Expression of EBV genes in nasopharyngeal carcinoma

EXPRESSION OF EBV GENES IN NASOPHARYNGEL CARCINOMA LI BOJUN （Bachelor of Medicine, CUMS） A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF MICROBIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2005 Acknowledgements ACKNOWLEDGEMENTS I would like to express my deepest gratitude to my two supervisors, Professor Chan Soh Ha and Dr. Hung Siu Chun, who give me guidance, support and encouragement throughout the course of this study. I sincerely thank Ms. Soo, Lini, Meera and all the people in the WHO Immunology Centre for their technical assistance and kind cooperation. I am grateful to my friends, Yu Hongxiang, Ge Feng and Paul, and all the people in the Department of Microbiology for their help in my study. I also thank my parents for their emotional support during this period. -I- Table of Contents TABLE OF CONTENTS ACKNOWLEDGEMENTS…………………………………………………………..Ⅰ TABLE OF CONTENTS……………………………………………………………..Ⅱ LIST OF TABLES……………………………………………………………………Ⅵ LIST OF FIGURES………………………………………………………………….Ⅶ SUMMARY…………………………………………………………………………...Ⅷ CHAPTER 1. INTRODUCTION……………………..………………….…….…….1 1.1 EPSTEIN-BARR VIRUS (EBV)……………………………………….……......2 1.1.1 Classification……………………….…………………………...…….……..2 1.1.2 Virus structure………………….………………………………….………..3 1.1.3 Genome structure……………….………………….…………………….....3 1.1.4 EBV infection of cells in vitro……………………………………………...4 1.1.4.1 Latent infection……………………………………………..………...5 1.1.4.1.1 Latent gene function……….……….....……………………….5 1.1.4.2 Lytic infection……….………..….………………………………….11 1.1.4.2.1 Immediate-Early (IE) genes……………..…………………...11 1.1.4.2.2 Early genes…………………..………………..………………13 1.1.4.2.3 Late genes…………………………….………………………15 1.1.5 EBV infection in vivo…………………..………………………………16 1.1.5.1 Primary infection………………..………………………………16 1.1.5.2 Different transcription programs used by EBV in vivo……...17 - II - Table of Contents 1.1.5.3 EBV lifecycle in vivo………………………………………..….18 1.1.6 EBV associated malignancies…………………………………………21 1.1.6.1 Burkitt’s Lymphoma (BL)……………………………………..22 1.1.6.2 Hodgkin’s Disease (HD)………………………………………..23 1.1.6.3 Non-Hodgkin’s Lymphoma in Immunocompetent Individuals………………..………………23 1.1.6.4 NPC……………………………………………………………...24 1.1.6.5 Posttransplant lymphoproliferative disorders (PTLDs)……..24 1.1.6.6 AIDS-related lymphomas (ARLs)……………………………..24 1.2 NASOPHARYNGEAL CARCINOMA (NPC)………………………………….26 1.2.1 Histological classification…………………………………………………...26 1.2.2 Anatomy……………………………………………………………………..26 1.2.3 Epidemiology………………………………………………………………..27 1.2.4 Clinical symptoms…………………………………………………………..27 1.2.5 Etiology……………………..………………………………………………28 1.2.5.1 Genetic factor………………………………………………………...28 1.2.5.1.1 Inactivation of tumour suppressor genes…………………….28 1.2.5.1.2 Oncogene activation…………………………………………...29 1.2.5.1.3 HLA association………………….…………………………….30 1.2.5.2 Environmental factor……………………….……………………….30 1.2.5.3 EBV infection………………………………………………………...31 1.2.5.3.1 EBV latent gene expression in NPC…………………………32 - III - Table of Contents 1.2.5.3.2 Lytic genes expression in NPC……………………………….34 1.2.6 Diagnosis of NPC……………………………………………………..35 1.2.6.1 Serological diagnosis……………………………………………35 1.2.6.1.1 EBV EA and VCA antibodies……………………………36 1.2.6.1.2 Other EBV antibodies in NPC patients………………...37 1.2.7 Treatment……………………………………………………………..38 1.3 OBJECTIVE OF THIS STUDY…………………………………………………39 CHAPTER 2. MATERIALS & METHODS………………………………………...40 2.1 SUBJECTS AND SAMPLES…………………………………………………….41 2.2 CELL CULTURE AND TECHNIQUES………………………………………...41 2.2.1 Maintenance of cell line…………..……………………..………………...41 2.2.2 Induction of EBV lytic cycle in cell lines…………………………………42 2.3 MOLECULAR TECHNIQUES………………………………………………….42 2.3.1 Primers……………………………………………………………………..42 2.3.2 Total RNA/DNA extraction………………………………………….…….43 2.3.3 Removal of decontaminating DNA from RNA….………………………..44 2.3.4 Reverse Transcription……………………………………………………..44 2.3.5 PCR…………………………………………………………………………45 2.3.6 One-Step RT-PCR………………………………………………………….45 - IV - Table of Contents CHAPTER 3. RESULTS & DISCUSSIONS………………………………………...47 3.1 PART 1: TESTING OF PRIMERS………………………………………………48 3.1.1 Testing of primers…………………………………………………………...48 3.1.2 Total RNA extraction, DNase I treatment and Reverse Transcription…..50 3.1.3 EBV RNA profiles of EBV cell lines………………………………………..52 3.1.3.1 B-lymphocyte-derived cell lines……………………………………...52 3.1.3.2 NPC-derived cell line C666-1………………………………..………69 3.2 PART 2: TEST EBV GENE EXPRESSION IN NPC BIOPSIES……………..72 3.2.1 DNA and RNA extraction……………………..…………………………..72 3.2.2 EBV DNA profiling of tissue sample……………………………………...72 3.2.3 EBV RNA profiling of tissue samples…………………………………….77 3.2.4 Orientation-Specific RT-PCR …………………..………………………...86 3.3 PART 3: CONCLUSION…………………………………………………………89 3.3.1 Successfully construct a profiling system to check the transcripts of EBV genes…………………………………...90 3.3.2 Lytic gene expression in NPC biopsies………..………………………….90 3.3.3 BHLF1 expression in NPC biopsies……………………………………..91 3.3.4 Further studies on BHLF1………………………………………………92 CHAPTER 4. REFERENCES………………………………………………………94 APPENDIX…………………………………………………………………………116 -V- List of Tables LIST OF TABLES CHAPTER 1. INTRODUCTION Table 1. Transcription programs used by EBV to establish long life infection ….........................................................18 Table 2. Gene expression in different types of EBV latent infection……………….22 CHAPTER 2. MATERIALS & METHODS CHAPTER 3. RESULTS & DISCUSSIONS Table 3. EBV gene expression pattern in different cell lines……………..……..62-64 Table 4. EBV gene profiling arrangement for tissue samples……………..……….73 Table 5. RNAs profiling results of tissue biopsies…………..…………..….