2 ngoặc kép là các chuỗi axit amin bảo thủ tương ứng với 2 mồi BegoAFor1 và BegoARev1. 4Kiểm tra PCR với cặp mồi TYLCVNV-sp-R1 / TYLCVNV-sp-F1 (đặc hiệu TYLCVNV) cho thấy 8/19 mẫu tạo ra tạo các băng đơn và rõ với kích thước khoảng 1386 bp (Hình 3C, Bảng 2), xác nhận sự có mặt của TYLCVNV.Kiểm tra PCR đã phát hiện thấy mẫu số 12 (mẫu thu tại Yên Mỹ - Thanh Trì - Hà Nội) có kết quả (+) với cả hai cặp mồi chứng tỏ mẫu này đã nhiễm cả 2 virus ToLCVV và TYLCVNV.Quan trọng nhất là chúng tôi đã phát hiện 2 mẫu (mẫu số 9, thu tại Đa Tốn – Gia Lâm – Hà Nội và mẫu số 14, thu tại Yên Mỹ – Thanh Trì – Hà Nội) có phản ứng PCR (–) với cả hai cặp mồi. Kết quả này gợi ý rằng các begomovirus nhiễm trên 2 mẫu này có thể không phải là ToLCVV hay TYLCVNV. Tuy nhiên danh tính của chúng chỉ thể được xác định dựa trên phân tích trình tự chuỗi gien virus. Bảng 2. Kiểm tra PCR các mẫu cà chua bị bệnh xoăn vàng láTT*Mã mẫuĐịa điểm thu mẫuPCR đặc hiệu BegomovirusToLCVV TYLCVNV1 CC1 Nam Hồng – Đông Anh – Hà Nội. + – +2 CC2 Nam Hồng – Đông Anh – Hà Nội. + + –3 CC 3 Cổ Bi – Gia Lâm – Hà Nội. + + –4 CC 4 Cổ Bi – Gia Lâm – Hà Nội. + + –5 CC 5 Cổ Bi – Gia Lâm – Hà Nội. + + –6 CC 6 Từ Sơn – Bắc Ninh. + + –7 CC 7 Từ Sơn – Bắc Ninh. + + –8 CC 8 Đa Tốn – Gia Lâm – Hà Nội + + –9 CC 9 Đa Tốn – Gia Lâm – Hà Nội + – –10 CC 10 Đa Tốn – Gia Lâm – Hà Nội + + –51200 bp454 bp1386 bpABCM 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19Hình 3. Kết quả điện di sản phẩm PCR của các mẫu cà chua bị bệnh xoăn vàng lá thu thập được. A) PCR với cặp mồi chung đặc hiệu DNA-A của begomovirus. B) PCR với cặp mồi đặc hiệu DNA-A của ToLCVV. C) PCR với cặp mồi đặc hiệu DNA-A của TYLCVNV. M là thang DNA (GeneRuler 1 kb, Fermentas). Các số từ 1 đến 19 là các mẫu cà chua (danh tính mẫu được trình bày ở bảng 2). Kích thước sản phẩm PCR cũng được chỉ rõ.11 CC 11 Duyên Hà – Thanh Trì – Hà Nội. + – +12 CC 12 Yên Mỹ – Thanh Trì – Hà Nội. + + +13 CC 13 Yên Mỹ – Thanh Trì – Hà Nội. + – +14 CC 14 Yên Mỹ – Thanh Trì – Hà Nội + – –15 CC 15 Yên Phú – Yên Mỹ – Hưng Yên. + – +16 CC 16 Yên Phú – Yên Mỹ – Hưng Yên. + – +17 CC 17 Yên Phú – Yên Mỹ – Hưng Yên. + – +18 CC 18Ngô Xuyên – Như Quỳnh – Hưng Yên+ + –19 CC 19 Đại học Nông nghiệp Hà Nội + - +* Số thứ tự trong bảng này cũng là số thứ tự các mẫu ở Hình 33.4. Kết quả giải trình tự mẫu PCRVì danh tính của begomovirus chỉ có thể được xác định chính xác dựa trên phân tích trình tự gien nên đối với 2 mẫu có PCR (-) đối với ToLCVV và TYLCVNV (mẫu số 9 và 14, Hình 3B, 3C, Bảng 2) chúng tôi đã giải trình tự trực tiếp sản phẩm PCR được khuyếch đại bằng cặp mồi