ELUCIDATING THE ROLE OF BNIP 2 IN ZEBRAFISH EARLY DEVELOPMENT

ROLE OF BNIP-2 IN ZEBRAFISH EARLY DEVELOPMENT CHUA SEE KIN DOREEN (B.Sc.(Hons.), NTU A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2013 ACKNOWLEDGEMENTS The course of my Master’s studies has been a rollercoaster ride of ups and downs - joys and disappointments, achievements and failures - but I’m thankful for all of it, for it has been a moulding process for my character and as a researcher. I would like to acknowledge important ones who have helped me in my journey to be a better person and scientist. Firstly, I would like to express my utmost thanks and appreciation to Assoc. Prof Low Boon Chuan for giving me the privilege of being his student and for believing in me. I am grateful for the warmth, enthusiasm, guidance and encouraging pep talks I have received from a brilliant scientist and teacher. I thank also Tiweng, my teacher in the lab for his patience and time spent in guiding me through my experiments. Thanks to all members of LBC lab for your friendliness and help extended over the course of my studies. I would like to sincerely thank Prof Gong Zhiyuan for graciously and generously providing me space in his laboratory to perform my experiments in the final leg of my studies. Thanks to all in the GZY lab for all the help rendered to me. I thank also Lora Tan for her generosity in giving me useful tips and for her friendship in the lab. Thanks also to Mr. Balan from the zebrafish aquarium for the chats, his helpfulness and his responsibility in helping to supply zebrafish embryos. To my family and Samuel, thanks for your full support and understanding, and for taking good care of me throughout it all. I share this achievement with you. To Him be all glory. i TABLE OF CONTENTS Acknowledgements i Table of contents ii List of Figures vi List of Abbreviations viii Summary x Chapter 1. Introduction 1 1.1 BNIP-2 1 1.1.1 Early discoveries of BNIP-2 1 1.1.2 BNIP-2 and cell dynamics 2 1.2 Bioinformatic analyses of the BCH domain 4 1.3 BCH domain containing-proteins and cell dynamics 7 1.4 Zebrafish, a model organism 10 1.5 Zebrafish early developmental stages 12 1.5.1 Zygote period 12 1.5.2 Cleavage period 12 1.5.3 Blastula period 12 1.5.4 Epiboly period 13 1.5.5 Gastrula period 14 1.5.6 Convergence and Extension (C&E) movements 14 1.6 Rationale and Objectives 18 1.7 Experimental Rationale and Approaches 20 1.7.1 bnip-2 knockdown by morpholino phosphorodiamidate 20 ii antisense oligonucleotides 1.7.2 Investigating potential bnip-2 interacting genes – E-cadherin, 27 RhoA, Cdc42 2. Materials and Methods 28 2.1 Fish Spawning and Maintenance 28 2.2 Molecular Biology Techniques 28 2.2.1 RT-PCR Molecular Cloning 28 2.2.2 Polymerase Chain Reaction (PCR) 29 2.2.3 Agarose Gel Electrophoresis 29 2.2.4 Purification of DNA Fragment From Agarose Gel 30 2.2.5 DNA Ligation 30 2.2.6 Growth, preparation and transformation of competent E.coli cells 30 2.2.6.1 Growth of E. coli cells in liquid and solid media 30 2.2.6.2 Preparation of competent E. coli cells 31 2.2.6.3 Transformation of competent E. coli cells 31 2.2.6.4 Colony Screening 32 2.2.7 Plasmid DNA Isolation and Purification from Bacterial Cultures 32 2.2.8 Restriction endonuclease digestion of plasmid DNA 32 2.2.9 DNA sequencing 33 2.2.9.1 PCR Cycle sequencing 33 2.2.9.2 Automated sequencing 33 2.2.9.3 Sequence Analysis 34 2.3 Analysis of Gene expression 34 iii 2.3.1 Whole mount in situ hybridization 34 2.3.2 Synthesis of digoxigenin labeled antisense RNA Probes 35 2.3.2.1 Linearisation of plasmids 35 2.3.2.2 Probe Synthesis - RNA labeling by in vitro transcription 35 2.3.3 Collection and Preparation of zebrafish embryos 35 2.3.4 Pre-hybridisation and Hybridisation 35 2.3.5 Incubation with antibody 36 2.3.5.1 Preparation of pre-absorbed Digoxigenin-Alkaline Phosphatase (DIG-AP) antibody 36 2.3.5.2 Incubation with pre-absorbed anti-DIG-AP antibody 36 2.3.6 Washing, Staining with NBT/BCIP and Fixation 37 2.3.7 Mounting & visualisation 37 2.3.8 Immunofluorescence 37 2.4 Protein Expression Studies 38 2.4.1 Protein extraction from zebrafish embryos 38 2.4.2 Sodium Dodecyl Sulphate-Polyacrylamide gel electrophoresis 39 (SDS-PAGE) 2.4.3 Western Blot analysis 39 2.4.4 G-LISA Assay 40 2.5 Functional Studies 41 2.5.1 Design and preparation of translational morpholinos 41 2.5.2 Microinjection 41 2.5.3 Synthesis of capped RNAs 42 2.5.3.1 Construction of pCS2–bnip-2b and pCS2-bnip2c for 42 iv mRNA synthesis 2.5.3.2 Linearisation of plasmids for mRNA synthesis 42 2.5.4 Statistical analysis 43 3. Results 44 3.1 bnip-2 knockdown elicits defects in epiboly and C&E processes 44 3.2 bnip-2 mRNA suppresses gastrulation defects in bnip-2 knockdown 57 morphants 3.3 bnip-2 knockdown causes abnormalities in epibolic mechanisms 61 3.4 bnip-2 knockdown causes increased RhoA activity 66 3.5 bnip-2 knockdown increases myosin light chain-2 phosphorylation 74 3.6 bnip-2 knockdown disrupts E-cadherin membrane localisation 75 3.7 Dominant-negative rhoA restores membrane-localised E-cadherin in 81 morphants and rescues gastrulation defects 4. DISCUSSION 84 4.1 bnip-2 is required for C&E processes 84 4.2 Regulation of RhoA and E-cadherin by Bnip-2 is required for epiboly 88 5. Future work 93 6. Conclusion 96 7. References 99 v LIST OF FIGURES Chapter Figure 1 1 1 2 1 3 1 4 3 1 3 2 3 3 3 4 3 5 3 6 3 7 3 8 3 9 3 10 3 11 3 12 3 13 3 14 3 15 3 16 3 17 3 18 Description Page Domain architecture and classifications of BCH-domain 6 containing proteins. The four domains of mesodermal C&E movements in the zebrafish gastrula and their characteristic underlying 17 cell movement behaviours. Description of morpholinos used for functional rescue 26 experiments. Schematic outline of experiments performed to elucidate 26 bnip-2’s function in zebrafish. bnip-2 knockdown elicits defects in epiboly and C&E 51 movements. bnip-2 knockdown by morpholino causes epiboly delay. 52 Control MO-injected embryos that show epiboly delay display higher percentage of abnormalities at the 153 somite stage. bnip-2 MO1-injected embryos that show epiboly delay display higher percentage of abnormalities at the 153 somite stage. bnip-2 MO2-injected embryos that show epiboly delay display higher percentage of abnormalities at the 154 somite stage. Control MO-injected embryos that show abnormalities 54 at the 1-somite stage or epiboly arrest display. bnip-2 MO1-injected embryos that show abnormalities 55 at the 1-somite stage or epiboly arrest display. bnip-2 MO2-injected embryos that show abnormalities 55 at the 1-somite stage or epiboly arrest display. Analysis of marker gene expression in control and bnip56 2 morphant zebrafish embryos. bnip-2 morphants embryos are categorised according to 59 severity of phenotype. bnip-2 knockdown by morpholino is dose-dependent. 59 bnip-2 morphant phenotype could be rescued by bnip-2 60 mRNA. bnip-2 morphant EVL cells display cell shape defects. 63 bnip-2 morphant EVL cells display actin ring 63 abnormality. bnip-2 morphant EVL marginal cells display defects in 64 cell shape changes. bnip-2 morphants display separation of EVL-DEL 65 during late epiboly bnip-2 morphants have higher RhoA activity. 70 bnip-2 morphant phenotype is aggravated by 71 constitutively active rhoA mRNA. vi 3 19 3 20 3 3 21 22 3 23 3 24 3 25 3 26 3 27 3 28 3 29 3 30 6 1 bnip-2 morphant phenotype is suppressed by dominant negative rhoA mRNA. No change in bnip-2 morphant phenotype with wild type rhoA mRNA. Proposed explanation of 3.5 Results. bnip-2 morphants have higher MLC-2 activity. bnip-2 morphant EVL cells display reduced membranelocalised E-cadherin. e-cadherin MO knockdown elicits defects in epiboly and C&E movements. Synergy of bnip-2 and e-cadherin MO knockdown in eliciting epiboly defects. Synergy of bnip-2 and e-cadherin MO knockdown in eliciting C&E defects. Synergy of bnip-2 and e-cadherin MO knockdown in reducing EVL membrane-localised E-cadherin. Dominant negative rhoA mRNA is able to restore membrane-localised E-cadherin to bnip-2 MO and ecadherin MO synergistic knockdown of membranelocalised E-cadherin. Dominant negative rhoA mRNA rescues epiboly defects phenotype arising from synergy between bnip-2 and ecadherin knockdown. Dominant negative rhoA mRNA rescues C&E defects phenotype arising from synergy between bnip-2 and ecadherin MO knockdown. Summary of findings and proposed mechanistic links. vii 71 72 72 74 77 78 79 79 80 82 82 83 98 LIST OF ABBREVIATIONS AP BCH BCIP BNIP bmp4 Bp BSA cDNA CE DEL DEPC DIG dlx3 DMSO DNA dNTP DTT EDTA eve1 EVL E-YSL F-actin FCS g GDP GEF eGFP GTP hgg1 hpf I-YSL kb LWR M min mGFP ml MO mRNA NBT ng ntl OD papc PBS PBT PCR alkaline phosphatase BNIP-2 and Cdc42GAP homology domain 5-bromo-4-chloro-3-indonyl phosphate bcl-2/adenovirus E1B Nineteen kilo-daltons interacting protein Bone morphogenetic protein 4 base pairs bovine serum albumin DNA complementary to RNA convergence and extension deep cell layer diethylpyrocarbonate digoxigenin distal-less3 dimethylsulphoxide deoxyribonucleic acid deoxyribonucleotide dithiothreitol ethylenediaminetetraacetic acid even-skipped 1 enveloping layer external yolk syncytial layer filamentous actin fetal calf serum gravitation force guanine diphosphate guanine nucleotide exchange factor enhanced green fluorescent protein guanosine triphosphate hatching gland 1 hours post fertilisation internal yolk syncytial layer kilo base pair length-to-width ratio mole per litre minute membrane green fluorescent protein millilitre morpholino messenger ribonucleic acid 4-nitroblue tetrazolium chloride nanogram no tail optical density paraxial protocadherin phosphate buffered saline phosphate buffered saline + 1% Tween 20 polymerase chain reaction viii PFA pg RE rpm RT RT-PCR sec SSC SSCT TAE UTR UV V vol wt WT WISH YSL syncyti al layer paraformaldehyde picogram restriction enzyme revolutions per minute room temperature reverse transcription polymerase chain reaction second sodium chloride-trisodium citrate solution (2XSSC plus 0.1% Tween 20) tris acetate-EDTA untranslated region ultraviolet volt volume weight Wild type whole-mount in situ hybridisation Yolk syncytial layer ix SUMMARY BNIP-2, first discovered as an interacting partner of the pro-survival Bcl-2 and viral E1B 19kDa protein, has been shown in cellular model systems to interact with diverse proteins for the regulation of various signalling pathways leading to cell growth, apoptosis, morphogenesis and differentiation. In order to explore its potential role in development to gain further insight into its physiological function, in vivo functional studies on bnip-2 were conducted using translational-blocking morpholino-based knockdown in zebrafish - a model organism selected for its high fecundity, the optical transparency and ease of access to embryos. The process of gastrulation, in which widespread cellular movements and behaviours occur, was examined in particular because BNIP-2 is known through cell culture studies to regulate cell dynamics. bnip-2 knockdown morphants displayed rescuable gastrulation defects such as delayed or arrested epiboly, and disrupted convergence-extension (C&E) movements leading to impaired axial extension and abnormal mediolateral widening of axial and paraxial mesodermal tissues. Furthermore, at late epiboly stages, anomalies such as separation of the enveloping layer (EVL) from the deep cells, abnormal morphology of EVL marginal cells and a widened actin band in the yolk syncytial layer were observed. Overexpression of a constitutively active form of rhoA, a key regulator of actin cytoskeletal dynamics, aggravated the bnip-2 morphant phenotype, while that of dominant negative rhoA attenuated the phenotype severity of bnip-2 morphants in which upregulated RhoA activity and phosphorylated myosin light chain 2 was found. In addition, cell membrane localisation of E-cadherin in the EVL was disrupted, and synergy between e-cadherin and bnip-2 morpholinos in x eliciting the bnip-2 morphant phenotype was observed. Dominant negative rhoA could suppress the bnip-2 morphant phenotype caused by synergy between e-cadherin and bnip-2 morpholinos. In summary, these results reveal that bnip-2 is required for normal gastrulation movements, and that its role involves, at least in part, the regulation of the membrane localisation of E-cadherin through the modulation of RhoA activity. In conclusion, this work introduces a novel molecular player in gastrulation, bnip-2, which may also be a new link between cell dynamics and development. These findings shed some light on the genetic interactions of bnip-2 and their possible roles in mechanisms underlying zebrafish gastrulation, and thus contribute insight into the molecular mechanisms underlying the regulation of cell dynamics by bnip-2. xi 1. Introduction 1.1 BNIP-2 1.1.1 Initial discoveries of BNIP-2 The Bcl-2/adenovirus E1B Nineteen kilo-daltons Interacting Protein-2, or BNIP-2 in short, was initially discovered as one of three novel proteins, Nip1, Nip2 and Nip3, in a bid to identify interacting proteins of the antiapoptotic adenovirus E1B 19kDA protein (Boyd et al., 1994). The E1B 19kDA protein functions to prevent host cell activation of cell death programmes in order to allow viral replication during viral infection. BNIP-2, or Nip-2 as it was called then, was hypothesised to be involved in the promotion of cell survival due to their direct interactions with both the antiapoptotic Bcl-2 and E1B 19kDa proteins. More recently, the Nip proteins have been classified as pro-apoptotic members of the Bcl-2 family of proteins due to their