Investigating the role of menaquinone metabolism in dormant mycobacteria with antisense RNA

INVESTIGATING THE ROLE OF MENAQUINONE METABOLISM IN DORMANT MYCOBACTERIA BY ANTISENSE RNA THOMAS M FIEDLER NATIONAL UNIVERSITY OF SINAGPORE 2007 Investigating the role of menaquinone metabolism in dormant mycobacteria by antisense RNA Thomas M Fiedler (BSc.) A thesis submitted for the Degree of Master of Science in Infectious Diseases Department of Medical Sciences National University of Singapore 2007 ACKNOWLEDGEMENTS First and foremost I would like to thank my supervisor Dr Markus R Wenk for giving me the opportunity to be part of his wonderful lab group On top of this, I sincerely thank him and all the people involved in establishing this joint Masters course for their commitment I would also like to express my gratitude towards my mentor Dr Anne K Bendt for providing professional guidance and moral support throughout the course of this thesis Special thanks also go to Dr Guanghou Shui for lending me his expertise regarding mass spectrometry My sincere appreciation to all the members of the NUS lab for making this time in Singapore such an interesting and pleasant experience, thanks guys! Kind thanks also to Dr Thomas Dick, Head of TB unit, for allowing me to use the facilities at the Novartis Institute for Tropical Diseases (NITD) Special thanks go out to Dr Kevin Pèthe and Dr Srinivasa Rao, who inspired this project and lent a helping hand on innumerable occasions with all work performed at NITD Further, I would like to thank Angelyn Seet, whose help with the cloning work performed in this study was invaluable Last but not least, I dearly thank all the people at the TB unit who helped me out whenever I got stuck I Table of contents Introduction .1 1.1 1.1.1 Epidemiology 1.1.2 The Pathogen 1.1.3 Pathology 1.1.4 Treatment .6 1.1.5 Drug resistance .7 1.2 Dormancy and latent disease 1.2.1 Dormancy induction 1.2.2 Mimicking dormancy in vitro: the Wayne model 1.3 Tuberculosis Energy metabolism during dormancy .10 1.3.1 The mycobacterial respiratory chain .10 1.3.2 A delicate balance? .11 1.3.3 Menaquinone (MK) 12 1.3.4 Biosynthetic pathway of menaquinone 14 1.3.5 Antisense RNA approach .16 1.3.6 Dormancy specific promoters NarK2 and Rv2466c .17 1.3.7 Mass spectrometry analysis 17 Materials and Methods 19 2.1 Bacterial strains 20 2.2 Media and growth conditions 20 2.2.1 7H9: Liquid growth media for aerobic mycobacterial cultures 20 2.2.2 Dubos: Liquid growth media for anaerobic mycobacterial cultures .20 II 2.2.3 7H11 agar: Solid media for growth of Mycobacteria 21 2.2.4 LB: Liquid media for E coli 21 2.2.5 LB agar: Solid media for E coli and contamination checks 21 2.2.6 ImMedia Kan Blue™ : Solid media for growth of transformed E coli 22 2.3 Plasmids and cloning procedures 22 2.3.1 Cloning and expression vectors 22 2.3.2 Cloned genes 23 2.3.3 Primer design 23 2.3.4 Polymerase chain reaction 25 2.3.5 Visualizing DNA 25 2.3.6 Ligation into Primary vector 26 2.3.7 Transformation of TOP10 E coli with TOPO2.1 27 2.3.8 TOPO Plasmid extraction .28 2.3.9 Restriction enzyme double digest 28 2.3.10 Gel extraction .29 2.3.11 Ligation into pJEM .30 2.3.12 Transformation of TOP10 E coli with pJEM 30 2.3.13 pJEM plasmid extraction 31 2.3.14 Transformation into BCG .31 2.3.15 Generating seed stocks 32 2.4 Wayne dormancy