………..81 - VI - List of Figures LIST OF FIGURES CHAPTER 1. INTRODUCTION Fig. 1 The BamHI fragments on EBV genome………………………………………..4 Fig. 2 EBV life cycle in vivo ….....................................................................................21 CHAPTER 2. MATERIALS & METHODS CHAPTER 3. RESULTS & DISCUSSIONS Fig. 3 Testing of EBV-gene specific primers (partial results)……………………..49 Fig. 4 Analysis of RNA and DNA extracted from B95-8 cells without TPA induction.………………………………………….50 Fig. 5 Analysis of cDNA quality…………………………………………………..…51 Fig. 6 cDNA profiling results of different EBV cell clines……………………..54-61 Fig. 7 DNA profiling results of one NPC biopsy………..………………………….76 Fig. 8 DNA profiling results of one non-NPC tissue biopsy……………………….77 Fig. 9 RNA Profiling results of one NPC patient tissue sample…………………...79 Fig. 10 RNA Profiling results of one non-NPC patient tissue sample………..…...80 Fig. 11 BBLF1, BGLF1 and BGLF4 transcription map…………………………..83 Fig. 12 Transcription map of genes within or near Bam HI A region……………85 Fig. 13 Orientation test of transcripts of some EBV genes…………………….…87 - VII - Summary SUMMARY Nasopharyngeal carcinoma (NPC) is one of the most common carcinoma found in the Southern Chinese and Asian population. It is closely associated with Epstein-Barr virus (EBV). Although it is a general concept from early studies that EBV infection resulting in NPC tumour formation is predominantly restricted to the latency stage, present studies have suggested that some EBV lytic genes may be expressed in NPC biopsies and contribute to the development of oncogenesis. By using reverse transcriptase polymerase chain reaction (RT-PCR) techniques, we have successfully constructed a profiling system which can detect EBV RNA expression and used this system to investigate the expression in NPC biopsies. Our results show that some EBV lytic genes are transcribed in NPC biopsies in addition to the latent genes that have been known to express. Among lytic genes, BHLF1 is found to be expressed in NPC for the first time in this study. This study is also the first comprehensive study of EBV gene expression in NPC. - VIII - CHAPTER 1 INTRODUCTION -1- Introduction 1.1 EPSTEIN-BARR VIRUS (EBV) Epstein-Barr virus (EBV) is ubiquitous human herpesvirus, infecting about 95% of the adult population worldwide. Primary infection with EBV generally occurs in early childhood and is asymptomatic. EBV can coexist with most human host without causing diseases. However in some individuals this virus is the causative agent of infectious mononucleosis and associated with the development of variety of human cancers, including B-cell neoplasms such as Burkitt’s lymphoma, Hodgkin’s disease (HD), certain forms of T-cell lymphoma and some epithelial tumours such as nasopharyngeal carcinoma (NPC) (Rickinson & Kieff, 1996). 1.1.1 Classification EBV is a gammaherpesvirus of the Lymphocryptovirus (LCV) genus. Herpesvirus family includes 3 subfamilies: the alphavirus subfamily includes Herpes Simplex virus I, II and Varicellazoster virus; betaherpesvirus include Cytomegalovirus and Human Herpesvirus 6 and 7; gammaherpesvirus include Human Herpesvirus 8 and EBV. The gammaherpesvirus subfamily includes gamma 1 (LCV) and gamma 2 or Rhadinovirus (RDV) genera. EBV is the only human LCV. Two subtypes of EBV are known to infect human: EBV type 1 and type 2. Type 1 is far more common in most infected populations. The two types differ in the genes that code for EBV nuclear protein (EBNA): EBNA-2, EBNA-3a, EBNA-3b, EBNA-3c and EBNA-LP (Kieff & Rickinson, 2001). -2- Introduction 1.1.2 Virus structure EBV has a toroid-shaped protein core which is wrapped with double-stranded DNA, a nucleocapsids with 162 capsomeres, a protein tegument between the nucleocapsids and the envelope, and an outer envelope with external glycoprotein spikes (Rickinson & Kieff, 1996). 1.1.3 Genome structure EBV genome is a 184-kbp long, double-stranded, linear DNA. It consists of tandemly reiterated 0.5 Kbp terminal direct repeats (TR) at the ends, tandemly reiterated 0.3 Kbp internal direct repeat (IR1), short and long unique sequence domains (US, UL). The two sequence domains are separated by IR1. When EBV infects a cell, the linear DNA genome becomes a circular episome with a characteristic number of terminal repeats and this is the common form of EBV genome in vivo. In some situations, the EBV genome can integrate into the host chromosome (Kieff & Rickinson, 2001). Since the EBV genome was sequenced from the BamHI fragment library, EBV open reading frames (ORFs) frequently named based on their location in BamHI fragments which from A to Z, and a to e, in descending order of the fragment sizes (See Fig. 1). For example, BARF1 means BamHI A fragment, first rightward ORF. -3- TR Introduction OriP C W W W W Y H F Q U PO M S L E Z R K B G D TXV I A TR TR Fig. 1 The BamHI fragments on EBV genome. Diagram showing the location of BamHI fragments on the prototype B95-8 EBV genome. The origin of plasmid replication (oriP) and the terminal repeats (TR) are indicated in the diagram. 