possession of the conserved Bcl-2 homology domain 3 (BH3), which promotes dimerization of Bcl-2 family members (Zhang et al., 2003). After its initial discovery, further investigations on BNIP-2 were made when it was found to transiently interact with the cytoplasmic tail of the Fibroblast Growth Factor Receptor-1 (FGFR-1) via an yeast-two-hybrid assay (Low et al., 1999). Subsequently, it was verified to be a bona fide substrate of FGFR that is tyrosine-phosphorylated upon FGFR stimulation by FGF in in vitro and cell culture contexts. Bioinformatic analyses revealed strong homology (61% similarity) between the N-terminus of BNIP-2 and the Cterminus non-catalytic domain of Cdc42GAP (otherwise known as p50RhoGAP), a GTPase-activating protein for Cdc42. This region at the Nterminus of BNIP-2 was later named the BNIP-2 and Cdc42GAP homology 1 domain (BCH) (Low et al., 2000). Further, it was found that the BCH domain, via its 217 RRKMP221 region, mediates homo- and heterocomplex formation between BNIP-2 and Cdc42GAP, but the interaction is prevented by tyrosine phosphorylation of BNIP-2 (Low et al., 2000). Between BNIP-2 and Cdc42GAP, there is also competitive binding to Cdc42. Strikingly, via the BCH domain, BNIP-2 also binds and promotes the GTPase-activity intrinsic to Cdc42 via a novel arginine patch motif, 235 RRLRK239, similar to the “arginine finger” employed by one contributing partner in a Cdc42 homodimer, and this too, is inhibited by tyrosine phosphorylation of BNIP-2 (Low et al., 2000). The BCH domain in Cdc42GAP does not have GAP activity to Cdc42 as it lacks the arginine patch. Therefore the BNIP-2 interactome discovered from these early studies hinted at BNIP-2’s involvement in a variety of pathways such as tyrosine kinase receptor signalling, GTPase-mediated signalling pathways and apoptosis, and suggested physiological significance that should be further looked into. 1.1.2 BNIP-2 and cell dynamics The physiological significance of BNIP-2’s interactions with Cdc42 came to light in a later study that overexpressed BNIP- 2 in MCF-7, HeLa, and COS-1 cells. Dramatic cell morphological changes were elicited by BNIP-2 overexpression, including cell elongation and the formation of membrane protrusions at the sites of its localisation (Zhou et al., 2005). Such changes were dependent on the recruitment of Cdc42 by the BCH domain, and were 2 effectively suppressed by the co-expression of dominant negative mutant forms of Cdc42 (Zhou et al., 2005). Unpublished work by the same laboratory showed that by activation of Rho, BNIP-2 had an inhibitory effect on MDCK epithelia cell spreading and retarded collective cell migration in a wound healing assay (Pan and Low, 2012). In addition, the binding of BNIP-2 to BPGAP1 potentiated the latter’s GAP activity towards Rho and reduced cell proliferation (Pan and Low, 2012). In addition, imaging studies to measure the activity of BNIP-2 or BCH domain alone in cells showed that BNIP-2 and BCH domain are dynamically distributed between endosomes and cell protrusions along the microtubules, and they were most active at protrusive tips (Pan and Low, 2012). Moreover, BNIP-2 has a kinesin-binding motif which is necessary for its trafficking in cells (Aoyama et al., 2009). These observations strongly support the role of BNIP-2 in the regulation of GTPase signalling and cell dynamics, and the versatility of BNIP-2 in engaging different Rho GTPases and their GAPs and GEFs suggest that BNIP-2 is involved in regulating GTPase signalling in a contextdependent manner (Pan and Low, 2012). 3 1.2 Bioinformatic analyses of the BCH domain The BCH domain was first discovered as a region of strong homology between BNIP-2 and Cdc42GAP but was subsequently found to have 14% sequence identity with the lipophilic CRAL_TRIO domain of the Saccharomyces cerevisiae Sec14p protein (Bankaitis et al., 2010). The CRAL_TRIO domain is also present in the cellular retinaldehyde binding protein (CRALBP) and Trio, a RhoGEF (Bankaitis et al., 2010). Similar protein domains can be found in other proteins such as tyrosine phosphatase, α-tocopherol transfer protein and others RhoGEFs such as Duo and Dbs (Gu et al., 1991, Min et al., 2003, Aravind et al., 1999, Pan and Low, 2012). Although these domains in some of these proteins bind small hydrophobic ligands, BCH domains are not known as yet to be lipophilic (Panagabko et al., 2003, Pan and Low, 2012). More recently, through genome-wide, crossspecies bioinformatic analyses of CRAL-TRIO and similar domains, and putative BCH sequences, the BCH domains have emerged as a novel subclass under the CRAL-TRIO superfamily (Gupta et al., 2012). BCH domains have been recognised in a large variety of proteins from diverse species including slime molds, plants, yeasts, insects, fish to human (Gupta et al., 2012). Further gene-structure and protein domain context analyses reveal that BCH domain sequences can undergo alternative RNA splicing, leading to, for example, splicing variants of BNIP-2, BNIP-2-Similar and BNIP-2 Extra Long (Zhou et al., 2002, Soh et al., 2008). Proteins containing the BCH domains can be subdivided into three groups: Group 1 members are defined by the presence of a single BCH domain that has the high amino acid sequence identity to the prototypical 4 BNIP-2 BCH domain compared to the other groups, Group 2 members possess a BCH domain that is associated with the macro domain, and Group 3 members contain a BCH domain associated with a RhoGAP domain (Pan and Low, 2012). The list of BCH-containing proteins can be found in Figure 1.1. 5 Figure 1.1: Domain architecture and classifications of BCH-domain containing proteins. Proteins containing the BCH domains can be subdivided into three groups: Group 1 members are defined by the presence of a single BCH domain that has the high amino acid sequence identity to the prototypical BNIP-2 BCH domain compared to the other groups, Group 2 members possess a BCH domain that is associated with the macro domain, and Group 3 members contain a BCH domain associated with a RhoGAP domain (Pan and Low, 2012). The percentages indicate the degrees of amino acid sequence identities compared to the prototypical BNIP-2 BCH domain. This figure is adapted from Pan and Low, 2004. 6 1.3 BCH domain containing-proteins and cell dynamics There is significant conservation in two GTPase-binding motifs found in the BCH domains. These motifs resemble the Rho-binding domain (RBD) and the Cdc42/Rac interactive binding domain found commonly in Rho and Cdc42/Rac1 effector proteins, respectively (Pan and Low, 2012). In particular, the BNIP-2 BCH domain contains within the CRIB-like region an experimentally validated novel Cdc42-binding motif, 285VPMEYVGI292, while BNIP-S, BNIP-XL and Cdc42GAP possess RBD-like motifs. These GTPasebinding motifs have been found to mediate cell morphogenesis, migration and differentiation. BNIP-H expression is highly specific to the brain and concentrates in the cerebellum and hippocampus (Buschdorf et al., 2006) Mutations in BNIPH gene, two of which are predicted to cause defects in the BCH domain, are associated with the Cayman cerebellar ataxia disease (Bomar et al., 2003). The protein targets for BNIP-H include the heavy chain of kinesin-1 motor, Rab small GTPases, Mek and Pin1 isomerase (Pan and Low, 2012). BNIP-H functions like an adaptor in transporting mitochondria in the kinesin-1 light chain along neuritis (Aoyama et al., 2009). BNIP-H has also been shown to bind a kidney-type phosphate-activated glutaminase (KGA) that is a metabolic enzyme responsible for glutamate production, and relocalise it to the tips of neurons (Buschdorf et al., 2006). Unlike BNIP-2 which interacts with Cdc42, BNIP-H targets mainly Rab GTPases and can be observed colocalising with these GTPases in endosomes and along neurites (Pan and Low, 2012). BNIP-XL is one of four major isoforms, isoform-4, encoded via differential initiation sites from the BMCC1 gene, a gene which has been 7 linked to human pathologies such as prostate cancer (Clarke et al., 2009), Alzheimer’s disease (Potkin et al., 2009) and leiomyosarcomas (Price et al., 2007). Like isoforms-1 and -3, BNIP-XL contains the BCH domain. It can undergo alternative splicing to generate BNIP-XLα and BNIP-XLβ (Figure 1.1) (Pan and Low, 2012). Among BNIP-2, BNIP-Sα, BNIP-H and BPGAP1, BNIP-2 is the protein BNIP-XL has the closest homology to. However, its BCH domain is most similar to that of BNIP-H. BNIP-XL has been proven to affect actin cytoskeletal reorganisation (i.e. formation of stress fibers) and antagonise Rho-mediated cellular transformation (Soh et al., 2008). In that study, it was shown that the BCH domain of BNIP-XL interacts with RhoA (as well as RhoC), and mediates association of BNIP-XL with the catalytic domains of Lbc, a RhoA-specific GEF (Soh et al., 2008). The knockdown of BNIP-XL increased active RhoA levels, while its overexpression reduced it. Therefore, BNIP-XL suppresses cellular transformation by restricting RhoA and Lbc binding, thus preventing sustained Rho activation (Soh et al., 2008). It was surmised that this could be a general mechanism for regulating Rho GTPases and their regulators RhoGEFs (Soh et al., 2008). BNIP-S share 72% similarity with BNIP-2 and its BCH domain has a high sequence homology of 86% similarity with the BCH Domain of BNIP-2 (Zhou et al., 2002). Overexpression of BNIP-S leads to BCH domainmediated extensive cell rounding and consequently, apoptosis independent of the action of caspases. This apoptotic effect can be suppressed by coexpression of dominant negative RhoA, thus suggesting that the apoptotic effect of BNIP-S is mediated by active RhoA (Zhou et al., 2006). Indeed, BNIP-S causes cell rounding and apoptosis by sequestering Cdc42GAP, thus negatively regulating its activity, and capturing RhoA for further activation. 8 BNIP-S, however, does not bind Rac1, Cdc42 and GTP-bound RhoA, binding only GDP-bound RhoA. Cdc42GAP and its homolog BPGAP1, are BCH domain-containing RhoGAPs which negatively regulate Rho GTPases, specifically Cdc42 and Rho, by activating their intrinsic GTPase activity, thus converting them from the active GTP-bound state to the inactive GDP-bound state. It has recently been shown that the BCH domain in Cdc42GAP, which contains a novel RhoA-binding motif, serves as a local modulator to sequester RhoA to prevent it from being inactivated by its proximal GAP domain (Zhou et.al., 2010). BPGAP1 activates cell protrusions and cell migration, mediated by cooperation between its BCH domain, a proline-rich region (PRR) and a GAP domain (Shang et al., 2003). The BCH domain of BPGAP1 elicits Cdc42/Racmediated cellular protrusions that enable its association with cortactin, which helps form branching actin network, and endophilin-2, which binds to the PRR region, for the exertion of its function (Lua et al., 2004, Lua et al., 2005). 9 1.4 Zebrafish, a model organism The zebrafish is a small and hardy freashwater tropical fish native to the waters in India. As a model organism, it offers several attractive practical advantages. It is easily available; it can be purchased in local commercial aquariums. In terms of husbandry, it has a relatively low maintenance cost compared to model organisms such as the mouse and the rat, which require more expensive and greater infrastructure. Its small size allows for easy handling, and its short generation time of approximately three months allows for relatively quick generation of transgenic lines. Furthermore, the zebrafish has high fecundity, thus allowing sufficient material and a large sample size for statistical power in experiments. The zebrafish was the first vertebrate that proved to be tractable to large-scale genetic screening most often conducted using fruit flies and worms (Fishman, 2001). This is partly due to easily discerned phenotypes generated by random chemical or radiation mutagenesis. The zebrafish has a powerful advantage over fruit flies and worms as it is a vertebrate. Invertebrates do not have direct analogs of biological systems found in vertebrates, such as a multichambered heart, neural crest cells and derivatives and kidney, thus imposing limitations on the study of embryology, neurorobiology and endocrinology (Dooley and Zon, 2000). Furthermore, the molecular components of signalling pathways discovered by genetic screening in invertebrates cannot be simply extrapolated to vertebrate structures. For example, lipids which control germ cell migration in fruit fly development, control heart precursor cell migration in the developing zebrafish. Also, since vertebrate developmental programmes are similar, the zebrafish is also useful for studying human development. The 10 mouse, despite being a vertebrate, has its own disadvantages. The development of mouse embryos within the mother’s uterus makes it inaccessible for experimental manipulation and analyses, thus causing inconvenience to the study of early development genes. In contrast, zebrafish embryos develop externally, thus allowing convenient access for manipulation and observation of early development, especially since they are optically transparent. Therefore, developmental or phenotypic real-time analyses can be made to the level of internal organs, and even the cell, during embryogenesis. In exploitation of the optical transparency of the zebrafish embryo, technologies such as fluorescently tagged proteins and fluorescent resonance energy transfer (FRET) and cellular transplantation have been developed for the physical tracking of cells or proteins, or for the monitoring of protein activity in the zebrafish embryo. In addition, the zebrafish is permeable to small molecules in its aqueous environment, thus making it useful for the study of interactions between gene and environment (Fishman 2001). The zebrafish is also useful for the study of human diseases since most human genes have orthologs in zebrafish, and with parallel organ systems and the conservation of body in vertebrates, zebrafish models for human diseases have been possible by mutations in orthologous zebrafish genes. Although zebrafish are tetraploid due to a genomic duplication event during evolution, there was subsequent functional specialisation of some duplicated genes and loss of other genes, such that where evaluated, duplicated genes are not redundant in function, but rather, subdivide the function of the ancestral gene (Fishman 2001). 