BegoAFor1/BegoARev1. Sản phẩm PCR được tinh chiết từ gel agarose dùng kít tinh chiết (PureLinkTM Quick Gel Extraction Kit, Invitrogen) và được ước lượng nồng độ bằng điện di agarose trước khi được giải trình tự cả 2 chiều bằng mồi PCR tại Viện Công nghệ sinh học tại Hà Nội.Kết quả cho thấy tất cả 4 sản phẩm giải trình tự đều có chất lượng tốt, không bị nhiễu, các dâu hiệu nucleotide đều rõ ràng (ngoại trừ phần ở 2 đầu mỗi sản phẩm). Các trình tự được lắp ráp, biên tập và loại bỏ các đoạn có chất lượng kém ở 2 đầu (do giải trình tự trực tiếp) dùng phần mềm BioEdit và SeqMan (DNASTAR).Cuối cùng chúng tôi thu được đoạn trình tự của 2 mẫu với chiều dài mỗi đoạn là 819 nts. Cả 2 đoạn này này đều chứa toàn bộ ORF AC3 với kích thước 402 nts (Hình 4).Mẫu số 9 (Đa Tốn – Gia Lâm – Hà Nội)5’CACAGGATTTTGGTCAGGTGTTTAACATGTATGATAACGAGCCAAGTACAGCCACAGTGAAGAACGATAACAGAGATCGCTTTCAAGTTCTACGGCGTTTTCAGGCGACTGTTACTGGTGGTCAGTATGCAAGTAAGGAGCAAGCAATAGTTAGGAAGTTTATGAAGGTGAACAACCATGTGACGTATAATCATCAAGAAGCTGCGAAGTATGACAATCACACAGAGAATGCTCTTTTGTTGTATATGGCATGTACTCATGCTAGTAATCCTGTGTATGCTACTTTGAAAATCAGAATCTATTTCTATGATTCTGTTCAGAATTAATAAAGATTGAATTTTATTATATTTGAATGTGTTACATATTCTGTCTTTTCCAATACATCCCATAATACATGATCACATGCTCTAATTACATTGTTAATACTAATTACACCCAAATTATCTAAATATTTCATACATTGAACCCTAAATACTCTTAAGAAACGCCAAGTCTGAGGACGTAAACGAGTCCAGATTTGGAATATTAGAAAACATTGGTGTATTCCCAACGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTTGTTCATCAGAAATGGTCTCTCGTCGTGGCTGATTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGTGACAGCCTAGTGCAATGAAGTATGAACAGCCACAAGGAAGATCAACTCTCCGTCTCCTCGTTGCTTTCTTGGCGTTGCGGTGTTGC 3’Mẫu số 14 (Yên Mỹ - Thanh Trì – Hà Nội)65’CCCAGGATTTTGGCCAGGTGTTTAACATGTATGATAATGAGCCGAGTACAGCTACTGTGAAGAATGACAACAGGGATCGTTTTCAAGTTCTCCGCCGTTTTCAAGCCACTGTTACTGGTGGCCAGTATGCAAGTAAGGAGCAAGCAATAGTCAGGAAATTCATGAAGGTGAATAACCATGTAACTTATAACCATCAAGAGGCTGCGAAGTATGATAACCACACAGAAAATGCTTTGTTATTGTATATGGCATGTACTCATGCTAGTAATCCAGTGTATGCTACTTTGAAGATCAGGATCTATTTCTACGATTCTGTTCAGAATTAATAAAGATTAAATTTTATTATACTTGAATCTTCTGTATCAATTGTGCCTTCTAATACATTGTACAATACATGAGACATTGCTCTAATTACATTATTGATGCTAATAACTCCTAAATTGTCTAAATACTTAATACATTGATATTTAAATACTCTTAAGAAACGCGAGGTCTGAGGATGTAAACGAGTCCAAACTCGGCAGATTAGAAAACATTGGTGTATCCCCAATGCTTTCCTCAGGTTGTAATTGAATTGGACTTGTATTGTGATGATGTCGTGGTTCGTCAGAAATGGTCTCTCGTCGTGGCTGGTTATCTTGAAATATAGGGGATTTTTGACCGTCCAGATATATACGCCACTCTCTGCTTGAGCTGCAGTGATAGCTTCCCCTGTGCGAGAATCCATGATTGTGACAGCCTAGTGCAATGAAGTATGAACATCCACAAGGGAGATCAACTCTCCGTCTCCTCGTAGCTTTCTTGGCGTTGCGGTGTTGC 3’Hình 4. Trình tự nucleotide của sản phẩm PCR dùng mồi BegoAFor1/BegoARev1 sau khi được biên tập. Đoạn ORF AC3 mã hóa protein REn được bôi đậm với vị trí khởi đầu