model .33 2.4.1 Plating out bacteria for CFU counts 33 2.4.2 Lipid extraction with chloroform:methanol 2:1 .34 2.4.3 Preparation of MK4 standard 35 2.4.4 ATP quantification assay 36 III 2.5 Mass Spectrometry analysis 37 2.5.1 HPLC/ESI/MS analysis of polar lipids 37 2.5.2 HPLC/APCI/MS analysis of menaquinones 37 Results 39 3.1 Cloning 40 3.2 Transformants harbouring empty vectors .43 3.3 Growth of menX-NarK2 transformed BCG 43 3.3.1 Growth of menX-NarK2 transformants in Wayne model .43 3.3.2 Troubleshooting variations in OD600 .45 3.4 Wayne experiments with entC-NarK2 and menB-NarK2 46 3.4.1 Growth of entC-NarK2 and menB-NarK2 in Wayne model 46 3.4.2 Troubleshooting variations in OD600 of wild-type cells 47 3.4.3 Colony forming units (CFU) of entC-NarK2 48 3.4.4 ATP content of entC-NarK2 and WT 52 3.5 Wayne experiments with menC-NarK2 and menD-NarK2 53 3.5.1 3.6 ATP content of menC-NarK2, menD-NarK2 and WT .55 Wayne experiments with menX-2466 .56 3.6.1 Growth of menA-2466 and entC-2466 in Wayne model 56 3.6.2 CFU of menA-2466 and entC-2466 .57 3.7 Summary of CFU results 59 3.8 Mass Spectrometry results 60 Discussion .63 4.1 Rationale of this study 64 4.2 Discussion of results 65 4.2.1 MenA- and menB-silencing showed no effect 65 IV 4.2.2 MenD-silencing impeded growth slightly .66 4.2.3 EntC-silencing with both promoters impedes growth 66 4.2.4 ATP-quantification uncertain 67 4.2.5 Detection of menaquinones with mass spectrometry .68 4.2.6 Overcompensation hypothesis 69 4.2.7 Feedback hypothesis .69 4.3 Isoprenic saturation 70 4.4 Future directions 71 Conclusions 73 References .75 Appendix .84 Sequencing results .85 V I Summary One of the many alarming discoveries of the late last century was the resurgence of tuberculosis (TB), a disease caused by the pathogen Mycobacterium tuberculosis Great concern is also caused by the fact that mycobacteria have developed extensive drug resistance over the past decades The emergence of drug resistance is partly due to TB therapy being a very lengthy process, the successful completion of which takes at least months, leading to problems of compliance, premature termination of therapy and subsequently selection of resistant mutants The long treatment time is associated with the pathogens’ ability to switch into a metabolic state referred to as dormancy In this state the bacteria cease replication and develop phenotypic resistance to most of the therapeutic agents in use today All these observations have fuelled renewed efforts to develop novel drugs with greater potency and the capability of targeting dormant bacteria The goal of the study described here was to make a contribution to these efforts Mycobacteria exclusively use menaquinones (MK) in their respiratory chain The fact that humans rely on ubiquinone and not have the capability to synthesize menaquinones renders menaquinone metabolism an attractive drug target We investigate here if menaquinone is essential for bacterial survival during dormancy, by inhibiting the translation of genes coding for menaquinone synthesizing enzymes, through the experimental use of antisense RNA To this end, we inserted fragments of eight genes coding for enzymes thought to be involved in menaquinone metabolism in the antisense orientation, into two sets of plasmids containing two distinct dormancy-specific promoters VI These