11 1.5 Zebrafish Early Developmental Stages 1.5.1 Zygote period The zygote period starts from the newly fertilised egg and ends when the first cleavage occurs (Kimmel et al., 1995). After fertilisation, the chorion swells away from the egg, and cytoplasmic streaming, the movement of nonyolky cytosplasm towards the animal pole to segregate the blastoderm from the yolk-granule-rich vegetal cytoplasm, is activated. This segregation continues into early cleavage stages. 1.5.2 Cleavage period During the cleavage period, the blastomeres undergo divisions that are meroblastic, i.e. the cell divisions incompletely undercut the blastoderm, and the blastomeres or a specific subset of them remain interconnected by cytoplasmic bridges (Kimmel et al., 1995). 1.5.3 Blastula period The blastula period is marked by the ball-like appearance of the blastoderm at the 128-cell stage, and ends at the onset of gastrulation. During the period, the embryo enters the midblastula transition (MBT), the stage in which zygotic gene transcription is activated, the yolk syncytial layer forms, and epiboly begins (Kimmel et al., 1995). The yolk syncytial layer is formed by the deposition of nuclei and cytoplasmic contents by the collapse of the marginal tier of blastomeres in the early blastula. The new marginal tier of blastomeres, unlike their predecessors, is non-syncytial. The YSL nuclei undergo mitotic divisions but remain syncytial. Initially, the YSL forms a narrow ring around the blastoderm edge, but within two division cycles, it 12 moves beneath the blastoderm to form the internal-YSL (I-YSL) which remains through embryogenesis to possibly play a nutritive role. A portion of the YSL remains external (E-YSL), and it is currently understood to play an important role in driving epiboly. 1.5.4 Epiboly Epiboly is the first major morphogenetic process of gastrulation to shape the developing embryo (Kimmel et al., 1995). Just before the onset of epiboly, the late blastula consists of three main tissue layers – an outermost single cell epithelial layer termed the enveloping layer (EVL) that covers the blastoderm deep cell layer (DEL), and an innermost yolk syncytial layer (YSL) which the EVL is tightly attached at its margin to. Epiboly is initiated at the sphere stage and epibolic movements thin and spread all three tissue layers vegetally such that the initial mound of cells sitting atop the yolk becomes a cell multi-layer of nearly uniform thickness, and the yolk cell is covered all around completely (100% epiboly), marking the end of epiboly. This thinning and spreading of the blastoderm is accomplished by the movement of deeper blastomeres of the DEL outwards to intercalate between more superficial blastomeres of the DEL. Such cell movements are termed radial intercalations, and along with the I-YSL, these movements are considered to be part of the driving force of early epiboly. Considerable progress has been made in identifying factors involved in epiboly, but there is still very little understanding on how these factors cooperate to drive the process, and many gaps in knowledge of signalling molecules and in understanding of mechanisms remain (Lepage and Bruce, 2010). 13 1.5.5 Gastrula period The gastrula period is characterised by the process of gastrulation, during which cell fate specification and massive tissue rearrangements occur, driven by widespread cell movement behaviours (Jessen and Solnica-Krezel, 2005). Gastrulation is required to set up the adult body plan of organisms, to organise germ layers and establish major body axes. Besides epibolic movements, internalisation and convergence-extension movements come into play during this period as well. The beginning of the gastrula period is marked by the initiation of internalisation, the movement of prospective mesodermal and endoderm cells all around the circumference of the blastoderm margin beneath the superficial ectodermal cells (Jessen and Solnica-Krezel, 2005). The germ ring forms during this process, and subsequently, the embryonic shield, a thickening of the blastoderm margin at the future dorsal side of the embryo, appears. It is thought that ingression may be the main type of cell movement mediating the process of internalisation. Following internalisation, cells migrate anteriorly toward the animal pole and contribute to the anterior-posterior extension of the embryonic axis. 1.5.6 Convergence and Extension (C&E) movements C&E movements narrow all the germ layers mediolaterally, while simultaneously elongating the embryo along its anterior-posterior axis. The C&E movements of the mesoderm is well understood, and it has been observed that the mesoderm can be subdivided into four domains along the dorsoventral axis of the gastrula (Figure 1.2) each domain characterised by different rates of C&E and cell movement behaviours, driven by different 14 signalling pathways that include Stat3 signalling, the non-canonical WNT/PCP pathway and G-protein coupled receptor signalling (Yin et al., 2009). The most ventral region is termed the “no convergence no extension” zone where mesodermal cells are not involved in C&E movements, but migrate along the yolk into the tailbud region (Yin et al., 2009). The lateral region of the embryo consists of mesodermal cells undergoing slow C&E cell movements, but which accelerate towards the dorsal midline. The third C&E domain is the region of the presomitic mesoderm located within six-cell diameters to the axial mesoderm. This domain consists of cells undergoing modest rates of C&E. Lastly the most dorsal region where the axial mesoderm is exhibits the same convergence rate as the adjacent domain, but exhibits a three-fold higher rate of extension. The ventral mesoderm and lateral mesoderm, which display slow and modest to fast rates of C&E, are characterised by the directed migration of mesodermal cells in these regions (Yin et al., 2009). In directed cell migration, cells migrate in an oriented fashion as individuals or in groups without significant neighbour exchanges. In the lateral mesoderm, cells undergo changes in rates and directions of cell migratory movements depending on the stage of gastrulation. At midgastrulation, cells migrate in the dorsal direction along complex trajectories and therefore give rise to slow C&E movements. During late gastrulation, the cells have reached more dorsal locations where they pack densely together and exhibit a mediolaterally elongated morphology. Thus they converge towards the dorsal midline collectively along more direct trajectories and at higher speeds. 15 Mediolateral intercalation of cells is the main cell movement driving C&E in the axial mesoderm (Yin et al., 2009). In the process of mediolateral intercalation, cells become elongated in morphology and membrane protrusive activity in the mediolateral directions is activated. Simultaneously, these cells move in between their immediate medial and lateral neighbours, thereby generating fast rates of mediolateral narrowing and anterior-posterior lengthening of the region. Radial intercalations, besides driving epiboly, have also a role to play in C&E of the medial presomitic mesoderm (Yin et al., 2009). As radial intercalations preferentially separate anterior and posterior neighbouring cells, anisotropic extension of the tissue is enabled, thus contributing to the anteriorposterior extension of the embryonic axis. As in the case of epiboly, gaps in knowledge and understanding of molecular mechanisms of C&E movements on the tissue and cellular levels still remain, and identification and analyses of signalling molecules and pathways involved in the regulation of C&E movements will continue being an important area of research (Jessen and Solnica-Krezel, 2005). 16 Figure 1.2: The four domains of mesodermal C&E movements in the zebrafish gastrula and their characteristic underlying cell movement behaviours. NCEZ, no convergence no extension zone; A, anterior; P, posterior; D, dorsal; V, ventral, PSM, presomitic mesoderm. This figure is adapted from Yin et al., 2009. 17 1.6 Rationale and objectives of study Although some target proteins of BNIP-2 have been identified and insights into its cellular functions have been gleaned from the studies conducted on it so far, the knowledge and understanding of the molecular signalling pathways and mechanisms mediating or mediated by BNIP-2 function remain poor. The ability of BNIP-2 to affect cell dynamic behaviours, to regulate different Rho GTPases, bind different GAPs and GEFs as well as interact with a diversity of other proteins, makes it an intriguing subject of study as it may potentially fill in the gaps in knowledge on how the “3G” (GTPase, GEF, GAP)-signalome is regulated by cellular factors and how its functions and regulation are linked to other signaling networks (Pan and Low, 2012). This study seeks to investigate the physiological importance of the bnip-2 gene in an in vivo model, the zebrafish, in the context of early development, when a well-studied plethora of signalling molecules and pathways are activated and regulated to mediate developmental processes. Given the versatility of BNIP-2 in protein interactions, it is highly plausible that it engages different proteins to regulate or mediate different biological processes depending on the specific context in development. Thus studying the role of bnip-2 in development facilitates the understanding of the contextual signalling ability of bnip-2. The aim of this study is to identify the developmental processes bnip-2 is involved in, and to determine interacting genes and signalling pathways it engages to mediate the developmental process. The process of gastrulation is 18 paid attention to in particular, as it is driven by widespread cell movement behaviours and dynamics that inevitably involves regulation by the 3Gsignalome and therefore very possibly requires the function of bnip-2 as well There are two main objectives to this study. One is to knockdown the function of bnip-2 by morpholino and analyse the resulting phenotype using a variety of cell and molecular biology methods to identify the developmental process affected, i.e. the process bnip-2 has a role in. After identifying the biological process affected, functionally interacting genes of bnip-2 will be determined in order to understand bnip-2 function in the context of a signalling pathway. This will be done by analysing possible aggravation or suppression of morphant bnip-2 phenotype resulting from co-knockdown of genes and phenotype rescue experiments. 19 1.7 Experimental rationale and approaches 1.7.1 bnip-2 knockdown by morpholino phosphorodiamidate antisense oligonucleotides One of the most direct ways to discover the function of a gene or the protein it encodes is to observe the phenotypic outcome when the gene or the protein it encodes is removed in an organism, resulting in a mutant. In classical or forward genetics, random mutagenesis is conducted with DNAdamaging agents to generate a large number of mutants with various mutations in different parts of the genomes, and genetic screens are conducted to identify and isolate a mutant with a defect or phenotype of interest. Following that, molecular characterisation is carried out to identify the gene or genes responsible for the altered phenotype. Reverse genetics has become an approach popularly used due to the large-scale genome sequencing conducted in numerous genome projects undertaken and completed in recent years. This has led to an influx of large amount of new DNA sequence information into public databases and therefore, the investigation of gene function often begins with the DNA sequence of the gene. In the reverse genetics approach, the starting point could simply be a genome sequence, a cloned gene, or a protein of interest from which the encoding gene or nucleotide sequence must be first identified, as had been done for BNIP-2. For gene functional studies, a powerful approach is to manipulate the activity of the gene to study the effect of gain-of- or loss-offunction of the gene. 20 As have been mentioned, based on earlier findings of BNIP-2, we hypothesised that BNIP-2 is involved in GTPase-mediated signalling pathways that regulate cell dynamics and is therefore potentially involved in the developmental process of gastrulation, in which widespread cell movement behaviours constitute the driving force. To test our hypothesis, we chose to perform BNIP-2 knockdown in zebrafish and conduct phenotypic analyses during early developmental stages, since that is when gastrulation processes mainly occur. This loss-of-function approach would provide valuable information about the early developmental significance of BNIP-2 in zebrafish. The