1.1.4 EBV infection of cells in vitro EBV has a strong tropism for human B lymphocytes in vitro, and EBV entry into these cells is mediated by a viral envelope glycoprotein gp350/220 which is the most abundant envelope glycoprotein of EBV. It can bind to a B lymphocyte cell surface protein CD21 (CR2) which is a receptor for EBV and the C3d component of complement, and allow EBV to absorb to the cells. Though EBV can infect epithelial cells in vivo, it is not easy for EBV to infect and transform epithelial cells in vitro. Previous studies suggested that EBV glycoprotein gH and EBV-specific immunoglobulin A (IgA) may be associated with EBV infection in epithelial cells in vivo (Sixby et al., 1992; Molesworth et al., 2000). Infection of primary human B lymphocytes with EBV results in conversion and continuous proliferation into long term lymphoblastoid cell lines (LCLs). During growth transformation virus does not replicate and produce progeny virons but rather is replicated by host DNA polymerase as an extrachromosomal episome. This is called latent infection. -4- Introduction EBV-latent infected cells can be reactivated to get into lytic infection to produce viral progeny in vivo. Because there is no in vitro system naturally permissive for EBV lytic cycle, lytic EBV infection is usually studied by inducing latently infected cells to become permissive for lytic virus replication. Phorbol esters are reliable and broadly applicable inducers. Following induction, a variable proportion of cells become permissive for virus replication and undergoes cytopathic changes (Kieff & Rickinson, 2001). 1.1.4.1 Latent infection EBV latently infected cells express a limited number of viral genes known as latent genes. EBV latent genes include the viral nuclear antigen family (EBNA): EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C and EBNA-LP; latent membrane proteins (LMP): LMP1, LMP2A, LMP2B; two small nonpolyadenylated noncoding transcripts: EBER1 and EBER2 and a complex family of spliced, polyadenylated BamHI A rightward transcripts (BARTs). 1.1.4.1.1 Latent gene function EBNA-LP EBV Nuclear Antigen Leader Protein (EBNA-LP) is an initial gene product that is expressed together with EBNA-2 following EBV infection of B cells in vitro (Sample et al., 1986). EBNA-LP is considered important for EBV-induced B-cell immortalization based on the observation that EBNA-LP mutant viruses show severely impaired transforming activity (Mannick et al., 1991). The major function of EBNA-LP -5- Introduction is to stimulate EBNA-2-mediated transcriptional activation of viral and cellular genes such as LMP-1 and cyclin D2 (Nitsche et al., 1997; Sinclair et al., 1994). EBNA-LP also interacts with many cellular proteins such as pRb, p53, heat shock protein 70 family (hsp72/hsc73), HS1-associated protein X1, bcl-2, HA95, protein kinase A (Szekely et al., 1993; Matsuda et al., 2003; Mannick et al., 1995; Han et al., 2001). These data suggest EBNA-LP may have multiple functions in B-cell transformation by modulating some components of the cellular machinery. EBNA2 EBNA2 is a transactivator that controls several viral and cellular genes expression. It is believed to be a key protein for B-cell immortalization. The function the EBNA2 is recognized by a transformation-incompetent but replication-competent laboratory EBV strain P3HR-1, which deletes the gene coding for EBNA2 (Bornkamm et al., 1982). EBNA2 can activate other EBV latent gene expression by transactivating the Bam HI-C-promoter (Cp) which partially controls the genes expression of EBNAs, and the promoters of LMP1 and LMP2 (Sung et al., 1991; Abbot et al., 1990). EBNA2 also shows the ability to regulate some cellular genes expression including the proto-oncogene c-myc as well as c-fgr, CD21, CD23 (a surface marker of activated B-cells), BLR2/EBI1 (the chemokine receptor) and represses transcription of the immunoglobulin heavy chain locus (Patel et al., 1990; Burgstahler et al., 1995; Cordier et al., 1993; Kaiser et al., 1999; Jochner et al., 1996). Based on these data, EBNA2 has a profound effect on host cells, and mediate immortalization of B lymphocyte. Studies on how EBNA2 regulates other genes expression mechanism show that -6- Introduction EBNA2 can interact with a cellular DNA binding protein RBP-J. RBP-J is a transcriptional repressor protein, and can repress transcription by binding to a histone deacetylase complex (HDAC). EBNA2 relieve the repression of RBP-J by masking the transcriptional repression domain and replace the HDAC corepressor (Hsieh et al., 1995, 1999). In this way, regulation of gene expression by EBNA2 is similar to Notch, a transmembrane receptor. Both of them modulate gene expression through interaction with RBP-J. EBNA2 could be regarded as a functional viral homologue of an activated Notch receptor (Jarriault et al., 1995). EBNA3A, 3B, 3C Studies have shown that EBNA3A and EBNA3C are required for B-cell immortalization whereas EBNA3B is dispensable (Tomkinson et al., 1993). EBNA3s are transcriptional regulators and have the ability to inhibit transcriptional activation of EBNA2 responsive promoters. EBNA3s can bind with RBP-J and disrupt its binding to EBNA2, thus repressing the transactivation of EBNA2 (Robertson et al., 1996). It is proposed that ENBNA2 and EBNA3s work together to precisely regulate some viral and cellular gene expression by the antagonistic control of RBP-J activity. Except counterbalance the action of EBNA2, EBNA3s may have the ability of transcription activation. EBNA3C can increase the production of LMP1 in the presence of EBNA2 (Zhao et al., 2000). Further researches on EBNA3C show it may disrupt multiple cell cycle checkpoints and induce nuclear division (Parker et al., 2000). -7- Introduction EBNA1 EBNA1 is a sequence specific DNA binding phosphoprotein that is required for the replication and maintenance of the episomal EBV genome. This function is achieved through the binding of EBNA1 to oriP which contains multiple EBNA1 binding sites. OriP is a cis-acting element in EBV genome. By associated with EBNA1, it enables the viral persistence of episomes in EBV infected-cells (Kieff & Rickinson, 2001). EBNA1 is the only EBNA-associated with chromosomes during mitosis and is a key mediator of EBV DNA binding to chromosomes. EBNA1 also has some function in regulation of gene expression. For example, it can interact with two sites downstream of Qp to