plasmids were introduced into Mycobacterium bovis BCG and the resulting bacterial transformants were cultivated under oxygen limiting conditions that induce dormancy Differences between transformants and wild-type, concerning the bacteria’s ability to survive hypoxia and synthesize menaquinone, were monitored by counting colony forming units (CFU) and measuring levels of menaquinones via mass spectrometry (MS) Based on our observations of cell growth, cells transformed with a plasmid carrying an antisense fragment of the gene entC were compromised in their ability to survive hypoxic conditions However, an inhibition of menaquinone synthesis and concurrent drops in menaquinone levels could not be confirmed by preliminary MS analysis VII 26 Gupta, K J., M Stoimenova, and W M Kaiser 2005 In higher plants, only root mitochondria, but not leaf mitochondria reduce nitrite to NO, in vitro and in situ J Exp Bot 56:2601-9 27 Harrison, A J., R J Ramsay, E N Baker, and J S Lott 2005 Crystallization and preliminary X-ray crystallographic analysis of MbtI, a protein essential for siderophore biosynthesis in Mycobacterium tuberculosis Acta Crystallograph.Sect.F.Struct.Biol.Cryst.Commun 61:121-123 28 Harrison, A J., M Yu, T Gardenborg, M Middleditch, R J Ramsay, E N Baker, and J S Lott 2006 The structure of MbtI from Mycobacterium tuberculosis, the first enzyme in the biosynthesis of the siderophore mycobactin, reveals it to be a salicylate synthase J.Bacteriol 188:6081-6091 29 Hutter, B., and T Dick 2000 Analysis of the dormancy-inducible narK2 promoter in Mycobacterium bovis BCG FEMS Microbiol.Lett 188:141-146 30 Kaiser, A., and E Leistner 1990 Role of the entC gene in enterobactin and menaquinone biosynthesis in Escherichia coli Arch Biochem Biophys 276:331-5 31 Kang, P B., A K Azad, J B Torrelles, T M Kaufman, A Beharka, E Tibesar, L E DesJardin, and L S Schlesinger 2005 The human macrophage mannose receptor directs Mycobacterium tuberculosis lipoarabinomannanmediated phagosome biogenesis J.Exp.Med 202:987-999 32 Konomi, N., E Lebwohl, K Mowbray, I Tattersall, and D Zhang 2002 Detection of mycobacterial DNA in Andean mummies J.Clin.Microbiol 40:4738-4740 79 33 Krishnaiah, K V., and T Ramasarma 1970 Effect of alpha-pchlorophenoxyisobutyrate on the metabolism of isoprenoid compounds in the rat Biochem J 116:321-7 34 Lillebaek, T., A Dirksen, E Vynnycky, I Baess, V O Thomsen, and A B Andersen 2003 Stability of DNA patterns and evidence of Mycobacterium tuberculosis reactivation occurring decades after the initial infection J Infect Dis 188:1032-9 35 Madison, B M 2001 Application of stains in clinical microbiology Biotech Histochem 76:119-25 36 Monaldi, V., and A Blasi 1960 Anatomical bases of tuberculosis Primary foci Arch De Vecchi Anat Patol 32:661-79 37 Muttucumaru, D G., G Roberts, J Hinds, R A Stabler, and T Parish 2004 Gene expression profile of Mycobacterium tuberculosis in a non-replicating state Tuberculosis (Edinb) 84:239-46 38 Parish, T., and N G Stoker 1997 Development and use of a conditional antisense mutagenesis system in mycobacteria FEMS Microbiol Lett 154:151-7 39 Pfyffer, G E., A Strassle, G T van, F Portaels, L Rigouts, C Mathieu, F Mirzoyev, H Traore, and J D van Embden 2001 Multidrug-resistant tuberculosis in prison inmates, Azerbaijan Emerg.Infect.Dis 7:855-861 40 Roberts, D M., R P Liao, G