accessibility and optical transparency of the zebrafish embryo will greatly facilitate morphant phenotypic analyses and therefore facilitate the understanding of BNIP-2 function on the organism, tissue, cell and even protein level. The method of BNIP-2 knockdown we employed is the use of morpholino phosphorodiamidate antisense oligonucleotides, or in short, morpholinos (MOs), which are short synthetic oligonucleotides consisting of about 25 subunits. The MO nucleotides are similar to conventional DNA or RNA nucleotides, except that they possess a six-membered morpholine moiety instead of a deoxyribose or ribose ring, and that they are connected via nonionic phosphorodiamidate linkages instead of anionic phosphodiester linkages, thereby yielding a net neutral charge for the molecule. The morpholine ring allows MOs to undergo Watson-Crick base pairing, but the linkages are nuclease- and protease-resistant and therefore stable in biological systems, and the uncharged backbone renders it less likely to interact with other cellular proteins and components in an unspecific manner and cause toxicity (Eisen and Smith, 2008). Another advantage of the MO is that it has excellent RNA21 binding affinity and anti-sense efficacy, for e.g., at 50 nM concentration of MO, there is more than 90 per cent inhibition of a luciferase reporter gene in cell-free translational systems - more efficacious than the widely used phosphorothioate oligonucleotides (Sumanas and Larson, 2002). Furthermore, MPOs display sequence-specific inhibition over a thirty-fold wider concentration range than phosphorothioate oligos in cell-free translation systems (Sumanas and Larson, 2002). Translation-blocking MOs are designed to bind to a region between the 5’ cap and about 25 bases 3’ of the AUG translation start site, and in an RNaseH –independent mechanism, elicit functional knockdown by blocking translation of the gene mRNA into protein through sterically blocking the translation initiation complex (Summerton, 1999). An alternative strategy is the use of splice-blocking MOs, which are designed to bind to splice sites thereby inhibiting pre-mRNA splicing or causing exon skipping, resulting in a defective protein upon translation. MOs are introduced into zebrafish embryos via microinjection into the center of the yolk to reduce the chance of secondary effects due to a mechanical disruption of the early blastomeres, and by the process of cytoplasmic streaming, they are transported into the embryonic cells (Bill et al., 2009). Because MOs are small in size and are neutral in charge, diffusion is the main driving force of spread throughout the embryo, facilitated by the cytoplasmic bridges present between early embryonic cells at the 1- to 8-cell stages (Bedell et al., 2011, Bill et al., 2009). Although it has been reported that MOs microinjected in this fashion can be ubiquitously delivered to all embryonic cells up to the 8-cell stage (Nasevicius and Ekker, 2000), we chose 22 to microinject the MOs at the single cell stage to best ensure the even distribution of MOs into blastomeres formed by successive cleavages as development progresses. Also, it is currently understood that MOs are most efficient the first three days of development and the efficacy decrease thereafter due to dilutions caused by on-going cell divisions and perhaps, excretion (Sumanas and Larson, 2002). This time-frame of MO efficacy is acceptable for our studies on bnip-2, as with most genes involved in vertebrate development, because most of the patterning, morphogenesis and organogenesis in zebrafish occur during the first two to three days of zebrafish development (Sumanas and Larson, 2002). We designed two independent and non-overlapping 25-mer translationblocking MOs for bnip-2: bnip-2 MO1, which targets the translational start site, and bnip-2 MO2, which is complementary to the 5’UTR of bnip-2 (Figure 1.3). Both MOs prevent the translation of all the bnip-2 splicing isoforms in zebrafish as the isoforms share the same 5’UTR. Presently, due to the unavailability of an antibody for zebrafish BNIP-2, the effect of these MOs on BNIP-2 protein level could not be verified. However, using human polyBNIP-2 antibodies and lysates obtained from 36 to 48 hpf embryos injected with the same MOs at the one-cell stage, our laboratory had previously shown that both bnip-2 MO1 and MO2 resulted in a decrease in BNIP-2 protein level. This demonstrated that bnip-2 MO1 and MO2 can indeed inhibit bnip-2 translation. Control experiments are essential in order to prevent spurious results arising from non-specific interactions or ‘off-target’ effects of MOs that affect the production of an unrelated gene product and result in a phenotype that is 23 only partially a result of the gene of interest (Eisen and Smith, 2008). A control MO could be the standard control MO, which is a MO that targets an exogenous gene not present in the species used which for our case is the zebrafish. An example of a commercially available standard control is one directed against human β-globin pre-mRNA. However, the standard control controls only for general toxicity and embryo handling; potential ‘mistargeting’ of the MO is not addressed (Eisen and Smith, 2008). Therefore, to address the latter issue, we designed two non-overlapping MOs, as the chance of two MOs having the same off-target effect is significantly lower (Eisen and Smith, 2008). In addition, if synergy occurs between the two MOs co-injected at respective sub-optimal doses (that do not elicit phenotypes on their own) resulting in the same phenotype as when injected independently, greater confidence in the phenotype observed can be obtained (Eisen and Smith, 2008). Instead of a standard control, we designed a control mismatch MO that differs from one of the bnip-2 MOs, i.e. bnip-2 MO1, by five nucleotides (termed a five-nucleotide mismatch MO) (Figure 1.3). As it more closely resembles the bnip-2 MO, it is a more stringent control compared to the standard control. As further affirmation of the observed phenotype, the ‘rescue-ofphenotype’ experiment was also conducted and this could not be done simply by co-injecting an endogenous form of zebrafish bnip-2 mRNA since it would titrate out the bnip-2 MOs. Therefore silent mutations (nucleotide substitutions that retain the same amino sequence) at five nucleotides were introduced into zebrafish bnip-2 mRNA at the region targeted by bnip-2 MO1 to prevent it 24 from binding to bnip-2 MO1 and titrating it out. The mutated bnip-2 mRNA synthesised in vitro was co-injected with bnip-2 MO1 and the phenotype produced was assessed and compared with that of independent bnip-2 MO1 injection. If the morphant phenotype could be rescued with bnip-2 mRNA, it showed that the phenotype produced by bnip-2 MO1 was specific to bnip-2 knockdown. Techniques such as live imaging, whole mount in situ hybridisation (WISH), immunofluorescence and western blot were employed for phenotype analyses (Figure 1.4). 25 -27 GGCACGAGAGCACCAGGAGTCGGTGGCGACCACAGAGGCACGGCTG AGGATGGAGGGGGTGGAGCTTAAGGAGGAGTGGCAGGATGAGGATT TCCCCAGGCCACTTCC MO Length Sequence (5’ to 3’) Mechanism bnip-2 MO1 25bp TAAGCTCCACCCCCTCCATCCTCAG Translationalblocking bnip-2 MO2 25bp TCTGTGGTCGCCACCGACTCCTGGT Translationalblocking Mismatch 25bp TAACCTGCACCGCCTCCATGCTGAG Internal control MO (MM) Figure 1.3: Description of morpholinos used for functional rescue experiments. (top) Part of bnip-2 mRNA sequence (first 108bp) targeted by morpholinos; highlighted in yellow: bnip-2 MO2 target sequence in the 5’UTR region; highlighted in cyan: bnip-2 MO1 target sequence at ATG translational start site. (bottom) Table outlines details of bnip-2 MO1, bnip-2 MO2 and the 5 base pair mismatch MO. Gene Knockdown Translational morpholino knockdown of BNIP-2 Phenotypic analysis of morphants • • • • In situ analyses with specific markers Immunofluorescence of possible affected genes Imaging of embryo morphology, cell migration, cell shape G-LISA to measure active Cdc42/RhoA GTPase Further manipulation of morphants • • Rescue of phenotype Co-injection of candidate interacting gene morpholinos, mRNAs Figure 1.4: Schematic outline of experiments performed to elucidate bnip-2’s function in zebrafish. Arrows indicate chronological order of experiments performed. 26 1.7.2 Investigating potential bnip-2 interacting genes – E-cadherin, RhoA, Cdc42 Previous (unpublished) work on zebrafish bnip-2 included a pull-down of directly or indirectly (in multi-subunit complexes) interacting proteins in zebrafish lysate by GST-tagged zebrafish BNIP-2 bound to glutathioneSepharose beads. The interacting proteins identified in this experiment were E-cadherin, RhoA, Cdc42 and Bcl-2. The identification of interacting proteins has traditionally been important in gene functional studies because, in a biological context, proteins do not function independently, but in interaction with other proteins in signalling pathways. Therefore a protein has to be studied in context with its interacting partners in order to fully understand its physiological function. Thus, hypotheses about BNIP-2’s function may be formed by extrapolation of the functions of its interacting partners. Taking into consideration that the biochemical and cellular functions of BNIP-2 as a core regulatory protein in multiple signalling gateways have been delineated (mainly in cell culture models) (Pan and Low, 2012), the prior finding of possibly interacting proteins of BNIP-2 led to the formation of research questions: Does the physical interaction of BNIP-2 with these proteins mean that BNIP-2 operates in the same zebrafish developmental signalling pathways as these proteins? Is BNIP-2 involved in the regulation of these proteins in early zebrafish developmental processes such as the hypothesised gastrulation? To answer these questions, further manipulations, experiments and analyses were performed on bnip-2 knockdown zebrafish morphants to assess possible effects on E-cadherin, RhoA and Cdc42 regulation (Figure 1.4). 27 2. Materials and Methods 2.1 Fish Spawning and Maintenance Wild type zebrafish were obtained from a local supplier, maintained and bred in line with standard procedures in a controlled environment (10 hour light and 14 hour dark cycles) (Westerfield, 2000). Embryos spawned by the wild type zebrafish were incubated in petri dishes containing egg water (30g ocean salt in 1litre of water) in a 28ͦ C incubator after being subjected to experimental manipulations. Staging of embryos were performed according to morphological criteria (Kimmel et al., 1995) 2.2 Molecular Biology Techniques 2.2.1 RT-PCR Molecular Cloning Full length pGEMT-easy-bnip-2 (exclusive of 5’UTR) had previously been cloned in the laboratory. Primers used for the cloning of full-length bnip2 were designed based on Genbank listed Danio rerio Bcl-2/adenovirus E1B 19kDa interacting protein (Accession number NM_201218). Sequences of primers used for the cloning of full length bnip-2b (restriction enzyme sequences in bold): Forward - 5’ CGGGATCCATGGAGGGGGTGGA 3’. Reverse - 5’ CCGCTCGAGTTAAGTGAAAGCGATT 3’. Sequences of primers used for the synthesis of bnip-2b mRNA containing five point mutations (underlined): Forward - 5’CGGGATCCATGGAAGGAGTAGAA CTCAAGGAGGAGTGGCAGGATGAGG 3’. Reverse – 5’ CCGCTCGAGT TAAGTGAAAGCGATT. Primers were purchased from Research Biolabs, Singapore. 28 2.2.2 Polymerase Chain Reaction (PCR) The PCR procedure was used in the colony screening procedure and for the introduction of restriction sites to DNA fragments via primers that contain the desired restriction site sequences. The standard volume of a PCR reaction is 50 μl, consisting of 5 μl of 10X PCR buffer (0.5 M KCl; 0.1 M Tris-HCl, pH 8.8; 15 mM MgCl2; 1% Triton X-100), 2.5 μl of 2 mM dNTP, 0.5 μl of 0.2 ug/μl forward primer, 0.5 μl of 0.2 ug/μl reverse primer, 0.2 μl of 5 U/μl Taq polymerase and 1 μl template DNA. A typical program used for amplifying 1 kb DNA product was as follows: denaturation at 94 °C for 5 minutes for 1 cycle, followed by 30 cycles of (denaturing at 94 °C for 30 seconds, annealing at 55 °C for 1 minute and extending at 72 °C for 1 minutes) and final extension at 72 °C for 10 minutes. All PCR reactions were carried out using a PTC-100 TM Programmable Thermal Cycler (MJ research). 2.2.3 Agarose Gel Electrophoresis Agarose gel electrophoresis was performed to isolate RNA products from mRNA synthesis reactions, DNA products from restriction enzyme reactions and in the PCR colony screening procedure to analyse PCR products. SYBR® Safe DNA Gel Stain (10000x concentrate) purchased from Molecular Probes® Invitrogen was added to 1x TAE buffer (40 mM Tris-acetate and 1 mM EDTA) for the making of agarose gels. DNA loading dye [0.2% (wt/vol) each of bromophenol blue and xylene cyanol in 30% (wt/vol) glycerol] was added to reaction mixtures. 5 μl of GeneRuler TM 1 kb or 100 bp DNA ladder was loaded into a separate well for the analysis of DNA or RNA product length. Gels were run in 1x TAE buffer at 95 V for 50 min. A UV 29 transilluminator was used to visualise DNA bands after the running of the gel, and images were captured on Polaroid film T667 using a polaroid camera. 2.2.4 Purification of DNA Fragment From Agarose Gel DNA bands of interest were identified using a UV transilluminator for visualisation, excised from agarose gels using a sterile blade and transferred to microcentrifuge tubes. DNA fragments were purified using the Qiaquick® Gel Extraction Kit from Qiagen following the manufacturer’s protocol. 