negatively regulate its own expression (Nonkwelo et al., 1996). In addition, EBNA1 has a central role in maintaining latent EBV infection. EBNA1 has Gly-Ala repeats located in its N-terminal. The repeats may generate a cis-acting inhibitory signal that interferes with antigen processing and MHC class I-restricted presentation. It suggests that EBNA1 can enable EBV-infected cells to escape from CTL surveillance, and support EBV persistence in cells (Levitskaya et al., 1995). LMP1 The EBV latent membrane protein (LMP1) is a versatile protein and has profound effects on target cells. It is directly implicated in oncogenesis due to its ability to recruit several cellular proteins and stimulate different signal pathways. LMP1 consists of a short cytoplasmic N-terminus tail, six transmembrane domains and a long cytoplasmic C terminus (Coffin et al., 2001; Kaykas et al., 2002). -8- Introduction The C-terminal 200-aa sequence is important for function of LMP1. It can bind with several protein and participate in different signal pathway. For example: 1. The tumour necrosis factor receptor–associated factors (TRAFs) and TNFR-associated death domain protein (TRADD) can bind with the C-terminal domain, and mediate nuclear factor-κB (NFκB) activation. The activated NFκB can translocate from cytoplasm to the nucleus and regulate some target genes which are essential for cell proliferation and anti-apoptosis (Devergne et al., 1996). 2. Janus kinase 3 (JAK3) is also supposed to bind with C-terminal domain of LMP1, and activate signal transducer activator of transcription (STAT) to regulate transcription (Gires et al., 1999). 3. Recent studies show that PI3-K (phosphatidylinositol 3 kinase) /Akt (protein kinase B) pathway can be activated via the LMP1 C-terminal, and results in promoting cell survival and remodeling actin filament (Dawson et al., 2003). In summary, LMP1 uses several different signal pathways to disrupt normal gene expression and induce uncontrollable cellular growth, resulting in tumour formation. LMP2 LMP2 encodes 2 proteins: LMP2A and LMP2B. These two proteins are integral membrane proteins which share their 12 transmembrane domains and the short C-terminal tail. Their difference is in N-terminal domain: LMP2A carries an extra hydrophilic N-terminal domain of 119 amino acids compared to LMP2B (Longnecker et al., 1991). Both LMP 2A and 2B have been shown to be dispensable for lymphocyte transformation (Speck et al., 1999). LMP2A N-terminal domain includes some -9- Introduction phosphorylated tyrosine residues which may provide binding sites for the cellular protein containing Src homology 2 (SH2) (Longnecker et al., 1991). Several phosphotyrosine kinases (PTKs) bind to LMP2A via their SH2 domain and are then activated to regulate cellular growth. LMP2A expression in B cells results in the bypass of normal B-lymphocyte developmental checkpoints, allowing immunoglobulin negative cells to colonize peripheral lymphoid organs. It suggests that LMP2A may resemble B cell receptor (BCR), thus providing inappropriate developmental and survival signals to EBV infected B cell in latently infected human hosts (Caldwell et al., 1998). Another possible function of LMP2A is that it can prevent the activation of lytic EBV by blocking BCR-mediated signal transduction (Miller et al., 1994). This function may be important in keeping EBV infected B-lymphocyte in their latent stages when these cells circulate in the peripheral blood and bone marrow. EBERs The EBV encoded, small, nonpolyadenylated, noncoding RNAs (EBERs) are by far the most abundant EBV RNAs in EBV-transformed cells. They localize to the cell nucleus and associate with cellular protein La and EAP (EBER-associated protein). Their function is not clear. Virus mutants with EBER gene deleted can transform lymphocyte. It suggests they may not be essential for transformation (Swaminathan et al., 1991). BARTs Complementary-strand BamHI A rightward transcripts, known as BARTs, are - 10 - Introduction differentially spliced RNAs that are present in many types of EBV infections (Smith et al., 2001). Differential splicing of Bam A rightward transcripts yields a family of transcripts, which encompass an open reading frame BARF0. BARF0 is predicted to encode a 173-amino acid protein and NPC patients have shown to generate antibodies to the BARF0 polypeptide (Glligan et al., 1991). By using anti-BARF0 antiserum, a protein doublet of 30 and 35 kDa is identified in EBV-positive cell lines and EBV-positive tumour biopsies (Fries et al., 1997). These data indicate that proteins encoded by BARTs might be expressed. 1.1.4.2 Lytic infection As discussed before, EBV-latent infected cells can be induced into lytic infection to produce viral progeny. After induction virus gene expression follows a temporal and sequential order, and all EBV lytic genes can be classified into 3 groups: immediate-early (IE) genes, early lytic genes and late genes. Immediate-early genes are expressed early after induction despite the presence of protein synthesis inhibitor. Early lytic genes are expressed before virus DNA replication, and their expression are dependent on some immediately-early genes expression. Late genes expressed temporally later, and their expression reduces markedly in the presence of viral DNA synthesis inhibitors. 