Wisedchaisri, W G Hol, and D R Sherman 2004 Two sensor kinases contribute to the hypoxic response of Mycobacterium tuberculosis J.Biol.Chem 279:23082-23087 80 41 Russell, D G 2007 Who puts the tubercle in tuberculosis? Nat Rev Microbiol 5:39-47 42 Sassetti, C M., D H Boyd, and E J Rubin 2003 Genes required for mycobacterial growth defined by high density mutagenesis Mol Microbiol 48:7784 43 Sohaskey, C D., and L G Wayne 2003 Role of narK2X and narGHJI in hypoxic upregulation of nitrate reduction by Mycobacterium tuberculosis J.Bacteriol 185:7247-7256 44 Sullivan, T J., J J Truglio, M E Boyne, P Novichenok, X Zhang, C F Stratton, H J Li, T Kaur, A Amin, F Johnson, R A Slayden, C Kisker, and P J Tonge 2006 High affinity InhA inhibitors with activity against drugresistant strains of Mycobacterium tuberculosis ACS Chem Biol 1:43-53 45 Truglio, J J., K Theis, Y Feng, R Gajda, C Machutta, P J Tonge, and C Kisker 2003 Crystal structure of Mycobacterium tuberculosis MenB, a key enzyme in vitamin K2 biosynthesis J Biol Chem 278:42352-60 46 Turunen, M., J M Peters, F J Gonzalez, S Schedin, and G Dallner 2000 Influence of peroxisome proliferator-activated receptor alpha on ubiquinone biosynthesis J Mol Biol 297:607-14 47 van Hylckama Vlieg, J E., J Kingma, A J van den Wijngaard, and D B Janssen 1998 A glutathione S-transferase with activity towards cis-1, 2dichloroepoxyethane is involved in isoprene utilization by Rhodococcus sp strain AD45 Appl Environ Microbiol 64:2800-5 81 48 Vieira, O V., R E Harrison, C C Scott, H Stenmark, D Alexander, J Liu, J Gruenberg, A D Schreiber, and S Grinstein 2004 Acquisition of Hrs, an essential component of phagosomal maturation, is impaired by mycobacteria Mol.Cell Biol 24:4593-4604 49 Warncke, K., M R Gunner, B S Braun, L Gu, C A Yu, J M Bruce, and P L Dutton 1994 Influence of hydrocarbon tail structure on quinone binding and electron-transfer performance at the QA and QB sites of the photosynthetic reaction center protein Biochemistry 33:7830-7841 50 Wayne, L G., and L G Hayes 1996 An in vitro model for sequential study of shiftdown of Mycobacterium tuberculosis through two stages of nonreplicating persistence Infect.Immun 64:2062-2069 51 Wayne, L G., and C D Sohaskey 2001 Nonreplicating persistence of mycobacterium tuberculosis Annu.Rev.Microbiol 55:139-163 52 WHO 2004 World Health Organization fact sheet Tuberculosis Saudi Med J 25:1136-8 53 Wilson, T H., and E C Lin 1980 Evolution of membrane bioenergetics J Supramol Struct 13:421-46 54 Wolinsky, E 1992 Mycobacterial diseases other than tuberculosis Clin Infect Dis 15:1-10 55 Wu, S., S T Howard, D L Lakey, A Kipnis, B Samten, H Safi, V Gruppo, B Wizel, H Shams, R J Basaraba, I M Orme, and P F Barnes 2004 The 82 principal sigma factor sigA mediates enhanced growth of Mycobacterium tuberculosis in vivo Mol Microbiol 51:1551-62 56 Yassin, A F., H Brzezinka, K P Schaal, H G Truper, and G Pulverer 1988 Menaquinone composition in the classification and identification of aerobic actinomycetes Zentralbl Bakteriol Mikrobiol Hyg [A] 267:339-56 57 Zhang, Y 2005 The magic bullets and tuberculosis drug targets Annu.Rev.Pharmacol.Toxicol 45:529-564 58 Zhang, Y 2004 Persistent and dormant tubercle bacilli and latent tuberculosis Front Biosci 9:1136-1156 59 Zink, A R., C Sola, U Reischl, W Grabner, N Rastogi, H Wolf, and A G Nerlich 2003 