2.2.5 DNA Ligation Ligation reactions were carried using 1 μl of T4 DNA ligase (New England Biolabs, USA), 1 μl of 10X ligation buffer and a molar ratio of insert DNA : vector DNA of at least 3:1 respectively in 10 μl total reaction volumes. 2.2.6 Growth, preparation and transformation of competent E. coli cells 2.2.6.1 Growth of E. coli cells in liquid and solid media For the growth of colonies in liquid media, single bacterial colonies were inoculated into Luria Broth medium (10 g of NaCl, 10g of tryptone and 5 g of yeast extract, adjusted to pH 7.0 with NaOH in 1 L of deionised water) containing ampicillin (Amp; 150 μg / ml) and shaken at 250 – 300 rpm at 37 °C overnight. For the growth of colonies on solid media, bacteria was streaked or spread onto LB agar plates (10 g Peptone, 5 g Yeast Extract, 5 g sodium chloride and 12 g agar dissolved in 1 L of deionised water, autoclaved, 30 cooled down, and poured into petri dishes) supplemented with appropriate antibiotics if necessary. 2.2.6.2 Preparation of competent E. coli cells For the preparation of competent E.coli cells, a single fresh colony of E. coli DH5α (obtained by streaking of bacteria strain on LB plates that were then incubated overnight in a 37 °C incubator) was inoculated into 2ml of LB broth and incubated at 37 °C overnight with shaking at 250 rpm. 0.5 ml of overnight culture was inoculated into 100 ml of LB broth contained in a 500 ml flask and shaken at 250 rpm at 37 °C until OD600 0.5. After 15 min of chilling on ice, a cell pellet was obtained by centrifugation at 1,000 g at 4 °C for 15 min. Resuspension of pelleted cells was performed using 30 ml of buffer RF1 (100 mM RbCl, 50 mM MnCl2.4H2O, 30 mM potassium acetate, 10mM CaCl2.2H2O, 15% glycerol) and moderate vortexing. After a 15min incubation on ice, the cells were centrifuged at 1,000 g at 4 °C for 15 min and the cell pellet resuspended in 8 ml of buffer RF2 (10 mM MOPS, 10 mM RbCl, 75 mM CaCl2.2H2O, 15 % glycerol). After 15 min incubation on ice, the competent cells were stored in aliquots of 100 μl in 1.5 ml microcentrifuge tubes at -80 °C. 2.2.6.3 Transformation of competent E. coli cells After the thawing of frozen competent E. coli cells on ice, 10 μl of ligation reaction was added to 100 μl of competent cells. The transformation mixture was incubated for 30 min on ice and then heat shocked at 37 °C for 1.5 min. After a 5 min recovery period on ice, 1 ml LB medium w/o antibiotics was added and the mixture was subjected to shaking at 200 rpm in 31 a 37 °C incubator for 1 h. The transformed cells were pelleted by a brief spin and resuspended in 100 μl LB broth w/o antibiotics. The suspension was spread onto LB plates supplemented with appropriate antibiotics, then incubated at 37 °C overnight for the growth of colonies. 2.2.6.4 Colony Screening Bacterial colonies were selected at random with a sterile tip and dissolved in 10μl of sterile water. 1 μl of this diluent was subjected to 30cycle-PCR amplification with T7 and SP6 primers and the resulting reaction mixtures were subjected to gel electrophoresis to be screened for positive clones that contained the desired DNA fragment. 2.2.7 Plasmid DNA Isolation and Purification from Bacterial Cultures Plasmid DNA was isolated from liquid bacterial cultures using AxyPrep™ Plasmid Miniprep Kit from Axygen Biosciences according to manufacturer’s protocol. 2.2.8 Restriction endonuclease digestion of plasmid DNA Restriction digestion is performed for the screening of recombinant clones that contain the target DNA insert or to transfer a DNA fragment from one plasmid to another. All restriction endonuclease digestions were carried out according to the manufacturer’s recommendations (New England Biolabs, USA) using the appropriate restriction buffer and temperature of incubation for each enzyme in a final reaction volume of 20 μl. The digested DNA was 32 subjected to gel electrophoresis for the screening of positive clones or for the isolation of desired DNA fragments. 2.2.9 DNA sequencing 2.2.9.1 PCR Cycle sequencing The ABI PRISMTM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) was used for the PCR cycle sequencing of plasmid DNA clones following manufacturer’s protocol. Sequencing reaction mixtures consisted of 0.1 μg plasmid DNA, 0.8 pmoles primer for plasmid DNA (T7 or SP6), 2 μl BigDye and autoclaved water added up to the final volume of 5 μl. Programme set up was as follows: 26 PCR cycles of 96 °C for 10 sec, 50 °C for 5 sec and 60 °C for 4 min. Amplified PCR products were purified by adding 5 μl of sequencing reaction mixture to a microcentrifuge tube containing 1.5 μl 3M pH 5.0 sodium acetate and 30 μl 95% nondenatured molecular grade ethanol. The mixture was incubated for 30 min on ice, then spun at maximum speed for 20 min at 4 °C. Supernatant was removed and the pellet was rinsed with 1 ml 70% ethanol by gentle vortexing, spun again, and after the removal of supernatant, air-dried. 2.2.9.2 Automated sequencing The ABI PRISMTM 377 DNA Sequencer and Power PC with ABI PRISMTM 377 DNA Sequencer Data Collection software (version 3.1, Perkin Elmer, USA) was used for the running of the sequencing gel and data processing. First, the extension products were resuspended in 2 μl loading dye, heat- denatured at 94 °C for 2 min and chilled on ice to prevent renaturation. 1 33 μl of denatured extension products was then loaded onto 6 % polyacrylamide sequencing gels (50 ml of gel mix contains 5 ml of Long Ranger Gel Mix, 5 ml of 10x TBE, 26 ml of distilled water and 18 g urea) for 9 h long electrophoresis using the dRhodamine matrix with the run module 36 E-1200 setting. ABI’s Sequence analysis Software was used for data analysis. 2.2.9.3 Sequence Analysis Sequencing results were verified by alignment against peaks manually on the Chromas software (Version 1.45)-generated chromatogram. The DNA sequence was then submitted to the Translated tool at Expasy (Gasteiger et al., 2003) (http://au.exapsy.org/tools/dna.html) to generate predicted amino acid sequence. BLASTN, BLASTP and Genomic Blast were performed using the NCBI BLAST network service (Altschul et al., 1990) (http://www.ncbi.nlm.nih.gov/BLAST). 2.3 Analysis of Gene expression 2.3.1 Whole mount in situ hybridization The in situ hybridization hybridisation procedure allows the detection of specific mRNA transcripts in the zebrafish. For this study, it involves the following steps: fixation of embryos to retain cellular mRNA, prehybridisation to prevent non-specific binding of probe, hybridisation of probe with target gene, and detection via development of chromogenic stain. 34 2.3.2 Synthesis of digoxigenin labeled antisense RNA Probes 2.3.2.1 Linearisation of plasmids pCS2+ plasmids containing the appropriate sequence were used for the synthesis of probes. Probes were generated by linearisation of plasmid containing the appropriate cDNA fragment of the appropriate gene sequence. 10 μg of plasmid DNA was linearised at the 5’ end of the cDNA fragment by appropriate restriction enzyme at 37 °C for 2 hours for each digestion reaction. An agarose gel was run to ensure complete plasmid linearisation and to estimate the quantity of DNA. 2.3.2.2 Probe Synthesis - RNA labeling by in vitro transcription Probe synthesis was performed using the PCR DIG Probe Synthesis kit from Roche according to manufacturer’s instructions. 2.3.3 Collection and Preparation of zebrafish embryos Only early stage embryos were used for in situ hybridisation in this study. Embryos were subjected to fixation in 4% paraformaldehyde (PFA) in PBS at 4 °C for 24 hours. Then the embryos were washed in PBT (0.1% Tween 20 in PBS) 4 x 20 min on a nutator at room temperature. 2.3.4 Pre-hybridisation and Hybridisation Embryos were first pre-hybridised in hybridisation buffer (50% formamide, 5 X SSC, Heparin in 0.05 mg/ml, tRNA in 0.5 mg/ml and citric acid in 9.2mM) at 68 °C overnight. RNA probe was dissolved in hybridisation 35 buffer to a final concentration of 0.2-0.5 μg/ml, denatured at 80 °C for 5 min and placed for 5 min on ice. After the removal of pre-hybridisation buffer, embryos were incubated in hybridisation buffer with probe in a water bath at 68 °C overnight. Post-hybridisation, embryos were washed at 68 °C with prewarmed 50% formamide/2 x SSCT (2 x SSC plus 0.1 % Tween 20) for 2 x 30 min, 2 x SSCT for 15 min and 0.2 SSCT for 2 x 30 min. 2.3.5 Incubation with antibody 2.3.5.1 Preparation of pre-absorbed Digoxigenin-Alkaline Phosphatase (DIG-AP) antibody To prepare anti-DIG-AP (Roche, Switzerland) for use, it was diluted to 1:500 in PBS/10% FCS and incubated with at least 50 zebrafish embyos of any stage on a nutator at RT for several hours. After transferring the antibody solution to a new tube, it was diluted to 1:5000 with PBS/ 10% FCS. The resulting pre-absorbed antibody was stored at 4 °C 2.3.5.2 Incubation with pre-absorbed anti-DIG-AP antibody After post-hybridisation washes, to reduce non-specific binding by anti-DIG-AP, embryos were incubated with blocking reagent solution, 10% FCS/PBS (fetal calf serum in PBS) for two hours at RT. The blocking solution was then replaced with pre-absorbed anti-DIG-AP antibody and incubated at 4 °C overnight on a nutator. 36 2.3.6 Washing, Staining with NBT/BCIP and Fixation After antibody binding, embryos were washed 4 x 30 min in PBT or TBST at RT on a nutator, followed by 2 x 5 min in PBS. Subsequently, embryos were washed in Buffer 9.5 (100mM Tris-HCl, pH9.5; 50 mM MgCl2; 100 mM NaCl and 0.1 % Tween 20) for 2 x 10 min. Embryos were stained with the staining solution [4.5 μl of NBT (Stratagene, USA) and 3.5 μl of BCIP (Stratagene, USA) in 1 ml of buffer 9.5]. The staining reaction was kept in dark for several hours until proper level of signals (blue colouration) developed. To stop the reaction, the staining solution was removed, embryos were washed in PBS for 2 x 10 min, and stored in 50% glycerol solution at 4 °C for further analysis. 2.3.7 Mounting & visualisation Embryos stored in 50% glycerol/PBS were placed onto glass slides for imaging. 2.3.8 Immunofluorescence Zebrafish embryos were fixed in 4% paraformadehyde at 4 °C overnight, then dechorionated and washed 3 x 10 min with PBT. After an overnight incubation in blocking solution (10% normal goat serum, 1% DMSO, 0.1% Triton in PBS), embryos were incubated overnight at 4 °C in blocking solution containing primary antibody. After washing 3 x 10 min with PBT, the embryos were incubated for 4 h with Alexa Fluor 488 or 594 secondary antibody (Invitrogen) or phalloidin at RT, and then washed 3 x 10 37 min. Secondary antibodies and Alexa 594 Phalloidin (Molecular Probes) were used at 1:200 dilutions. The following primary antibody and dilution were used: mouse anti-E-cadherin (BD transduction laboratoriesTM) at 1:100. For visualisation, embryos stored in 80% glycerol/PBS were mounted onto glass slides for imaging. 2.4 Protein Expression Studies 2.4.1 Protein extraction from zebrafish embryos Zebrafish embryos were dechorionated manually using forceps, then deyolked in Ginzburg Fish Ringers solution (6.5 g NaCl, 0.25 g KCl, 0.3 g CaCl2, 0.4 g CaCl2•2H2O, 0.2 g NaHCO3 dissolved in H2O to a total volume of 1 liter) Yolks were removed by triturating with a glass pipette that has been drawn out to have a tip diameter approximately the size of the yolk, centrifugation at 0.6 xg for 2 min, and lastly supernatant containing dissolved yolk was removed as much as possible. For embryonic cell lysis, the pellet was subjected to trituration in approximately 100 μl of ice- cold RIPA buffer (50 mM Tris-Hcl pH 7.4, 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1mM each of EDTA, PMSF, Na 3VO4, and NaF with 1 μg/ml each of proteinase inhibitors aprotinin, leupeptin and pepstatin). To obtain protein sample, the lysate was centrifuged at 14,000 rpm at 4 °C for 15 min to remove debris and other fatty tissue. A second spin was carried out to ensure homogenous lysate. The supernatant was kept at -80 °C and a BCATM protein assay (PierceNet) was done to quantitate the protein content. 38 2.4.2 Sodium Dodecyl Sulphate-Polyacrylamide gel electrophoresis (SDS-PAGE) SDS-Polyacrylamide gels were prepared (Bio-Rad protein mini-gel system) and performed under reducing conditions. Separating and stacking gels were prepared according to the desired protein molecular weight to be resolved. Protein samples were mixed with 6X Laemmli buffer (25% 0.5 M Tris pH 6.8, 20% glycerol, 4% of 10% SDS, 10% β-mercaptoethanol and 0.1% bromophenol blue in water) in a 6:1 ratio, and boiled at 95 °C for 5 min before loading onto the gel. Bio-Rad Prestained Precision Protein StandardsTM (BioRad Laboratories, USA) was used as a molecular weight marker. Electrophoresis was carried out in 1X running buffer (25mM Tris-HCL pH 8.3, 192 mM Glycine and 0.1% (w/v) SDS) at a constant current of 50 mA till the gel front just runs out. 2.4.3 Western Blot analysis After electrophoresis, protein bands were transferred to a methanol pre-activated 0.45 micron PVDF (Polyvinylidene diflouride) membrane (Immuno-BlotTM, Bio-Rad Laboratories, USA) using a Mini Trans-BlotTM system (Bio-Rad), in Transfer buffer (25 mM Tris-base, 192 mM glycine and 20% (v/v) methanol) for 90 min at 100 V in 4 °C. Blocking of membrane was performed with 3% blocking buffer (PBS containing 0.1% Tween-20 and 3% BSA) at 4 °C overnight. Primary antibody binding with carried out by incubating membrane in appropriate antibody (Sigma, USA) dissolved in 1% blocking buffer overnight at 4 °C on an orbital shaker. The filter was then incubated with 1:2000 diluted anti-mouse or anti-rabbit lgG peroxidase 39 conjugate secondary antibody in 1% blocking buffer for 2h at RT. Each incubation with the antibody solution was followed by a series of three washes with Washing buffer (PBS containing 0.1% Tween-20) 3 x 10 min at RT to remove excess antibody. The antibody signal was then detected by exposure to enhanced chemiluminescence (ECL) using SuperSignal Chemiluminescent Substrate (PIERCE, USA) till desired signal was obtained. Antibodies used in this project include phospho-MLC-2 (Cell Signalling Technology), RhoA (Sigma-Aldrich, USA), E-cadherin (BD transduction laboratoriesTM), β-actin (Sigma- Aldrich, USA), GAPDH (Sigma- Aldrich, USA). Secondary antibodies used include rabbit polyclonal (Sigma-Aldrich, USA) and mouse monoclonal (Sigma-Aldrich, USA). 