dịch mã cũng như hướng dịch mã được chỉ bằng mũi tên vuông.3.5. Kết quả tìm kiếm các trình tự tương đồng trên GeneBankSử dụng công cụ tìm kiếm trực tuyến BLAST trên NCBI, chúng tôi đã tìm các chuỗi gien có quan hệ với các chuỗi số 9 và số 14. Kết quả tìm kiếm dựa trên toàn bộ trình tự chuỗi (819 nts) cho thấy chuỗi trên GeneBank gần gũi nhất với chuỗi số 9 là một isolate của papaya leaf curl China virus (PaLCuCNV, isolate FQ1, có nguồn gốc từ Trung Quốc, mã số AM691554). Tương tự, chuỗi trên GeneBank gần gũi nhất với chuỗi số 14 là một isolate của Tomato yellow leaf curl Vietnam virus (TYLCVNV, nguồn gốc Việt Nam, mã số DQ641697). Kết quả tìm kiếm dựa trên trình tự gien AC3 cho thấy, virus trên GeneBank gần gũi nhất với cả 2 chuỗi số 9 và 14 đều là PaLCuCNV.3.6. Kết quả so sánh mức độ tương đồng trình tự nucleotideĐể đánh giá mức độ tương đồng, trình tự nucleotide của 2 mẫu virus trong nghiên cứu này được so sánh với trình tự nucleotide của nhiều virus trên GeneBank. Các chuỗi virus trên GeneBank bao gồm (i) 5 chuỗi (không tính cùng hay khác virus) có quan hệ gần gũi nhất từ tìm kiếm BLAST, (ii) các virus được phân lập từ trước tại Việt Nam, (iii) nhiều mẫu virus phân lập từ cà chua thuộc cựu thế giới và (iv) một virus đại diện nhóm tân thế giới (sweet potato leaf curl virus, SPLCV). Ngoài ra, để đánh giá mức độ tương đồng giữa các isolate khác nhau của cùng 1 virus, 11 chuỗi papaya leaf curl China virus (PaLCuCNV) cũng được so sánh. Đầu tiên, các chuỗi được “nắn” (aligned) dùng phần mềm Clustal X; tiếp theo phần trăm tương đồng nucleotide của các chuỗi được tính từ lệnh “sequence identity matrix” của phần mềm Bioedit. Danh tính virus, mã GeneBank, nguồn gốc của 41 chuỗi virus trên GeneBank được trình bày ở Bảng 3.Kết quả so sánh dựa trên đoạn 819 nts cho thấy mẫu virus số 14 có mức tương đồng cao nhất với Ageratum leaf curl virus (ALCV, AJ851005, nguồn gốc Trung Quốc) với phần trăm tương đồng là 97 % (Bảng 3).Trong khi đó, mẫu virus số 9 có mức tương đồng cao nhất với 2 isolate của PaLCuCNV (AM691554, AM691552) có nguồn gốc từ Trung Quốc và với TYLCVNV (DQ641697) của Việt Nam. Tuy nhiên, phần trăm tương đồng của mẫu virus số 9 thấp hơn nhiều và đều bằng 89.7 % đối với cả 3 chuỗi trên (Bảng 3).7Cả 2 mẫu virus, số 9 và 14, đều chia sẻ mức tương đồng nucleotide khá thấp đối với mẫu SPLCV, một đại diện của nhóm Tân thế giới (phần trăm tương đồng lần lượt là 0.52 và 0.508 (Bảng 3).3.7. Kết quả phân tích phả hệĐể đánh giá mối quan hệ phả hệ của 2 mẫu begomovirus từ nghiên cứu này với các begomovirus khác, phần mềm MEGA đã được sử dụng để tính khoảng