1.1.4.2.1 Immediate-Early (IE) genes IE genes are essentially considered to cause the switch from latent infection to - 11 - Introduction lytic infection. However IE gene expression cannot be considered synonymous to full viral lytic replication (Rickinson & Kieff, 1996). IE genes include BZLF1, BRLF1, BRRF1 and the BI’LF4 (Segouffin et al., 2000; Marschall et al., 1991). BZLF1, BRLF1 BZLF1 and BRLF1 encode two transcriptional activator proteins ZEBRA (Z, EB Replication Activator) and Rta (R transactivator) sequentially. Both proteins are essential for the switch from latency to lytic infection. They are expressed simultaneously within two hours of induction and consequently trigger a cascade of sequential expression of numerous early genes (Feederle et al., 2000). ZEBRA is a sequence-specific DNA-binding protein of 35 KD, and distantly related to c-fos which binds DNA via degenerate AP-1 and CREB-like binding sites (Farrell et al., 1989). Previous study shows that introduction of the BZLF1 gene of Epstein-Barr virus into latently-infected B cells leads to induction of the entire lytic cycle program of the virus (Takada et al., 1986). Rta is also shown to be able to disrupt latency in epithelial cells and in certain B cell lines (Zalani et al., 1996; Ragoczy et al., 1998). Some studies suggest Rta can regulate gene expression via DNA binding dependent and independent mechanisms (Gutsch et al., 1994). BZLF1 is silent during latency, and its expression is controlled by the Zp promoter (Miller et al., 2002). ZEBRA activates target genes by binding to Z-responsive elements (ZREs) which are present in the promoters of some EBV genes, including the promoters of BZLF1 and BRLF1 (Kieff and Rickinson, 2001). BRLF1 expression is controlled by Rp promoter, and several cis elements involved in regulating Rp activity - 12 - Introduction including sites for binding cellular transcription factors NF1, Sp1, YY1, Zif and EBV ZEBRA. ZEBRA can activate Rta in all cell backgrounds that have been studied, and Rta can activate ZEBRA only in certain cell background (Zalani et al., 1996). Recent research shows that Rp is only weakly responsive to the lytic cycle inducer TPA and ionomycin. It suggests ZEBRA protein expression precedes transcription of BRLF1 (Pingfan et al., 2003). BZLF1 and BRLF1 can work together to regulate many EBV gene expression. For example, two key early promoter regulatory elements within DL and DR (duplication, left and right) are coordinately up-regulated by ZEBRA and Rta. DL and DR encode abundant early genes and include the origins for lytic viral DNA replication. Promoter activation has a strong positive effect on DNA synthesis (Kieff and Rickinson, 2001). Besides a role in activating EBV early and late gene expression, ZEBRA can down-regulate the latency associated promoters CP and WP. Perhaps it facilitates the transition from latency to lytic cycle (Sinclair et al., 1992). In addition to its involvement in viral genes expression, ZEBRA may interfere with IFNγ signal pathway to abrogate the IFNγ induced MHC-II up-regulation and thereby contribute to the immune escape for the latently EBV infected B cells (Morrison et al., 2001). 1.1.4.2.2 Early genes EBV early genes are different from late genes by their persistent transcription in the presence of inhibitors of viral DNA synthesis. At least 30 EBV genes belong to early - 13 - Introduction genes based on this criterion. (Kieff and Rickinson, 2001) BS-MLF1 The EBV nuclear protein BS-MLF1 (SM) is expressed early after entry of EBV into the lytic cycle. It is a posttranscriptional regulator of viral gene expression and essential for virion production (Gruffat et al., 2002). SM protein can activate intronless genes expression and inhibit expression of intron-containing genes (Ruvolo et al., 1998). In contrast to the majority of cellular genes, many EBV genes expressed during lytic cycle are intronless, and SM may therefore be important in enhancing expression of other lytic EBV genes. In addition, SM shows gene specificity, preferentially activating expression of some but not all intronless genes (Ruvolo et al., 2001). Except regulation of viral gene expression, SM protein can increase expression of some cell genes, such as some interferon-stimulated genes and STAT1 (Ruvolo et al., 2003). BHRF1 BHRF1 protein is expressed primarily during lytic infection and is dispensable for lymphocyte transformation (Lee et al., 1992). This protein shows partial sequence homology to the human apoptosis inhibitor bcl-2. Further research shows BHRF1 resembles bcl-2 both in its subcellular localization and in its capacity to enhance B-cell survival (Henderson et al., 1993). It suggests BHRF1 may enhance cell survival through the inhibition of apoptosis (Oudejans et al., 1995). BARF1 The BARF1 gene encodes a 31-kDa early protein which was shown to be able to induce malignant transformation in BALB/c3T3 cells and in the human B-cell line - 14 - Introduction Louckes. Injection of BARF1-expressing BALB/c3T3 cells into newborn rats resulted in the induction of aggressive tumours, while injection of BARF1-expressing Louckes human EBV-negative B cells into the same mouse induced the formation of a small tumour that regressed after 3 weeks (Wei et al., 1989). This gene was found to be expressed in NPC biopsies, and was shown to have the ability to immortalize primary monkey epithelial cells (Decaussin et al., 2000; Wei et al., 1997). It suggests that this gene maybe has a role in the development of NPC. BARF1 can activate anti-apoptotic Bcl-2 expression through its N-terminal region. The cooperation of BARF1 with Bcl-2 maybe contributes to the induction of transformation (Sheng et al., 2001). Some studies also show that BARF1 protein has some homology to the intracellular adhesion molecule 1 and the human colony-stimulating factor-1 receptor. Therefore BARF1 may be involved in immune suppression by being an antagonist to colony-stimulating factor 1 receptor or by occupying intracellular adhesion molecule 1 receptor on T lymphocytes (Strockbine et al., 1998). 