2.4.4 G-LISA Assay G-LISA Cdc42 Activation Assay Biochem Kit and G-LISA RhoA Activation Assay Biochem Kit were purchased from Cytoskeleton, Inc. Lysates were first obtained from embryos as follows: Embryos were dechorionated manually using forceps, then deyolked in Ginzburg Fish Ringers solution (6.5 g NaCl, 0.25 g KCl, 0.3 g CaCl2, 0.4 g CaCl2•2H2O, 0.2 g NaHCO3 dissolved in H2O to a total volume of 1 liter). Yolks were removed by triturating with a glass pipette that has been drawn out to have a tip diameter approximately the size of the yolk, centrifugation at 0.6 xg for 2 min, and lastly supernatant containing dissolved yolk was removed as much as possible. For embryonic cell lysis, the pellet was subjected to trituration in approximately 100 μl of ice- cold RIPA buffer (50 mM Tris-Hcl pH 7.4, 150 mM NaCl, 1% NP-40, 0.25% sodium deoxycholate, 1mM each of EDTA, PMSF, Na3VO4, and NaF with 1 μg/ml each of proteinase inhibitors aprotinin, 40 leupeptin and pepstatin). To obtain protein sample, the lysate was centrifuged at 14,000 rpm at 4 °C for 15 min to remove debris and other fatty tissue. A second spin was carried out to ensure homogenous lysate. BCATM protein assay (PierceNet) was done to quantitate the protein content. Resulting samples were then subject to the G-LISA assays which were carried out according to manufacturer’s instructions. 2.5 Functional Studies 2.5.1 Design and preparation of translational morpholinos The rational and design of bnip-2 morpholinos are described in Results Chapter 3.1.1. The e-cadherin morpholino sequence used in this study was referenced from Babb and Marrs (2004). The stock lyophilized morpholino is dissolved to appropriate working stock concentrations of 1.0 mM in 1 x Danieau Buffer (Nasevicious & Ekker, 2000) (58mM NaCl, 0.7mM KCl, 0.4mM MgSO4, 0.6mM Ca(NO3)2 and 5.0mM HEPES pH 7.6). The morpholinos were then aliquoted and stored at 80 °C. 2.5.2 Microinjection Morpholinos and in vitro synthesized RNAs were microinjected into 1 cell stage zebrafish embryos (Nasevicious & Ekker, 2000) using an oilpressured injector and glass needles. To determine the suitable morpholino concentration used for experiments, a statistical record of phenotypic defects and reproducibility was maintained. 41 2.5.3 Synthesis of capped RNAs The in vitro synthesis of mRNA was performed using the mMESSAGE mMACHINE SP6 transcription kit (Ambion, USA) according to manufacturer’s instructions. This kit allows the introduction of a cap analog, m7G(5’)ppp(5’)G structure to the 5’ end of the mRNAs, as it ensures efficient translation in eukaryotic systems. 2.5.3.1 Construction of pCS2–bnip-2b and pCS2-bnip2c for mRNA synthesis Plasmid pGEMT-easy-bnip-2b and the pCS2+ vector were digested with EcoRI separately to release the insert fragment. The fragments were subcloned into the digested vector pCS2+. The resulting orientation and sequence of plasmids were checked by automatic DNA sequencing. To add on 5’ eGFP tags to the gene fragments, gene fragments were digested and ligated into pXJ40-eGFP plasmid cut with the same restriction enzymes. The gene fragment with the 5’ eGFP tag was then released by subjecting to appropriate restriction enzyme digestion reaction again and ligated back into pCS2+ vector that was digested with the same restriction enzymes. mGFP from pCAG-mGFP plasmid (Addgene) was subcloned into pCS2+ vector. 2.5.3.2 Linearisation of plasmids for mRNA synthesis Plasmids pCS2+–bnip-2b, pCS2+-mGFP, and pCS2+-WT rhoA, rhoAG14V or -rhoAT19N were used as templates for in vitro transcription. For sense RNA synthesis, 7 μg of plasmid was digested with Xho1 to linearise the plasmid at the 3’ end of the insert. An agarose gel was run to ensure the 42 plasmids had been linearised completely. Using a UV transilluminator for visualisation, linearised plasmid DNA bands were excised from agarose gels using a sterile blade and transferred to microcentrifuge tubes. DNA fragments were purified using the Qiaquick® Gel Extraction Kit from Qiagen following the manufacturer’s protocol. The linearised DNA was then used as a template for in vitro mRNA synthesis using the mMESSAGE mMACHINE SP6 transcription kit (Ambion, USA) according to manufacturer’s instructions. 2.5.4 Statistical analysis Phenotype data generated by morpholino knockdown and mRNA rescue experiments, and G-LISA and western blot densitometry data are presented as means ± s.d unless otherwise stated. Each experiment was repeated at least three times. The statistically significant differences in mean values were assessed with the two populations (paired) t-test. 43 3. Results 3.1 bnip-2 knockdown elicits defects in epiboly and C&E processes Different MO concentrations were first injected into embryos as an assessment of MO efficacy and toxicity, and to identify a range of concentrations at which the control MO did not elicit any defects. Embryos for all sets in any single experiment were obtained from the same mating to ensure genetic invariability, and were assessed for defects from the 1 cell stage till 48 hpf using a stereo microscope. The lowest concentration at which bnip-2 MO1 consistently yielded defects was 1 ng, and the highest concentration at which its control MO did not elicit any defect was 2 ng. bnip-2 MO2 elicited similar defects as bnip-2 MO1, but bnip-2 MO2 was less efficacious and therefore yielded defects consistently at a relatively higher concentration of 5 ng. Therefore, detailed analyses were performed with 1 ng bnip-2 MO1 and 5 ng bnip-2 MO2. The development of bnip-2 MO-injected embryos was indistinguishable from control-injected embryos from the 1-cell till early epiboly stages. The first visible defect in bnip-2 MO-injected embryos was observed during late epiboly. Epiboly is the first major morphogenetic process of gastrulation to shape the developing embryo. Just before the onset of epiboly, the late blastula consists of three main tissue layers – an outermost single cell epithelial layer termed the enveloping layer (EVL) that covers the blastoderm deep cell layer (DEL), and an innermost yolk syncytial layer (YSL) which the EVL is tightly 44 attached at its margin to. Epiboly is initiated at the sphere stage and epibolic movements thin and spread all three tissue layers vegetally such that the initial mound of cells sitting atop the yolk becomes a cell multi-layer of nearly uniform thickness, and the yolk cell is covered all around completely (100% epiboly), marking the end of epiboly. In bnip-2 MO-injected embryos, epiboly was delayed compared to control-injected embryos, or arrested, at different points during epiboly, such that epiboly was not completed (Figure 3.1). At 9 hpf, when most (89%) control MO-injected embryos are in the 80-90% epiboly stage, bnip-2 MOinjected embryos showed a higher percentage of epiboly delayed embryos; while 5.5% of control MO-injected embryos were observed to be in the 50-60% epiboly stage, 30.4% of bnip-2 MO1-injected embryos and 33.3% of bnip-2 MO2-injected embryos were in the 50-60% epiboly stage (Figure 3.2). The assessment of the same samples at the 1-somite stage revealed 15.5% and 10% epiboly arrested embryos in bnip-2 MO1 and bnip-2 MO2-injected embryos respectively, compared to 2.2% in control MO-injected embryos (Figures 3.3, 3.4 and 3.5). In a normal embryo at the post-epiboly bud stage, a distinct swelling termed the tail bud (hence its staging name) forms at the posterior end of the embryonic axis, just dorsal to the site of yolk plug closure. Also, a prominent bulge or polster of postmitotic hatching gland cells forms as a result of the accumulation of prechordal plate hypoblast cells in the anterior end of the axial mesendoderm; this anterior region of axial mesendoderm consists of brain anlagen. bnip-2 MO-injected embryos displayed a more posteriorly placed polster or a more anteriorly placed tail bud and therefore a shortened 45 anterior-posterior axis (or embryo length, the embryo’s longest linear dimension) compared to control-injected embryos. The shortened anteriorposterior axis could also be observed at subsequent developmental stages (i.e. segmentation and pharyngula stages) (Figure 3.1). During the segmentation or somitogenesis stages, bnip-2 MO-injected embryos exhibited reduced anterior structures - head or prechordal plate and optic primodium. Thereafter through the pharyngula stages (from 24 hpf) when the posterior trunk straightens, bnip-2 MO-injected embryos similarly displayed reduced anterior structures, as well as undulated notochords, and abnormally curved, mis-protruded and broadened tails. The tails extending beyond the yolk extensions of these embryos appeared significantly shortened. The yolk extensions of these embryos were similarly truncated and thickened. From the lateral view, instead of possessing myotomal chevron-shaped trunk somites, the somites appeared compressed in the anterior-posterior axis and mis-shapened. A closer dorsal view of the embryos revealed shortened notochords and mediolateral widening of notochord and abnormally sized somites (Figure 3.1). In order to understand the relationship between different developmental stages of control- and bnip-2 MO-injected embryos, embryos from the previous experiment which assessed epiboly progression (Figure 3.2) were segregated according to the stage of epiboly (after removal of dead embryos) and allowed to grow to the 1-somite stage. Although bnip-2 MOinjected embryos at the 80-90% epiboly stage exhibited a much higher percentage of C&E morphants than the corresponding control MO-injected embryos as expected (Figures 3.3 and 3.4), epiboly delayed embryos showed a 46 higher tendency to arrest or die during epiboly, and greater C&E morphant severity at the 1-somite stage compared to their normal counterparts in control MO, bnip-2 MO1 and bnip-2 MO2 samples (Figures 3.3, 3.4 and 3.5). After phenotypic assessment, the 1-somite stage embryos were then allowed to grow to the 24 hpf stage after the removal of dead embryos, and assessed for the severity of morphant phenotype. In all three samples (control MO, bnip-2 MO1 and bnip-2 MO2), it was found that epiboly arrested embryos largely do not survive till the 24 hpf stage, and that embryos that displayed C&E defects at the 1-somite stage displayed significantly greater C&E morphant severity at the 24 hpf stage compared to their normal 1-somite stage embryo counterparts (Figures 3.6, 3.7, 3.8). The method of assessing morphant phenotype severity is described in Section 3.2 and Figure 3.10. In order to characterise the morphological abnormalities of bnip-2 loss-of-function morphants in more detail spatially and temporally, WISH was performed to stain for marker genes specifically expressed in distinct regions of the embryo at specific stages of development (Figure 3.9). To examine the possibility of impairment in axial mesendoderm extension, bud stage embryos were co-stained for mRNA expression patterns of no tail (ntl), distal-less3 (dlx3) and hatching gland 1 (hgg1). hgg1 marks the polster located at the anterior end of the prechordal plate anlage (region anterior to the notochord anlage chordamesoderm) (Inohaya et al., 1997). ntl is specifically expressed in the notochord anlage, a band of axial mesoderm that extends dorsally from the prospective posterior mesoderm to the mesencephalon anlage (Schulte-Merker et al., 1994). dlx3 defines an arching boundary between neuroectoderm (or neural plate) and non-neural ectoderm 47 boundary (Akimenko et al., 1994). In a normal embryo at the bud stage, the prechordal plate anlage wherein polster is located, marked by hgg1, is positioned anterior to the neural plate (boundary marked by dlx3). However in bnip-2 MO-injected embryos, the prechordal plate was displaced posteriorly with respect to the neural plate and the neural plate was widened laterally, and as a result, its boundary lost its characteristic arc (Figure 3.9A). The notochord anlage region of bnip-2 MO-injected embryos, as marked by ntl, was shortened and widened mediolaterally (Figure 3.9B). Embryos were also stained for paraxial protocadherin (papc) expression, which is limited to posterior paraxial mesoderm. In bnip-2 MO-injected embryos at the 1-somite stage, the posterior paraxial mesoderm was similarly shortened along the anterior-posterior axis and expanded laterally (Figure 3.9C). Staining of myoD expression in the myotomal part of the somites in the paraxial mesoderm during somitogenesis revealed compressed (more closely spaced) and widened somites (Figure 3.9D) (Weinberg et al., 1996). The morphological abnormalities in axial and paraxial mesendodermal structures manifested in bnip-2 MO-injected embryos - diminished anterior structures (i.e. prechordal plate and optic primodium), reduced anteriorposterior lengths and truncated and broadened axial and paraxial mesodermal structures (e.g. notochord and somites) - are classical characteristics of C&E defects. To identify possible abnormalities in dorsoventral patterning, embryos were stained for dorsoventral patterning gene markers (Figure 3.9E) bone morphogenetic protein4 (bmp4) is a member of the family of BMPs which are key mediators of dorsoventral patterning in vertebrates and are integral for the 48 induction of ventral fates in fish and frogs (Stickney et al., 2007). The ventral ectoderm marker bmp4 in particular, is required for the specification of ventroposterior cell fates. In normal zebrafish embryos at the onset of gastrulation, bmp4 expression is limited mostly to the ventral margin and recedes in the dorsal direction. By bud stage, bmp4 becomes localised to a horseshoe-shaped domain flanking the most anterior portion of the neural tube and to a diffuse domain at the tailbud. Tail bud marker eve1 is a zebrafish homeobox gene and a member of the Drosophila even-skipped (eve) gene family (Joly et al., 1993). It is also associated with ventral and posterior fates. At the beginning of gastrulation, eve1 is expressed in the ventral and lateral margin and at the end of epiboly, becomes localised to the region just ventral to the yolk plug closure (Figure 3.9F). bmp4 and eve1 expression in bnip-2 MO-injected embryos at the bud stage were unaffected (Figure 3.9E, Figure 3.9F) These results suggest that bnip-2 is not involved in dorsoventral patterning and tail bud differentiation. 