cách di truyền và xây dựng cây phả hệ dựa trên các chuỗi đã được nắn trước bằng phần mềm ClustalX. Tương tự như kết quả so sánh chuỗi, cây phả hệ (Hình 5) cho thấy virus mẫu số 14 và ALCV hình thành một cụm riêng rẽ với giá trị boostrap tới 100 % phản ánh mức độ tương đồng trình tự nucleotide rất cao giữa chúng.Trái lại mẫu virus số 9 hình thành một cụm riêng rẽ so với các chuỗi hoặc cụm chuỗi khác (Hình 5)8Bảng 3. Mức tương đồng nucleotide dựa trên so sánh đoạn 819 nts của 2 mẫu begomovirus từ nghiên cứu này với đoạn tương ứng của 41 chuỗi virus trên GeneBankSttMã GenbankTên virus Ký hiệuNguồn gốcMẫu 9Mẫu 141AM691554Papaya leaf curl China virus [FQ1]PaLCuCNV-FQ1Trung Quốc0.8970.8332AM691552Papaya leaf curl China virus [F25]PaLCuCNV-F25Trung Quốc0.8970.8333 EU874386Papaya leaf curl China virus [ ZM1]PaLCuCNV-ZM1Trung Quốc0.8940.8334 AJ558123 Papaya leaf curl China virus [G2] PaLCuCNV-G2Trung Quốc0.8940.8295 AJ558117Papaya leaf curl China virus [G30]PaLCuCNV-G30Trung Quốc0.8940.8336 AJ811914 Papaya leaf curl China virus [G4] PaLCuCNV-G4Trung Quốc0.8940.8297AM691553Papaya leaf curl China virus [LC1-2]PaLCuCNV-LC1-2Trung Quốc0.8920.8308 AJ704604Papaya leaf curl China virus [G22]PaLCuCNV-G22Trung Quốc0.8880.8279 AJ558125Papaya leaf curl China virus [G10]PaLCuCNV-G10Trung Quốc0.8830.83510 AJ558124 Papaya leaf curl China virus [G8] PaLCuCNV-G8 Trung Quốc0.8790.84011DQ641700Papaya leaf curl China virus [VN]PaLCuCNV-VN Việt Nam0.8790.84712DQ641697Tomato yellow leaf curl Vietnam virusTYLCVNV Việt Nam0.8970.82613 AJ851005 Ageratum leaf curl virus ALCVTrung Quốc0.8930.97014DQ641698Erectites yellow mosaic virus EYMV Việt Nam0.8450.86015AY602166Tomato yellow leaf curl Guangdong virus TYLCGDVTrung Quốc0.8380.85716 AJ810156 Stachytarpheta leaf curl virus SLCVTrung Quốc0.8360.84717 AJ437618 Ageratum enation virus AEV Nepal0.7560.74318 X74516 Ageratum yellow vein virus AYVV Singapo0.8270.77419 AF363011 Cotton leaf curl Rajasthan virus CLCuRV Ấn Độ0.6960.69520 AJ438936 Eupatorium yellow vein virus EpYVV Nhật Bản 0.71 0.71 PaLCuCNV.LC1-2.TrungQuoc PaLCuCNV.G4.TrungQuoc PaLCuCNV.F25.TrungQuoc PaLCuCNV.FQ1.TrungQuoc PaLCuCNV.G2.TrungQuoc PaLCuCNV.G22.TrungQuoc PaLCuCNV.ZM1.TrungQuoc PaLCuCNV.G30.TrungQuoc PaLCuCNV.VietNam PaLCuCNV.G8.TrungQuoc PaLCuCNV.G10.TrungQuoc TbLCuYNV.Y61.TrungQuoc AYVV.Singapo SCLV.NhatBan TYLCVNV.VietNam ToYLCV.VietNam TYLCGDV.G3.TrungQuoc TLCPV.P118.Philippines ToLCLV.Lao TLCMaLV.Malaysia SLCV.Hn30.TrungQuoc ALCV.G52.TrungQuoc EYMV.VietNam PLCV-MaL.Malaysia TYLCThLV.ThaiLan TYLCuCNV.Y278.TrungQuoc TYLCuCNV.Y322.TrungQuoc MYMIV.Ando