1.1.4.2.3 Late genes Most late genes that can be identified directly or based on their homology with other herpesvirus genes encode structural proteins. For example, late gene BcLF1 encodes viral capsid antigen (VCA), BFRF3 encodes the small capsid protein VCA-p18, BdRF1 encode the scaffold protein VCA-p40 (van Grunsven et al., 1993; Baer et al., 1984). The viral glycoprotein genes that have been identified are all late genes, - 15 - Introduction including BLLF1 (gp350/220), BALF4 (gp110), BILF1 (gp64), BBRF3 (gp84/113), BXLF2 (gp85), etc (Kieff and Rickinson, 2001). BCRF1 BCRF1 protein shows amino acid sequence homology to human interleukin 10 (hIL-10) (Vieira et al., 1991). hIL-10 has the ability to inhibit the activation and effector function of T cells, monocytes and macrophages, and is a potent growth and differentiation factor for B lymphocytes (Rousset et al., 1992). Studies suggest BCRF1 is functionally homologous to hIL-10. They share the ability to modulate local immune response (Moore et al., 1991). Therefore BCRF1 may enhance the survival of EBV-infected cells by suppression of the host immune system. 1.1.5 EBV infection in vivo 1.1.5.1 Primary infection EBV is transmitted from person to person through saliva which contains infectious virus and/or productively infected cells (Yao et al., 1985). Primary infection may begin at oropharynx. EBV may infect oropharyngeal epithelium first and replicate in these infected cells, and then release virus to infect the B lymphocyte which is close to the epithelial cells (Greenspan et al., 1985). However, this sequence of infectivity is under debate. Some researchers suggest that B cells may be the main target of primary infection, and epithelial cells infection is occurred as the consequence of local reactivation of the virus from EBV-carrying B lymphocytes. This hypothesis is based on the observation: 1. EBV was found in B-lymphocytes but not in epithelial cells in the - 16 - Introduction tonsil form IM patients (Niedobitek et al., 1997). 2. X-linked agammaglobulinemoia patients who have no matured B-lymphocytes are free of EBV infection (Faulkner et al., 1999). Until now, it is general concept that EBV primary infection occurs at mucosal surfaces, but whether epithelial-cell infection is the first step of virus infection remains unresolved. Most people undergo asymptomatic primary infection during early childhood. Delayed primary infection can occurs in adolescence and can cause infectious mononucleosis (IM). In either case, primary infection is followed by life long, mostly asymptomatic, persistent infection (Niedobitek et al., 2000). 1.1.5.2 Different transcription programs used by EBV in vivo After primary infection, EBV can persist in human B cells, but the viral gene expression pattern in B cells in vivo is different from in vitro experiment. In general, the expression patterns can be defined in 5 stages, which are described in the following. 1. In healthy carriers, EBV mainly stays in memory B cells which are in a resting stage where no viral proteins are expressed (Hochberg et al., 2004). This gene expression pattern is called latency (resting) program. 2. In dividing memory B cells, only EBNA1 protein is expressed. This gene expression pattern is called latency (dividing) program. 3. B cells that express all EBV latent genes are found only in the lymph nodes and this gene expression pattern is known as the growth program (Joseph et al., 2000). This is equivalent to the latency program of infected B-lymphocyte in vitro. - 17 - Introduction 4. EBV infected B cells in the germinal center may express EBNA1, LMP1 and LMP2A protein and this is called default program (MacLennan et al., 1988). 5. EBV lytic infection which can be found in some plasma cells in the Waldeyer’s ring is known as lytic program. Different programs may have different function in the process of establishment of EBV life-long infection in humans (Thorley & Gross, 2004). These possible functions are discussed in next part. The different transcription programs of EBV in vivo and its possible functions are summarized in Table 1. Table 1. Transcription programs used by EBV to establish long life infection Type of infected B cells Naive cell Program name Growth Genes expressed Possible functions EBNA1, EBNA2, EBNA3, LMP1 and LMP2 EBNA1, LMP1 and LMP2A Activates B cells Germinal-center cell Default Peripheral blood memory cell Dividing peripheral blood memory cell Plasma cell Latency (resting) Latency (dividing) None Lytic All lytic genes EBNA1 Differentiates activated B cells into memory cell Allows lifetime persistence Allows viral DNA in latency program cell to divide Replicates virus in plasma cell 1.1.5.3 EBV lifecycle in vivo During initial infection, EBV infects the naive B cells in or below the mucosal epithelium, expressing viral genes in what we previously known as the growth program. Similar to in vitro experiments, the infected cells are transformed into proliferating B - 18 - Introduction lymphoblasts. However, the EBV infected B lymphoblasts cannot exist in vivo for long periods of time due to the strong cytotoxic T cell (CTL) response against EBV infected B lymphoblasts which arises soon after primary infection in normal people (Khanna et al., 1995; Joseph et al., 2000). In order to have long term persistence in the human host, EBV chooses resting memory B-cells as its host cell in vivo. One hypothesis about how EBV gets into memory B-cell is that EBV may cause infected B lymphoblasts to differentiate into resting memory B-cells in the germinal center soon after infection. This pathway mimics the way that antigen-activated B cell blast differentiates into a long living memory B cell after primary infection. In the germinal center, the EBV infected B-cell