Characterization of Mycobacterium tuberculosis complex DNAs from Egyptian mummies by spoligotyping J Clin Microbiol 41:359-67 60 Zwahlen, J., S Kolappan, R Zhou, C Kisker, and P J Tonge 2007 Structure and mechanism of MbtI, the salicylate synthase from Mycobacterium tuberculosis Biochemistry 46:954-64 83 Appendix 84 Sequencing results Shown here are the sequences of eight expression vectors sequenced by Research Biolabs technologies pte ltd (Singapore), with an ABI PRISM 3100 capillary sequencer (Applied Biosystems, USA) One example of each insert is given The first vector encodes the Rv2466c promoter sequence, the seven following vectors encode the NarK2 promoter sequence Sequencing was performed using reverse primer and forward primer Since the forward primer did not perform well, its results are not included Reverse sequences depicted here were converted into their complementary strands, to show the promoter in sense and the insert in antisense orientation The quality of sequencing of the promoter regions was relatively poor, as they were sequenced towards the end of the reaction 85 Rv2466c-anti-menA construct (Rv0534c) 5’GNGATCNANTCANNGAGACTTTNTAATTTTTATAATAATGGGACCTANGTNCCTTTTT Rv2466c → ATTTNAAAATTTTCACAAACGGTTACAAGCATAAAGTATATTT_GNCCCGCTGAGTTTGA ANGGCCACGNGTNCAATTAACCGGTTGGCGGAACAGTGCGGGCGGCCGTGGTNTGNTGGG CGGTGTACTCACCGCTGCTGACTCCAACGAGAGGACCGCGCCATGCTCGAGAAGGCCCCC CAGAAGTCTGTCGCCGATTTCTGGTTCGATCCGCTGTGCCCGTGGTGCTGGATCACGTCG bamH1 antisense-menA → CGCT_GGATCC_CCGAAGAACACAAACACCGCCAGCTCGCCGAAGCCCGCATAGCCGTAG GGTTTTGACCCGCCGGTGTAGAGCCAGGCCCCGGCGATGCAGATCGCACCCACCGCAATC AGCCACGGCGCGCTGAGCAGCGCCGAAACCAGCCCGGCCAGCGCACCGAGCGCCAGGCTC GTCATGGCAGCGGTCAGCACCGAGCGCGGGGTCGCCAGCCGCGAGCCCACCAACCGCACC GGACCCACCCTGTCGTCATCGGTGCCGCGGATGCCGTCGGAGTAGTCATTGGCGTAATTG ACCCCAATGACCAGCGCCACCGCAACAGCCAGTGCCAACAGCGCTTTCCACCACACGGCC GCGTGCAGCCAGGCCGCGGCGCCGGTGCCGGCAACCACTGGCGCGATCGCGTTCGGCAGC GTTCGGGGCCGCGCGCCGGAGACCCACTGTGCGAAACTGGCCACCAGGGCATCCTGCCCT ATGCACAACAATGGGCGCATGCTCGGAGTGATCGGCGGCAGCGGCTTCTACACCTTCTTT GGGTCGGACACCCGCACAGTCA kpn1 ATTCGGACAC_GGTACC_AAGCTTGATCCGATAACACAGAACAATTN 3’ 86 NarK2-anti-menB construct (Rv0548c) NarK2 → 5’GNTTACAAGCNAAANTTANT_GGGGGACCAGGTTCAGNTCGTGGTNAAATGCATCTTG NGANTGGGGTNAANCTTCCACAAAACAATTCGACCCACCGCGCCGGAGCCCTTCGATAGG GCTTGAANTTCCNGCCACTNGGGTCATTTGTNCGCCAGGGGCGAAAGGTTTGNCACATTG GGGACTTCCGGCCCTAACTGAGCCGGCGCCATCGAAGCCAGGGCTAGCGCATGGCTGTCC sph1 antisense-menB → _AGTACTGGGCCCGCGGATCC_GCATGC_GACCAGACAAATGACCACCTTGGGCATGAAC CGGATCAGCCGCTGCACCTCCAGGATGTGCAACCGGCCGGCGCGGGCGACATCAACCGTG TCCGCGGTGTCTCCGCTGGCGTACTGGTAACCGCTGCGCCCACGAATTCGTTGGTCGCCG CCGGAGCAGAACGCCCAGCCGCCGTCCTTCGGGGACGGCCCGTTGCCGGTCAGCAGCACC ACTCCGACGTCGGGCGACATTCGTGCATGGTCGAGCACCCGGTACAGCTCGTCGACGGTG TGCGGGCGAAATGCGTTGCGCACTTCAGGGCGGTTGAACGCCTCCCGCACCGTGGCATCG TCGACGTGGCGGTGGTAGGTGATGTCGGTCAGATCGTCGAACCCGTCCACGAGCCGCCAC GCCTTGGCATCAAAAGGGTTGTCACTCAAGGCTGTTGAACTCCGTCCTTGTTCGCCGGCT GGAGCCACCACGGCGATCTGATCCGTTCACCCATGCCTGCCACAGTAATCATGGCCGCTG GGCGTCAGCCGGACGGTATGGTGCCCGGGGCCTTGGTC kpn1 ACATGTGGTCGTGA_GGTACC_AAGCNTGATCCGATAACACAGAANAANNTNT 3’ 87 NarK2-anti-menC construct (Rv0553) NarK2 → 5’NCNAAANGTTANANNNAAANNATT_GGGNANCAGTTNACTCCTGTNNNANGCATNCTG GGAATGGGGGTAACTCCACAAAAAATTCGACCACCGGGCCGGANNCNTNCGATANGGCCT GAATTCCNGGCCACTGGGNTCANTNGTNCGCCAAGGGNGAAAAGTTTGCCACATTGGGGA CTTCCGGCCCTAANTGAGCCGGCGCCATNGAAGCCAGGGCTAGCGCATGGCTGTCC_AGT