MYMV.ThaiLan TYLCInV.LB.Iandonexia CYMV.nigeria ICMV.AnDo AEV.Nelpan PepLCBV.Bangladesh CLCuRV.Ando LYMV.VietNam SLCCNV.ViệtNam LiAYVV.VietNam AlYVV.VietNam EpYVV.NhatBan SPLCV.My91 121 AJ314739 Indian cassava mosaic virus ICMV Ấn Độ0.7120.70122 AF126406Mungbean yellow mosaic India virusMYMIV Ấn Độ0.6250.62923 AF509739 Luffa yellow mosaic virus LYMV Việt Nam0.6770.67024 D14703 Mungbean yellow mosaic virus MYMV Thái Lan0.6300.62125 AF314531 Pepper leaf curl Bangladesh virus PepLCBVBangladesh0.7600.74526 AB050781 Soybean crinkle leaf virus SCLV Nhật Bản0.8170.77427 AF509743 Squash leaf curl China virus SLCCNV Việt Nam0.6900.68928 AJ566744 Tobacco leaf curl Yunnan virus TbLCuYNVTrung Quốc0.8000.75629 AF195782 Tomato leaf curl Laos virus ToLCLV Lào0.8050.81630 AF264063 Tomato leaf curl Vietnam virus ToLCVNV Việt Nam0.8130.78231 AF189018Tomato yellow leaf curl Indonesia virus ToLCInV Indonesia0.7340.72332AY514630Tomato yellow leaf curl Thailand virusTYLCTHV Thái Lan0.7850.80233 AF327436 Tomato leaf curl Malaysia virus TLCMaLV Malaysia0.7850.79134 AF414287 Pepper leaf curl virus PepLCV Malaysia0.8290.84135 EU487040Tomato leaf curl Philippines virus ToLCPV Philippin0.8020.80536DQ641701Lindernia anagallis yellow vein virus LaYVV Việt Nam0.7030.70037AM050736Alternanthera yellow vein virus isolate AlYVVTrung quốc0.7370.72338 AF104036 Sweet potato leaf curl virus SPLCV Mỹ0.5240.50839 AJ223191 Chayote yellow mosaic virus CYMV Nigeria0.6860.67240AM980509Tomato yellow leaf curl China virus-[Y278]TYLCuCNV-Y278Trung Quốc0.7620.78541AM181683Tomato yellow leaf curl China virus-[Y322]TYLCuCNV-Y322Trung Quốc0.7740.778 PaLCuCNV.LC1-2.TrungQuoc PaLCuCNV.G4.TrungQuoc PaLCuCNV.F25.TrungQuoc PaLCuCNV.FQ1.TrungQuoc PaLCuCNV.G2.TrungQuoc PaLCuCNV.G22.TrungQuoc PaLCuCNV.ZM1.TrungQuoc PaLCuCNV.G30.TrungQuoc PaLCuCNV.VietNam PaLCuCNV.G8.TrungQuoc PaLCuCNV.G10.TrungQuoc TbLCuYNV.Y61.TrungQuoc AYVV.Singapo SCLV.NhatBan TYLCVNV.VietNam ToYLCV.VietNam TYLCGDV.G3.TrungQuoc TLCPV.P118.Philippines ToLCLV.Lao TLCMaLV.Malaysia SLCV.Hn30.TrungQuoc ALCV.G52.TrungQuoc EYMV.VietNam PLCV-MaL.Malaysia TYLCThLV.ThaiLan TYLCuCNV.Y278.TrungQuoc TYLCuCNV.Y322.TrungQuoc MYMIV.Ando MYMV.ThaiLan TYLCInV.LB.Iandonexia CYMV.nigeria ICMV.AnDo AEV.Nelpan PepLCBV.Bangladesh CLCuRV.Ando LYMV.VietNam SLCCNV.ViệtNam LiAYVV.VietNam AlYVV.VietNam EpYVV.NhatBan SPLCV.My10[...]