transiently expresses EBV latent genes EBNA1, LMP1 and LMP2A during division (default program). As discussed before, LMP2A could replace B cell receptor (BCR) function in B cell development to send rescue signals to infected cells, resulting in immunoglobulin-negative cells to colonize peripheral lymphoid organs (Caldwell et al., 1998). LMP 1 can promote B-cell survival and growth through the c-Jun N-terminal kinase (JNK) signal cascade. It is suggested that LMP1 mimic the B-cell activation processes which are physiologically triggered by CD40-CD40 ligand signals to sustain B-cell proliferation (Kilger et al., 1998). In summary, with expression of the default program, EBV may cause a B blast cell to differentiate into a memory B cell and get into the lymph circulation. By staying in resting memory B cells at frequency of 1 in 1×105 to 1×106 cells, EBV can exist in host for long time without eliminated by immune system (Wagner et - 19 - Introduction al., 1992). In memory B cells, no viral protein is expressed (latency program). Only when the infected memory B cells divide, EBV EBNA1 is expressed to allow viral DNA to replicate (Hochberg et al., 2004). Some infected memory B cells can get back to the lymphoepithelial tissue of oropharynx and be reactivated into the lytic cycle to produce viral progeny. Recent studies have shown that the infected B cells express all lytic genes (lytic program) to produce infectious virus when memory B cells differentiate into plasma cells in Waldeyer’s ring (Thorley & Gross, 2004). The released virions can not only get into saliva to infect other people, but also can infect B lymphocytes in the host. Until now, we know little about the signals that disrupt the viral latency state and initiate the lytic cycle in vivo. Some studies have shown that the signal for B-cell terminal differentiation may possibly be the signal for EBV reactivation (Crawford et al., 1986; Mellinghoff et al., 1991). The EBV life cycle are shown in Fig. 2. - 20 - Introduction Saliva Activated blast Default program Tonsil Infection Periphery Memory cell Latency program Differentiation Cell division Growth program Virus Lytic program Plasma cell EBNA 1 express Differentiation Replication Fig. 2 EBV life cycle in vivo. Diagram describing the EBV life cycle and different transcription programs used by EBV in different stage of its life (Thorley & Gross, 2004). 1.1.6 EBV associated malignancies EBV has been implicated in the development of a wide range of malignancies, including Burkitt’s lymphoma, Hodgkin’s disease, non-Hodgkin’s lymphoma, nasopharyngeal carcinoma, lymphoproliferative disorders gastric cancer, (PTLDs), breast cancer, AIDS-associated posttransplant lymphomas and leiomyosarcomas in immunosuppressed individuals (Thompson et al., 2004). Based on different latent gene expression in different diseases, EBV latent infection has been classified into 3 types. Gene expression patterns in different latency types are listed in Table 2 (Kieff & Rickinson, 2001). Latency type I, II and III correspond to latency (dividing), default and growth programs in regular infection in vivo. - 21 - Introduction Latency type EBNA1 I + EBNA-2,LP,3A-C LMP1, LMP2 EBERs + BARTs Example + BL II + Ш + + + + + + + HD, NPC + ARLs Table 2. Gene expression in different types of EBV latent infection BL: Burkitt’s lymphoma; HD: Hodgkin’s disease; NPC: Nasopharyngeal carcinoma; ARLs: AIDS-related lymphomas. 1.1.6.1 Burkitt’s Lymphoma (BL) BL is a B-cell lymphoma that was originally described in equatorial Africa where it accounts for approximately half of all childhood cancers (Burkitt et al., 1961). BL can be separated into two types: endemic and nonendemic BL. Endemic BL occurs primarily in equatorial Africa and New Guinea, and EBV is present in approximately 95% of cases (Magrath et al., 1992). Nonendemic BL is found in the Europe and the USA. Only 15%-30% of nonendemic BL cases are associated with EBV in the USA (Subar et al., 1988). In vitro experiments, Akata BL cell line subcultures that lost EBV cannot induce tumours in mice and lose malignant phenotypes, and reinfection of Akata cells with EBV can restore the malignant phenotypes (Shimizu et al., 1994; Komano et al., 1998). These data supports the association between EBV and BL. In endemic BL biopsy, expression of EBV latent genes can be detected, and the expression pattern belongs to latency type I, only EBNA1, BARTs and EBER are expressed (Rowe et al., 1986). - 22 - Introduction 1.1.6.2 Hodgkin’s Disease (HD) Hodgkin’s Disease is characterized by mononuclear Hodgkin cells and their multinucleated variant the Reed-Sternberg cells, together abbreviated as H-RS cells. These cells are now postulated to be of B-cell lineage (Lukes et al., 1966; Marafioti et al., 1997). Several evidences support the linkage between EBV and HD. First, the individuals with a history of infectious mononucleosis (IM) have 4 fold increased risk of developing HD (Munoz et al., 1978.) Second, a retrospective analysis of serum sample showed increased antibody titers to EBV viral capsid antigen in HD patients (Mueller et al., 1989). Finally, the key finding is detection of EBV genomes and gene products in H-RS cells (Herbst et al., 1993). EBV latent genes EBNA-1, LMP1, LMP-2A, 2B, BARTs and EBERs are expressed in H-RS cells. This gene expression pattern belongs to latency type II. (Pallesen et al., 1991). 