49 A. 1 somite B. 10-somites C. 24 hpf WT WT Control Control WT Mild bnip-2 MO1 (i) Control Intermediate bnip-2 MO1 bnip-2 MO1 (ii) bnip-2 MO1 Severe bnip-2 MO2 (i) Severe bnip-2 MO2 (ii) Intermediate bnip-2 MO2 Mild bnip-2 MO2 50 D. 7-somite E. 48 hpf WT WT Control Control bnip-2 MO1 Mild WT Intermediat e bnip-2 MO1 bnip-2 MO2 Severe 51 Percentage of embryos (%) Figure 3.1: bnip-2 knockdown elicits defects in epiboly and C&E movements. (A-D) Different stages of embryo development at which control- and bnip-2 MO1- and bnip-2 MO2-injected embryos were compared. bnip-2 MO1- and bnip-2 MO2-injected embryos exhibited similar defects. (A) 1-somite stage embryos, lateral view, dorsal to the right; blue arrowheads demarcate anterior limit of prechordal mesoderm and posterior limit of tailbud; wider distance between arrowheads in bnip-2 MO-injected embryos observed; red arrowheads indicate point of epiboly arrest. (i) epiboly arrest phenotype (ii) extension defect phenotype. (B) 10-somite stage embryos, lateral view, dorsal to the right; blue arrowheads demarcate anterior limit of prechordal mesoderm and posterior limit of tailbud; wider distance between arrowheads observed in bnip-2 MO-injected embryos. (C) 24 hpf, lateral view, dorsal to the right; embryos were categorised into ‘mild’, ‘intermediate’ and ‘severe’ in terms of the severity of a specific phenotype, in this case the shortening of anteriorposterior axis. (D) 7-somite stage embryos, dorsal view, anterior to the top; red arrows specify lateral width of second pair of somites from posterior which is wider in bnip-2 MO-injected embryos. 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 50-60 (%) 70 (%) 80-90 (%) Control MO (n=91) 5.5 5.5 89.0 1 ng bnip-2 MO1 (n=168) 30.4 4.8 64.9 5 ng bnip-2 MO2 (n=90) 33.3 0 66.7 Figure 3.2: bnip-2 knockdown by morpholino causes epiboly delay. Percentages of embryos at different stages of epiboly (indicated by legend) generated by each treatment as specified in the x-axis. Embryos in each group were injected with control MO (to bnip-2 MO1), bnip-2 MO1 and bnip-2 MO2 at the doses indicated and assessed for stage of epiboly at 9 hpf. 52 Percentage of 1-somite embryos (%) (Control MO) 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Morphant Arrest Dead 50-60 (%) (n=5) 0.0 0.0 40.0 60.0 70% (n=5) 40.0 40.0 0.0 20.0 80-90 (%) (n=81) 77.8 13.6 0.0 8.6 Percentage of 1-somite embryos (%) (bnip-2 MO1) Figure 3.3: Control MO-injected embryos that show epiboly delay display higher percentage of abnormalities at the 1-somite stage. Percentages of embryos showing different phenotypes (indicated by legend) at the 1-somite stage. Embryos were injected with control MO, assessed for phenotype at 9 hpf (Figure 3.2), grouped according to stage of epiboly and assessed again at the 1-somite stage for phenotypes as indicated in the legend. 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Morphant Arrest Dead 50-60 (%) (n=51) 0.0 9.8 37.3 52.9 70% (n=8) 0.0 12.5 37.5 50.0 80-90 (%) (n=109) 16.5 70.6 3.7 9.2 Figure 3.4: bnip-2 MO1-injected embryos that show epiboly delay display higher percentage of abnormalities at the 1-somite stage. Percentages of embryos showing different phenotypes (indicated by legend) at the 1-somite stage. Embryos were injected with bnip-2 MO1, assessed for phenotype at 9 hpf (Figure 3.2), grouped according to stage of epiboly and allowed to grow till the 1-somite stage for assessment of phenotype as indicated in the legend. 53 Percentage of 1-somite embryos (%) (bnip-2 MO2) 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Morphant Arrest Dead 50-60 (%) (n=30) 0.0 3.3 30.0 66.7 70% (n=0) 0.0 0.0 0.0 0.0 80-90 (%) (n=60) 25.0 71.7 0.0 3.3 Percentage of 24 hpf embryos (%) (Control MO) Figure 3.5: bnip-2 MO2-injected embryos that show epiboly delay display higher percentage of abnormalities at the 1-somite stage. Percentages of embryos showing different phenotypes (indicated by legend) at the 1-somite stage. Embryos were injected with bnip-2 MO2, assessed for phenotype at 9 hpf (Figure 3.2), grouped according to stage of epiboly and allowed to grow till the 1-somite stage for assessment of phenotype as indicated in the legend. 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Intermediate Severe Dead 1-somite WT (n=59) 94.9 5.1 0.0 0.0 1-somite morphant (n=19) 0.0 75.0 16.7 8.3 Epiboly arrested (n=2) 0.0 0.0 0.0 100.0 Figure 3.6: Control MO-injected embryos that show abnormalities at the 1somite stage or epiboly arrest display. Percentages of embryos showing different phenotypes (indicated by legend) at the 24 hpf stage. Embryos were injected with control MO, assessed for phenotype at 9 hpf (Figure 3.2) and 1somite stage (Figure 3.3), segregated according to phenotypes as specified in the x-axis and assessed again at the 24 hpf stage for degree of phenotype severity as indicated in the legend. 54 Percentage of24 hpf embryos (%) (bnip-2 MO1) 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Intermediate Severe Dead 1-somite WT (n=18) 77.8 5.6 5.6 11.1 1-somite morphant (n=82) 2.4 11.9 34.5 51.2 Epiboly arrested (n=27) 0 0 11.1 88.9 Percentage of 24 hpf embryos (%) (bnip-2 MO2) Figure 3.7: bnip-2 MO1-injected embryos that show abnormalities at the 1somite stage or epiboly arrest display. Percentages of embryos showing different phenotypes (indicated by legend) at the 24 hpf stage. Embryos were injected with bnip-2 MO1, assessed for phenotype at 9 hpf (Figure 3.2) and 24 hpf (Figure 3.4), segregated according to phenotypes as indicated in the x-axis and assessed again at the 24 hpf stage for phenotypes as indicated in the legend. 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT Intermediate Severe Dead 1-somite WT (n=16) 20.0 60.0 20.0 0.0 1-somite morphant (n=44) 0.0 22.7 68.2 9.1 Epiboly arrested (n=8) 0.0 0.0 25.0 75.0 Figure 3.8: bnip-2 MO2-injected embryos that show abnormalities at the 1somite stage or epiboly arrest display.. Percentages of embryos showing different phenotypes (indicated by legend) at the 24 hpf stage. Embryos were injected with bnip-2 MO2, assessed for phenotype at 9 hpf (Figure 3.2) and 1somite stage (Figure 3.5), segregated according to phenotypes as indicated in the x-axis and assessed again at the 24 hpf stage for phenotypes as indicated in the legend. 55 B. ntl A. ntl+dlx3+hgg1 * * * * * * * * * * Control MO D. myoD C. papc Control MO MO Control F. eve1 E. bmp4 Control MO Control MO Control MO Figure 3.9: Analysis of marker gene expression in control and bnip-2 morphant zebrafish embryos. Control and bnip-2 MO-injected embryos were fixed at the appropriate stages and subjected to in situ hybridisation for the visualisation of marker genes. For each marker gene section, control is on the left and bnip-2 morphants (MO) on the right. Detailed description in Chapter 3.2. (A) ntl, dlx3 and hgg1, 1-somite stage, dorsal view, animal pole to the top; mediolateral widening of neural plate (dlx3) (outlined in asterisks *), polster (hgg1) located posterior to neural plate instead of anterior as observed in control. (B) ntl, tailbud stage, dorsal view, animal pole to the top; mediolateral widening and anterior-posterior shortening of notochord. (C) papc, 2-somite stage, dorsal view, animal pole to the top, arrows indicate the mediolateral widening of bnip-2 morphant papc expression domain; mediolateral broadening and shortening of posterior paraxial mesoderm. (D) myoD, 7somite stage, dorsal view, animal pole to the top; somites are more closely spaced or compressed and widened mediolaterally. (D) bmp4, tailbud stage, lateral view; bmp4 expression unaffected in morphants. (E) eve1, tailbud stage, lateral view; eve1 expression unaffected in morphants. 56 3.2 bnip-2 mRNA suppresses gastrulation defects in bnip-2 knockdown morphants To facilitate statistical analyses of morphants, embryos were classified into four categories – ‘Wild type’ (WT), ‘Mild’, ‘Intermediate’ and ‘Severe’ – based on severity of defects observed at the 10-somite stage (Figure 3.10). This developmental stage was selected as it is the earliest stage from the endpoint of gastrulation to have sufficiently developed anterior and posterior structures that were easily distinguishable. ‘Wild type’ embryos display no reduction in head structures and anterior-posterior lengths are comparable to that of un-injected WT embryos. ‘Mild’ embryos have a slight but observable reduction in head structures and visible decrease in anterior-posterior length, ‘Intermediate’ embryos have significant and obvious reduction and abnormalities in head structures and much shortened anterior-posterior lengths. ‘Severe’ embryos exhibit drastic shortening of anterior-posterior lengths and severe reduction in head structures such that head and tail were indistinguishable. The double blind method of obtaining statistical data was used in experiments to ensure impartiality and to prevent errors arising from bias. As confirmation of the specificity of the phenotypic defects observed, a dose-dependent experiment was performed in which embryos were injected with increasing doses (0.5 ng, 1 ng and 2 ng) of bnip-2 and assessed for any corresponding increase in severity of phenotype. 0.5 ng of bnip-2 MO yielded 10.8% morphants, 1 ng yielded 47.5% morphants and 2 ng resulted in 69.8% morphants (Figure 3.11). In addition, co-injection of 1ng bnip-2 MO and 100150pg GFP-tagged bnip-2 mRNA which contained silent nucleotide 57 substitutions that prevent its binding to and sequestration of bnip-2 MO, resulted in 37.2% of WT embryos compared with 8.9% for embryos injected with bnip-2 MO alone (Figure 3.12). GFP mRNA was used as a control for GFP-tagged bnip-2 mRNA in this experiment. The incomplete rescue could be due to the need for a precise dose of bnip-2 mRNA or could be because the protein translation system in the embryo was perturbed due to the introduction of interfering MO and the introduction of a large amount of exogenous mRNA. Nonetheless, the use of a rigorous control morpholino, the dose-dependency of phenotypic defects caused by bnip-2 MO knockdown and the ability of bnip-2 mRNA to attenuate the defects or ‘rescue’ the morphant phenotype, indicate that the morphant phenotype observed was the result of specific interference of bnip-2 function. 58 Percentage of embryos (%) Figure 3.10: bnip-2 morphants embryos are categorised according to severity of phenotype. The lateral view of embryos is shown. ‘Wild type’ embryos display no reduction in head structures and anterior-posterior lengths are comparable to that of un-injected WT embryos. ‘Mild’ embryos have a slight but observable reduction in head structures and visible decrease in anterior-posterior length, ‘Intermediate’ embryos have significant and obvious reduction and abnormalities in head structures and much shortened anteriorposterior lengths. ‘Severe’ embryos exhibit drastic shortening of anteriorposterior lengths and severe reduction in head structures such that head and tail (indicated by red arrows) were indistinguishable. The double blind method of obtaining statistical data was adopted. 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT (%) Mild (%) Intermediate (%) Severe (%) Control MO (n=150) 100.0 0 0 0 0.5ng (n=163) 1.0ng (n=168) 2.0ng (n=149) 89.2 8.7 1.5 0.5 52.5 25.0 21.4 1.1 30.2 14.2 31.2 24.4 Figure 3.11: bnip-2 knockdown by morpholino is dose-dependent. Percentages of embryos of different degrees of phenotype severity (indicated by legend) generated by each treatment as specified in the x-axis. Embryos in each group were injected with control MO or different doses of bnip-2 MO1 at the doses indicated and assessed for degree of severity as described in Figure 3.10. 59 Percentage of embryos (%) 100.0 90.0 80.0 70.0 60.0 50.0 40.0 30.0 20.0 10.0 0.0 WT (%) Morphant (%) Control MO (n=236) bnip-2 MO (n=224) 98.0 2.0 8.9 91.1 bnip-2 MO + bnip-2 mRNA (n=336) 37.2 62.8 Figure 3.12: bnip-2 morphant phenotype can be rescued by bnip-2 mRNA. Percentages of wild type and morphant phenotype embryos (indicated by legend) generated by each treatment as specified in the x-axis. Percentages obtained from pooling at least three independent experiments. 