... sánh đoạn 819 nts của 2 mẫu begomovirus từ nghiên cứu này với đoạn tương ứng của 41 chuỗi virus trên GeneBankSttMã GenbankTên virus Ký hiệuNguồn gốcMẫu 9Mẫu 141AM691554Papaya leaf curl China virus [FQ1]PaLCuCNV-FQ1Trung Quốc0.8970.8332AM691552Papaya leaf curl China virus [F25]PaLCuCNV-F25Trung Quốc0.8970.8333 EU874386Papaya leaf curl China virus [ ZM1]PaLCuCNV-ZM1Trung... curl China virus SLCCNV Việt Nam0.6900.68928 AJ566744 Tobacco leaf curl Yunnan virus TbLCuYNVTrung Quốc0.8000.75629 AF195782 Tomato leaf curl Laos virus ToLCLV Lào0.8050.81630 AF264063 Tomato leaf curl Vietnam virus ToLCVNV Việt Nam0.8130.78231 AF189018Tomato yellow leaf curl Indonesia virus ToLCInV Indonesia0.7340.72332AY514630Tomato yellow leaf curl Thailand virus TYLCTHV... Malaysia virus TLCMaLV Malaysia0.7850.79134 AF414287 Pepper leaf curl virus PepLCV Malaysia0.8290.84135 EU487040Tomato leaf curl Philippines virus ToLCPV Philippin0.8020.80536DQ641701Lindernia anagallis yellow vein virus LaYVV Việt Nam0.7030.70037AM050736Alternanthera yellow vein virus isolate AlYVVTrung quốc0.7370.72338 AF104036 Sweet potato leaf curl virus SPLCV... AJ314739 Indian cassava mosaic virus ICMV Ấn Độ0.7120.70122 AF126406Mungbean yellow mosaic India virus MYMIV Ấn Độ0.6250.62923 AF509739 Luffa yellow mosaic virus LYMV Việt Nam0.6770.67024 D14703 Mungbean yellow mosaic virus MYMV Thái Lan0.6300.62125 AF314531 Pepper leaf curl Bangladesh virus PepLCBVBangladesh0.7600.74526 AB050781 Soybean crinkle leaf virus SCLV Nhật Bản0.8170.77427... Quốc0.8930.97014DQ641698Erectites yellow mosaic virus EYMV Việt Nam0.8450.86015AY602166Tomato yellow leaf curl Guangdong virus TYLCGDVTrung Quốc0.8380.85716 AJ810156 Stachytarpheta leaf curl virus SLCVTrung Quốc0.8360.84717 AJ437618 Ageratum enation virus AEV Nepal0.7560.74318 X74516 Ageratum yellow vein virus AYVV Singapo0.8270.77419 AF363011 Cotton leaf curl Rajasthan virus CLCuRV Ấn Độ0.6960.69520... Quốc0.8880.8279 AJ558125Papaya leaf curl China virus [G10]PaLCuCNV-G10Trung Quốc0.8830.83510 AJ558124 Papaya leaf curl China virus [G8] PaLCuCNV-G8 Trung Quốc0.8790.84011DQ641700Papaya leaf curl China virus [VN]PaLCuCNV-VN Việt Nam0.8790.84712DQ641697Tomato yellow leaf curl Vietnam virus TYLCVNV Việt Nam0.8970.82613 AJ851005 Ageratum leaf curl virus ALCVTrung Quốc0.8930.97014DQ641698Erectites... AJ558123 Papaya leaf curl China virus [G2] PaLCuCNV-G2Trung Quốc0.8940.8295 AJ558117Papaya leaf curl China virus [G30]PaLCuCNV-G30Trung Quốc0.8940.8336 AJ811914 Papaya leaf curl China virus [G4] PaLCuCNV-G4Trung Quốc0.8940.8297AM691553Papaya leaf curl China virus [LC1-2]PaLCuCNV-LC1-2Trung Quốc0.8920.8308 AJ704604Papaya leaf curl China virus [G22]PaLCuCNV-G22Trung... quốc0.7370.72338 AF104036 Sweet potato leaf curl virus SPLCV Mỹ0.5240.50839 AJ223191 Chayote yellow mosaic virus CYMV Nigeria0.6860.67240AM980509Tomato