sph1 antisense-menC → ACTGGGCCCGCGGATCC_GCATGC_ACAGGGTTGTTCAAGGTATTCCAGCGGGCCGTCGG CGGTCAGGGCGGCCGCCGCGGCCACCGCCTCGGCGACACCCCAGCCACCGTTGGCGTCCA CCCGCACCATGGGAACCAGCTCCCGAACCGCGTTGACACGCTCGATGTCGTCGGCCAAGC TCTGCCCAGGCTCGGCGACCTTCACCTTGGCCGTCCGGGCCCCAGGAAACCGGGCCAGCA CCTCGCCCACCTGGGCGGCGGCAACGGCCGGCACAGTGGCGTTAATCGGAACGCGGTCAC GTCGCACCGGCGGCGGCGCACAGTAGGCGGTCTCGATCGCCGACGCCAACCACGCGCACG CCTGCGCGGACTGGTACTCCACGAACGCACCGAATTCGCCCCAACCGGCCGGACCCTCGA TCAAGGCCACTTCACGGGTGGTGATGCCGCGGAAACGCACTCGCATCGGCAGGGCCACAA CATACAGGCGGTCCAGCAGGGCTTCTAGGGGGGGCAGCACGGGTATCACCGCCGATAAAC CTGGCGACCGGCCAGAAACGTCGCCCGCACCGCCAGGTCGGCGATCTGCTCTGGCGGCAC CGTCCGGGGATCCGCCGACAGCACCA kpn1 CCATATTCCGCGTACT_GGTACC_AAGCTTGATCCGATAACACAGAACAATTT 3’ 88 NarK2-anti-menD construct (Rv0555) 5’GGGANCCTAAAGTTCCCTTTTTTATTTAAAAATTTTTTCCAAAAACGNTTACAAGCAT NarK2 → AAAGNT_AGTTGGNGACCAGGTTCAGCTCGCTGGTCATAATGCATCCTTGCGATTGGGTG TAACCTCCACAGACAAATCCGACCACCGCGCCGGAGCCTTCCGATAGGGCCTGAAGTCCC GGCCACTGGGGTCATTNGTCCGCCAGGGGCGAAAGTTCTGCCACATTGGGGACTTCCGGC CCTAACTGAGCCGGCGCCATCGAAGCCAGGGCTAGCGCATGGCTGTCC_AGTACTGGGCC sph1 antisense-menD → CGCGGATCC_GCATGC_CAGGCTGATGCTGGCGCGCACCTGGGTGCCGAAATAGCCCAGC TGTTCCATGGTCTGGTTGGCGCCGGTGCCCAGCAGCTCGTAGGGCCGATTGGCTGACAGC ACGATCAGCGGCACCCGAGCGTAGTTTGCCTCCACCACCGCCGGACCGAGGTTGGCCACG GCGGTGCCGGATGTCATCGCGACACACACCGGCGCGCCCGCCCCGATTGCCAGCCCGATG GCCAGGTAGCCGGCGGTGCGTTCATCGATGCGAACGTGCAACCGGATCCGGCCGGACCGG TCGGCGTCCTGCAGCGCGAAGGCCAGCGGCGCATTGCGCGAGCCCGGACACAGCACCACG TCGCGAACGCCGCCGCGGATCAGTTCGTCGACGACGACGCGCGCCTGTGTCGTCGAGGGG TTCACCAGTACAGAGTGTCACAGCCGGACCGTATGGCCGGGCCGCGCTCAGGCCTTGACA kpn1 CTGGCGAAGAACTTCAGCATCGCGG_GGTACC_AAGCTTGATCCGATAACACAGAACAAN TATT 3’ 89 NarK2-anti-menE construct (Rv0542c) NarK2 → 5’GATTGGGGTAACTCCAANAN_AATTCGACCACCGNGCGGAGCCTTCGATAGGNCTGAA TTCCNGCCACNGGTCATTTTTCCCCAGGGNGAAAGTTTTNCACATTGGGANTTCNGCCCT NAATGAGCCGGCCCATNGAAGCCAGGGCTAGCGCATGGCTNTCC_AGTACTGGGCCCGCG sph1 antisense-menE → GATCC_GCATGC_GAACGCCGTCGTAGACACAGCCGCCCGAGGTCTCGCTCATGCCGTAG GTGCGCACCACCGTGATGCCGGCGGCGGCCGCGGCGTCCAGGATGGGCCGGGGGGCCGGC CCGCCGCCGATCAGCACCGCGTCCAATTCGGCCAGCGCGGCCGTGGCCGCCGGGTCGGTA GTGCCTTGGCCAACTGTGCGGCGACCAGCGACGTGTATCGCCGGCCAGAACCCAATCTCT TTATCGCGTTGGGTAATTCGGTGACATCGAATCCCGCGGAGACGTTCAGTTCGACAGGAA CTGATCCGGCGATCACGCTGCGCACCAGCACCGCCAGCCCGGCGATGTGATACGGCGGCA CAGCCAACAGCCAGCTGCCCGGTCCGCCGAGCCGGTCGTGGGCGGCCGAGGCGCTGGCGG TCAAGGCCGCCGCGGTCAACATGGCGCCCTTGGGCGGTCCCGTGGTTCCTGACGTCGTCA CTACCAGGGCGACGTCGTCGTCAATCTGCTCGCCCACTCGCAAAGCGCCCAGCAAGGACT CATGCTGGGTGGGCACCGCGACCAATGCCGGGTCGCTGCCACCCAGCACTCGTTGCAGGG CAGGCAGCAGCAGCGCGGTAGCAGAACCGGCCGGGACGTGCAGCGCACGCAGGATGGCTA kpn1 TGCGTGC_GGTACC_AAGCTTGATCCGATAACACAGAACAATNTATT 3’ 90 NarK2-anti-entC construct (Rv3215) NarK2 → 5’AATTTTTTCACAAAACGTTTACAAGCATAAAGCTAGT_GTGGNGACCAGGNTCAGTTC GTGGTCATAATGCATCCTTGCGATTGGGGTGTAACCTCCACAGACAAATCCGANCACCGC GCCGGAGCCTTCCGATAGGGCNTGAANTTCCCGGCCACTGGGGTCATTCGTCCGCCAGGG GCGAAAGGTCTGCCACATTGGGGACTTCCGGCCCTAACTGAGCCGGCGCCATCGAAGCCA GGGCTAGC sph1 antisense-entC → GCATGGCTGTCC_AGTACTGGGCCCGCGGATCC_GCATGC_CGAGCACCACTTTGTGCAA CGGGCCGTCGAAGGCGGCCAGCAGATCCCGTGCGCGGCCGATCCGGGTCAGGTAGTCGGC AGGTGGCGGAAGGGCGGCGGCGACGCGTACCTTGGGCAGCGGGCCGGTCGGCCAGTCAGG CAGCTTCCGGGCCCGCAGCACGCCATCCGGCACCATCAATGCGGCGGGTCTGCTCACGTC GAAAGGCAACGCGCCCAACAGTATTGGTGCTGTACCTGAGCGAAGTGCCGCTTGCGCGGC CCGCACGTCGCAGTATCGTGTCCGCACCCCGCGGGCAATCAGGGTGCCTCTTGGTCCGCA CAGTGCGAACGGTGGTTCTGGGTGCAAGGTTGCCACGTGTGCGCTCACCCGGCTGCGATC