60 3.3 bnip-2 knockdown causes abnormalities in epibolic mechanisms To examine epiboly defects on the cellular level, whole-mount late epiboly embryos were fixed and visualised for phalloidin-stained F-actin in the EVL using immunofluorescence. F-actin delineated the boundaries of EVL cells where it forms peripheral cortical belts, and therefore cell shape could be clearly examined. At late epiboly, bnip-2 morphant EVL cells appeared to have a smaller length-to-width ratio and therefore appeared more rounded in shape compared to the narrow and elongated control EVL cells (Figure 3.13) The immunostaining of F-actin also revealed a punctate staining pattern located around the EVL leading edge in late epiboly embryos (Figure 3.14). In wild type epiboly stage embryos, two F-actin rings form around the circumference of the margin – one ring is located along the EVL leading edge, and another punctate actin ring is located in the external yolk syncytial layer (E-YSL), a wide belt of YSL nuclei situated peripherally to the blastoderm margin, vegetal to the EVL leading edge (Lepage and Bruce, 2010). At 50% epiboly, control and bnip-2 morphant embryos displayed punctate F-actin structures, which were diffused and collectively undefined in formation, vegetal to the EVL margin. At 80% epiboly, while both control and bnip-2 morphants displayed a defined band of punctate actin, the band in bnip-2 morphants was wider compared to control embryos (Figure 3.14). The embryos were also subjected to live imaging of cell shape changes enabled by co-injecting embryos with the mRNA of a commercially available membrane-bound form of enhanced green fluorescence protein (mGFP). mGFP was created by fusing the palmitoylation sequence of GAP43 to the Nterminus of eGFP. Images were captured at two time points – 50% epiboly 61 (time 0) and 1h after 50% epiboly (~75% epiboly at 25 ͦ c). At 50% epiboly, control marginal EVL cells appeared generally oval in shape, but underwent a dramatic increase in LWR and became mediolaterally narrower and elongated in shape along the anterior-posterior axis 1h later (Figure 3.15). bnip-2 morphant marginal EVL cells appeared normal in morphology at 50% epiboly, but after 1h, the LWR ratio and cell shape appeared unchanged although the cells appeared to have enlarged in size (Figure 3.15). Live imaging with mGFP also revealed the detachment of EVL from DEL at late epiboly in bnip-2 morphants. The leading edge of the DEL in morphants lagged behind the leading edge of the EVL by about two marginal EVL cell lengths, whereas the distance between EVL and DEL in control embryos was approximately one EVL cell length (Figure 3.16). 62 MO Figure 3.13: bnip-2 morphant EVL cells display cell shape defects. Embryos were injected with control or bnip-2 MO, and subjected to whole-mount immunostaining at late epiboly for F-actin using phalloidin. The EVL cells were imaged for cell morphology by a fluorescent microscope; lateral view; animal pole to the top. bnip-2 morphant EVL cells displayed a smaller lengthwidth ratio (LWR) (both length and width are delineated by blue arrows) than control EVL cells and appeared more rounded in shape. MO Figure 3.14: bnip-2 morphant EVL cells display actin ring abnormality. Embryos were injected with control or bnip-2 MO, and subjected to wholemount immunostaining at late epiboly for F-actin using phalloidin. The embryos were imaged for the actin ring (indicated by yellow arrowhead) in the E-YSL; lateral view; animal pole to the top. bnip-2 morphants exhibited a thicker actin ring than the actin ring of control embryos. 63 MO Figure 3.15: bnip-2 morphant EVL marginal cells display defects in cell shape changes. Embryos were co-injected with control and mGFP mRNA or bnip-2 MO and mGFP mRNA. EVL marginal cells were imaged live at two time points - 50% epiboly (time 0) and at 1h; lateral view; animal pole to the top; EVL leading edge indicated by white arrowhead. At time 0, both control and bnip-2 morphant marginal EVL cells appeared generally oval in shape. At 1h, control EVL marginal cells underwent a dramatic increase in LWR, becoming mediolaterally narrower and elongated in shape along the anteriorposterior axis. However, bnip-2 morphant EVL marginal cells remained relatively unchanged in LWR and shape, although the cells appeared to have enlarged in size. Length and width of cells are delineated by arrows. 64 Control MO bnip-2 MO Figure 3.16: bnip-2 morphants display separation of EVL-DEL during late epiboly. Embryos were co-injected with control and mGFP mRNA or bnip-2 MO and mGFP mRNA. Embryos were imaged such that EVL and DEL leading edges could be observed; lateral view; animal pole to the top; DEL leading edges indicated by white arrowhead, EVL leading edges by yellow arrowhead. A larger distance between EVL and DEL could be observed. 65 3.4 bnip-2 knockdown causes increased RhoA activity rhoA and cdc42 are members of the RhoA-related subfamily of the Rho small GTPases family, and together with Rac, are key regulators of actin cytoskeleton dynamics. rhoA is best known for its ability to induce focal adhesion formation and the formation of stress fibers primarily via downstream effectors such as Rho-associated kinase (Ridley and Hall 1992), while cdc42 triggers filopodia formation. They are also involved in a variety of cellular activities that include cell migration, cell morphology, cytokinesis, endocytosis and phagocytosis (Barrett et al., 1997). In development, rhoA has been shown to be important for processes as the generation of tissue polarity, actin structuring in oogenesis, head involution, segmentation and dorsal closure in Drosophila (Johndrow et al., 2004), and notably gastrulation in Drosophila, Xenopus and zebrafish primarily as part of the non-canonical Wnt signalling pathway (Jessen and Solnica-Krezel, 2005). cdc42 is involved in germband retraction, epithelial integrity, actin morphology in oogenesis in Drosophila, as well as gastrulation in Xenopus and zebrafish. In zebrafish development in particular, rhoA is found to regulate apoptosis through Mek/Erk pathway (Zhu et al., 2008), mediate cytokinesis and epiboly via Rho kinase (Lai et al., 2005), function downstream of Wnt5, Wnt11 (Zhu et al., 2006) and Fyn/Yes (Jopling et al., 2005) and upstream of Rho kinase and Diaphanous (Zhu et al., 2006) to regulate convergence-extension movements, and mediate midline convergence of heart primordia (Matsui et al., 2005). Cdc42 regulates actin polymerization critical for proper cell motility and migration control downstream of ptenb during gastrulation in zebrafish (Yeh et al., 2011) 66 More strikingly, rhoA and cdc42 have been observed to function downstream of bnip-2 in cell culture studies (unpublished data). In MDCK epithelial cells, BNIP-2 activates the Rho/ROCK/myosin signalling cascade thereby retarding cell spreading and collective cell migration, but in fibroblasts, inactivates Rho by binding BPGAP1 and enhancing its activity towards Rho, leading to greater loss of stress fibers and reduced cell proliferation (Pan and Low, 2012). BNIP-2 induces extensive changes in epithelial and fibroblast cell morphology and membrane protrusions by binding and activating Cdc42 (Zhou et al., 2005). Taking into account the role of RhoA and Cdc42 in actin cytoskeleton dynamics, cell motility and unpublished findings that BNIP-2 functionally and physically interacts with RhoA and Cdc42 in cell cultures and in zebrafish respectively, the hypothesis that bnip-2 and rhoA or cdc42 may function in the same signalling pathway to regulate gastrulation was made. If rhoA and cdc42 function downstream of bnip-2, the regulation of these Rho GTPases may be perturbed upon bnip-2 knockdown. To address this conjecture, commercially available G-LISA kits were used to assay the activity of RhoA and Cdc42 in lysate harvested from bnip-2 knockdown zebrafish morphants. Zebrafish lysate samples were incubated in individual wells of a 96-well plate that contained a protein that bound specifically to active GTP-bound RhoA or Cdc42. After rigorous washing, a primary antibody to RhoA or Cdc42 was administered followed by a horse radish peroxidase-conjugated secondary antibody and a substrate for colorimetric detection and measurement. 67 Lysate from bnip-2 morphants yielded a 1.52-fold higher level of active RhoA (p600) Active Cdc42 1 0.8 0.6 0.4 0.2 0 Control MO bnip-2 MO Figure 3.17: bnip-2 morphants have higher RhoA activity. (A-B) Embryos in each group were injected with control MO or bnip-2 MO, pooled and harvested for lysates that were assayed for active RhoA (A) or active Cdc42 (B) levels (see text for details).Values are averaged from at least six independent experiments. y-axis absorbance units are arbitrary. Asterisk * indicates p[...]... phosphorylation of BNIP- 2 (Low et al., 20 00) Between BNIP- 2 and Cdc42GAP, there is also competitive binding to Cdc 42 Strikingly, via the BCH domain, BNIP- 2 also binds and promotes the GTPase-activity intrinsic to Cdc 42 via a novel arginine patch motif, 23 5 RRLRK239, similar to the “arginine finger” employed by one contributing partner in a Cdc 42 homodimer, and this too, is inhibited by tyrosine phosphorylation of. .. and Low, 20 12) Moreover, BNIP- 2 has a kinesin-binding motif which is necessary for its trafficking in cells (Aoyama et al., 20 09) These observations strongly support the role of BNIP- 2 in the regulation of GTPase signalling and cell dynamics, and the versatility of BNIP- 2 in engaging different Rho GTPases and their GAPs and GEFs suggest that BNIP- 2 is involved in regulating GTPase signalling in a contextdependent... underlying zebrafish gastrulation, and thus contribute insight into the molecular mechanisms underlying the regulation of cell dynamics by bnip- 2 xi 1 Introduction 1.1 BNIP- 2 1.1.1 Initial discoveries of BNIP- 2 The Bcl -2/ adenovirus E1B Nineteen kilo-daltons Interacting Protein -2, or BNIP- 2 in short, was initially discovered as one of three novel proteins, Nip1, Nip2 and Nip3, in a bid to identify interacting... the 5’UTR of bnip- 2 (Figure 1.3) Both MOs prevent the translation of all the bnip- 2 splicing isoforms in zebrafish as the isoforms share the same 5’UTR Presently, due to the unavailability of an antibody for zebrafish BNIP- 2, the effect of these MOs on BNIP- 2 protein level could not be verified However, using human polyBNIP -2 antibodies and lysates obtained from 36 to 48 hpf embryos injected with the. .. the Rho-binding domain (RBD) and the Cdc 42/ Rac interactive binding domain found commonly in Rho and Cdc 42/ Rac1 effector proteins, respectively (Pan and Low, 20 12) In particular, the BNIP- 2 BCH domain contains within the CRIB-like region an experimentally validated novel Cdc 42- binding motif, 28 5VPMEYVGI2 92, while BNIP- S, BNIP- XL and Cdc42GAP possess RBD-like motifs These GTPasebinding motifs have been... regulated to mediate developmental processes Given the versatility of BNIP- 2 in protein interactions, it is highly plausible that it engages different proteins to regulate or mediate different biological processes depending on the specific context in development Thus studying the role of bnip- 2 in development facilitates the understanding of the contextual signalling ability of bnip- 2 The aim of this study... activity of the gene to study the effect of gain -of- or loss-offunction of the gene 20 As have been mentioned, based on earlier findings of BNIP- 2, we hypothesised that BNIP- 2 is involved in GTPase-mediated signalling pathways that regulate cell dynamics and is therefore potentially involved in the developmental process of gastrulation, in which widespread cell movement behaviours constitute the driving... domain associated with a RhoGAP domain (Pan and Low, 20 12) The percentages indicate the degrees of amino acid sequence identities compared to the prototypical BNIP- 2 BCH domain This figure is adapted from Pan and Low, 20 04 6 1.3 BCH domain containing-proteins and cell dynamics There is significant conservation in two GTPase-binding motifs found in the BCH domains These motifs resemble the Rho-binding... BNIP- 2 (Low et al., 20 00) The BCH domain in Cdc42GAP does not have GAP activity to Cdc 42 as it lacks the arginine patch Therefore the BNIP- 2 interactome discovered from these early studies hinted at BNIP- 2 s involvement in a variety of pathways such as tyrosine kinase receptor signalling, GTPase-mediated signalling pathways and apoptosis, and suggested physiological significance that should be further... its role involves, at least in part, the regulation of the membrane localisation of E-cadherin through the modulation of RhoA activity In conclusion, this work introduces a novel molecular player in gastrulation, bnip- 2, which may also be a new link between cell dynamics and development These findings shed some light on the genetic interactions of bnip- 2 and their possible roles in mechanisms underlying ... prior finding of possibly interacting proteins of BNIP-2 led to the formation of research questions: Does the physical interaction of BNIP-2 with these proteins mean that BNIP-2 operates in the. .. the same zebrafish developmental signalling pathways as these proteins? Is BNIP-2 involved in the regulation of these proteins in early zebrafish developmental processes such as the hypothesised... activity of the gene to study the effect of gain -of- or loss-offunction of the gene 20 As have been mentioned, based on earlier findings of BNIP-2, we hypothesised that BNIP-2 is involved in GTPase-mediated