yellow leaf curl China virus- [Y278]TYLCuCNV-Y278Trung Quốc0.7620.78541AM181683Tomato yellow leaf curl China virus- [Y322]TYLCuCNV-Y322Trung Quốc0.7740.778 PaLCuCNV.LC1-2.TrungQuoc PaLCuCNV.G4.TrungQuoc PaLCuCNV.F25.TrungQuoc... gien CP và Rep và đã được chứng minh có khả năng phát hiện DNA-A của nhiều begomovirus (Ha et al., 2006, 2008)Hai cặp mồi còn lại là các mồi đặc hiệu cho TYLCVNV (TYLCVNV-sp-F1 / TYLCVNV-sp-R1) và ToLCVV (ToLCVV-sp-F2 / ToLCVV-sp-R2). Các mồi này đã được thiết kế dựa trên trình tự chuỗi gien đã cơng bố của 2 virus này.Bảng 1. Các mồi được sử dụng trong nghiên cứuMồi Trình tự (5’ –... virus AEV Nepal0.7560.74318 X74516 Ageratum yellow vein virus AYVV Singapo0.8270.77419 AF363011 Cotton leaf curl Rajasthan virus CLCuRV Ấn Độ0.6960.69520 AJ438936 Eupatorium yellow vein virus EpYVV Nhật Bản 0.71 0.71 PaLCuCNV.LC1-2.TrungQuoc PaLCuCNV.G4.TrungQuoc PaLCuCNV.F25.TrungQuoc PaLCuCNV.FQ1.TrungQuoc PaLCuCNV.G2.TrungQuoc PaLCuCNV.G22.TrungQuoc PaLCuCNV.ZM1.TrungQuoc PaLCuCNV.G30.TrungQuoc . một bệnh nhưng do nhiều virus thuộc chi Begomovirus, họ Geminiviridae gây ra (Moriones & Navas-Castillo, 2000). Các begomovirus có hình thái phân. tuần hoàn (Pico et al., 1996) .Begomovirus là các virus có bộ gien DNA sợi vòng đơn, kích thước khoảng 2.6 – 2.8 kb. Begomovirus có thể có bộ gien đơn (gồm
- Xem thêm -

Xem thêm: Chủng virus Begomovirus, Chủng virus Begomovirus,

Hình ảnh liên quan

Hình 1. Tổ chức bộ gien phân tử DNA-A của begomovirus. CP = coat  protein. REn = replication enhancer - Chủng virus Begomovirus

Hình 1..

Tổ chức bộ gien phân tử DNA-A của begomovirus. CP = coat protein. REn = replication enhancer Xem tại trang 1 của tài liệu.
* Số thứ tự trong bảng này cũng là số thứ tự các mẫu ở Hình 3 - Chủng virus Begomovirus

th.

ứ tự trong bảng này cũng là số thứ tự các mẫu ở Hình 3 Xem tại trang 6 của tài liệu.
Bảng 3. Mức tương đồng nucleotide dựa trên so sánh đoạn 819 nts của 2 mẫu begomovirus từ nghiên cứu này với đoạn tương ứng của 41 chuỗi  virus trên GeneBank - Chủng virus Begomovirus

Bảng 3..

Mức tương đồng nucleotide dựa trên so sánh đoạn 819 nts của 2 mẫu begomovirus từ nghiên cứu này với đoạn tương ứng của 41 chuỗi virus trên GeneBank Xem tại trang 9 của tài liệu.
Hình 5. Cây phả hệ dựa trên phân tích đoạn 819 nts của 2 mẫu virus phân lập từ nghiên cứu này và đoạn tương ứng của 41 chuỗi virus trên GenBank - Chủng virus Begomovirus

Hình 5..

Cây phả hệ dựa trên phân tích đoạn 819 nts của 2 mẫu virus phân lập từ nghiên cứu này và đoạn tương ứng của 41 chuỗi virus trên GenBank Xem tại trang 11 của tài liệu.