GGCTGCGGATGACCGGTCAACCCGAGCACGGCGAGCTGACGCACGCCGTGCTCGAACCCG kpn1 CAGATCCCGATCGAGGCGGTGGGCATCGCGAAACGGCTGCCTTC_GGTACC_AAGCNTGA TCCGATAACACAGAACAATTANT 3’ 91 NarK2-anti-menH construct (Rv0558) 5’ TAATTAATTGGGGACCCTAGAGGTCCCCTTTTTTATTTTAAAAATTTTTTCACAA NarK2 → AACGGTTTACAAGCATAAAGCTAGT_GTGGCGACCAGGCTCAGCTCGCTGGTCATAATG CATCCTTGCGATTGGGGTGTAACCTCCACAGACAAATCCGACCACCGCGCCGGAGCCCT CCGATAGGGCCTGAAGTCCCGGCCACTGGGGTCATTCGTCCGCCAGGGGCGAAAGGTCTG CCACATTGGGGACTTCCGGCCCTAACTGAGCCGGCGCCATCGAAGCCAGGGCTAGCGCAT sph1 antisense-menH → GGCTGTCC_AGTACTGGGCCCGCGGATCC_GCATGC_CGACCGAAAAATCGGCAGCCACA CACCACGCGCCCGATTTGGTGAGCTCTACGGTGGACACGGCGGTGCCCGCGGCCAGGTCC AGGACCTTTTGGCCGGGCCCGATCCGCAGCGCCGACCGAGTGGCTCGCCGCCAATACCGG TCCTGGCCCAGGGACAACACGGTATTGGTCAGGTCATACTTGCGGGCGACGCCATCGAAC ATCGACGCCACGTCGCGGGGATCCTTGTCCAAGGCGGCGCGACTCATAGCCTCGACGCTA CCGTTACGCGGCCTGGGTCGTGCGCCGACCTCGCACCGCCTCGTAGTGGCCGAGCAGCTC kpn1 ATCGCAGACCAC_GGTACC_AAGCNTGATCCGATAACACAGAACAA 3’ 92 NarK2-anti-Rv0560c construct NarK2 → 5’AAAATTTNCAAACGTTNNAAANAANTAT_TGGGGACAGNTCACTCCTGTNAAANAATC NTGGATGGGGGTAACTCCACANAAAATTCGACCACCGGGCNGAANCNTNCGATAGGGCCT NAATTCCNGCCACTGGGTCATTCGTNCGCCAGGGGNGAAAGTTTTGCCACATTGGGGACT TCCGGCCCTAANTGAGCCGGCGCCATNGAAAGCCAGGGCTAGCGCATGGCTGTCC_AGTA sph1 antisense-Rv0560c → CTGGGCCCGCGGATCC_GCATGC_CCAACACGAAGTAGGAGGCGCCCGGTGCCGCCGCAC GCACGATCGATTGCAGATCGCCCTCCCGGGACTCGACCGGCATGGAGTGGAACAGTGTGC TGTCGACGATGGTGTCGAACCTGCCGTCATAGCCGGTAAACGAACTGGCGTCGGCCACCT CGAAGCTGGCATTGGCCAGGCCGCGCTTCGCTGCTTCATGCCGAGCCAGTTCTACGGCGG CGGGGGAGAGGTCCAGTCCGACCGTGGTGTGTCCCCGTTCGGCCAGTGCCAGCGAAATCG CGGCCTCCCCGCAGCCCACGTCGAGGACGTCGCCGCGGAACTTGCCCTGCACGAACAGGG CGGCCAGCTCGGGCTGGGGTTCGCCGATGCTCCATGGCGGTCGGACTCCCTCCCCGAAGG CGACGGATTCACCGCGGTAGGCGGATTCGAACTCAAGATCCAGCGATTCAGTCATGTGTT CATATATATCAACGGCCCTGATATATGTCAACACAGTTGACATTCGCGCACCCTTGGTTG CCGGCCGTCAGCTGAACGGCGGTCGTCGATCGACGAGCCGGGACAATTGACCGCCACCGC GCCACACCCGCGCCACCCAGTCGCGGTCGTCGTCGGTGACCAGATTGGACATCACCCGCA kpn1 _GGTACC_AAGCNTGATCCGATAACACAGAACAGATTTA 93 [...]... conversion of chorismate to isochorismate presumably performed by the enzyme EntC is the first dedicated step in the synthesis of menaquinone in mycobacteria The ORF entC has an entirely different genomic location than all other enzymes involved in biosynthesis of menaquinone and is thought to replace the function of the enzyme MenF that produces isochorismate for the biosynthesis of menaquinone in plants... mycobacteria 15 1.3.5 Antisense RNA approach To investigate whether inhibition of menaquinone synthesis during dormancy results in death of the bacteria, a technique termed antisense RNA inhibition was employed This approach was chosen because knockouts of these genes are probably not viable (42) and thus would not allow the investigation of the role of menaquinone synthesis during dormancy and its... focusing on the involved enzymes The focus of this study lies on the synthesis of the aromatic portion of menaquinone The synthesis of the specific head group of menaquinone involves seven steps catalyzed by seven enzymes (Figure 6) encoded by menA, menB, menC, menD, menE, menF (entC) and menG (4) Homologues for all these genes characterised in E coli have been found in mycobacteria except for menF The. .. and of mobile quinones that can diffuse along the membrane and shuttle electrons from one complex to another Some of the protein complexes, called dehydrogenases, accept electrons from NADH on the inside of the cell and hand them over to menaquinones, which in turn deliver the electrons to other protein complexes, the oxidases or reductases In a final step, oxidases pass the electrons on to the terminal... feed electrons into the chain (Figure 4) NDH1 is a proton-pumping NADH-dehydrogenase, which is down-regulated during NRP1, whereas the production of the non-proton pumping NDH2 is increased, with the result that the proton motive force is lessened and ATP production reduced, indicating a cut in energy requirements (51) The only detectable quinone in mycobacteria is menaquinone (MK) Menaquinone acts as... bacteria in the gut, in order to produce a cofactor involved in carboxylation of glutamic acids in enzymes of the coagulation cascade This carboxylase activity is crucial for effective blood clotting and lack of menaquinone can lead to uncontrolled haemorrhage Menaquinone is thus also known as Vitamin K (for the first letter in the German word “Koagulation” meaning coagulation) Different species of menaquinone. .. at the right point As has been mentioned earlier, it is poorly understood what metabolic activity is needed to ensure that the cellular membrane of M tuberculosis remains energized during NRP2 We intend to investigate whether menaquinones play a central role in these processes 1.3.3 Menaquinone (MK) As mentioned in section 1.3.1, quinones constitute the mobile element of the respiratory chain There... bacterial survival The expression of antisense RNA on the other hand can be conditionally induced after the bacterial culture has reached an adequate density Inhibition is achieved by the antisense RNA strand’s ability to hybridize to its mRNA counterpart, thus forming double stranded RNA and inhibiting its translation In order to make the inhibition of translation more efficient, the cloned antisense sequences... promoter gains activity in NRP2 (Srinivasa Rao, personal communication) 1.3.7 Mass spectrometry analysis In this study, lipid extracts of M bovis BCG cells were analyzed using mass spectrometry, in order to detect and quantify levels of menaquinone Detection of a reduction in menaquinone levels in the transformants upon dormancy would support the assumption that antisense inhibition of menaquinone synthesis... in such a fashion that the PCR products would contain approximately a 100 bp part of the upstream region of each gene including the Shine-Dalgarno site and about a third of the coding region of the genes of interest The Shine-Dalgarno sequence allows mRNA to establish contact with the ribosome and is crucial for efficient translation Additionally, two dissimilar restriction sites were attached to the ... Investigating the role of menaquinone metabolism in dormant mycobacteria by antisense RNA Thomas M Fiedler (BSc.) A thesis submitted for the Degree of Master of Science in Infectious... research focusing on the involved enzymes The focus of this study lies on the synthesis of the aromatic portion of menaquinone The synthesis of the specific head group of menaquinone involves seven... S-adenosyl-Lhomocysteine Menaquinone O S-adenosyl-Lmethionine O 2-phytyl-1,4-naphtoquinone Figure 6: Menaquinone synthesis in mycobacteria 15 1.3.5 Antisense RNA approach To investigate whether inhibition of menaquinone