1.1.6.3 Non-Hodgkin’s Lymphoma in Immunocompetent Individuals Except infecting B-cells, EBV can infect other cells and cause diseases. Several types of non-B-cells, non-Hodgkin’s lymphoma are associated with EBV, such as nasal T/ natural killer cell lymphoma and angioimmunoblastic lymphadenopathy (Jones et al., 1988; Weiss et al., 1992). Nasal T/ natural killer non-Hodgkin’s lymphoma is a specific extranodal T-cell lymphoma which occurs in the nasal cavity. The consistent association between EBV with this lymphoma was first found in Japanese, and confirmed in Chinese and Caucasian patients. Based on previous study, expression of EBV latent genes in this lymphoma belongs to latency type II (Minarovits et al., 1994). - 23 - Introduction 1.1.6.4 NPC NPC is an epithelial carcinoma of nasopharynx. It is closely associated with the EBV infection. The association between EBV and NPC will be discussed in detail later. 1.1.6.5 Posttransplant lymphoproliferative disorders (PTLDs) PTLDs refer to a collection of clinically and pathologically diverse tumours, predominantly of B-lymphocyte origin, associated with therapeutic immunosuppression after organ transplantation. PTLDs arise in up to 10% of all transplant recipients and nearly all forms of disorders are associated with EBV (Nalesnik, 2002; Penn, 1994). In healthy individuals, EBV can establish lifelong asymptomatic latency in B-lymphocytes that is effectively controlled by EBV-specific cytotoxic T-lymphocytes (CTLs). Immunocompromised transplant recipients exhibit a profound deficit in cell-mediated immunity that leads to the disruption of the balance between EBV infection and EBV-specific CTLs. This change can cause uncontrolled EBV-driven B cell proliferation, and results in tumour formation and the onset of PTLDs (Knowles, 1998). By using RT-PCR and western blot method, a latency type Ⅲ-like EBV gene expression pattern can be found in early PTLDs (Young et al., 1989). 1.1.6.6 AIDS-related lymphomas (ARLs) ARLs are a heterogeneous group of diseases which arise in the HIV-associated immunosuppression patients. These lymphomas are mostly B-cell origin and contain the patients’ intrinsic EBV (Knowles, 1999). Both type I and type II EBV strains are - 24 - Introduction detectable. This shows two types EBV can co-infect the host (Boyle et al., 1991). According to the EBV association and EBV gene expression patterns, ARLs can be separated into 2 types. One type is diffuse large B-cell lymphoma. This type is closely associated with EBV, and EBV gene expression pattern belongs to latency type III. Another type is AIDS-related BL. Only 30-40% cases of this type lymphoma are associated EBV, and only rare cases show LMP1 expression (Knowles, 1999). - 25 - Introduction 1.2 NASOPHARYNGEAL CARCINOMA (NPC) Nasopharyngeal carcinoma (NPC) is a malignancy of the stratified squamous epithelium of nasopharynx. NPC is rare in most countries, but it has a high incidence South-East Asia. NPC is distinguished from other cancers of the head and neck by its histopathology, epidemiology, clinical characteristic and treatment (Muir et al., 1992). 1.2.1 Histological classification Based on the classification of World Health Organization (WHO), NPC is classified into 3 histological types: • Type I: keratinising squamous cell carcinoma (SCC) • Type II: non-keratinising carcinoma • Type III: the undifferentiated carcinoma. Type III is the most common NPC type in people. According to some report, type II and III can be considered as undifferentiated carcinoma of the nasopharyngeal type (UCNT). Generally UCNT have a higher local control rate than SCC after treatment of radiotherapy (Reddy et al., 1995; Marks et al., 1998). 1.2.2 Anatomy Nasopharynx can be defined as that portion of the pharynx which lies behind the nasal fossae and extends inferiorly as far as the level of the soft plate. Nasopharyngeal carcinoma usually originates in the fossa of Rosenmuller (lateral nasopharyngeal recess). It can then extend within or out of the nasopharynx to the other lateral wall - 26 - Introduction and/or posterosuperiorally to the base of the skull or the palate, nasal cavity or oropharynx. Many of the skull base foramens that carry important neural and vascular structures are located immediately adjacent to the nasopharynx. The nasopharynx is lined by mucosa that is covered with pseudostratified columnar epithelium and stratified squamous epithelium, and the mucosa is frequently infiltrated by lymphoid tissue. It is from this epithelium that nasopharyngeal carcinoma arises (Alan et al., 1999). 1.2.3 Epidemiology Nasopharyngeal carcinoma incidence rate is less than 1 per 100,000 in most countries. But in southern china, especially in Cantonese region around Guangdong and Hong Kong, the NPC incidence rate is much higher. It is about 30-80 /100,000 people per year (Muir et al., 1992). NPC can occur in any age. In Asia the peak incidence is in the people aged between 50-60. Men are twice as likely to develop nasopharyngeal carcinoma as women (Spano et al., 2003). 1.2.4 Clinical symptoms The early symptoms of NPC patients are minimal, and always ignored by patients and doctors. Until the carcinoma reach relatively advanced stage, the symptoms become clearly. The most common presenting symptom is cervical lymphadenopathy, followed by nasal and aural symptoms. Neurological complaints are less common and always - 27 - Introduction happen late. Only small part of patients presents distant metastases (Skinner et al., 1991). 1.2.5 Etiology NPC often occurs in specific race and area. This suggests that genetic and environmental factors may contribute to the oncogenesis of NPC. Until now, many studies reveal that genetic factor, EBV and environmental factor are associated with NPC. 1.2.5.1 Genetic factor Cytogenetic studies had been done to investigate the chromosomal aberrations in the NPC cancer cells. Chromosome abnormalities of 1, 3p, 3q, 5q, 9p, 11q, 12, 13q, 14q, X and breakpoints in 1p11-31, 3p12-21, 3q25, 5q31, 11q13, 12q13, X 25 were observed. The deletion of short arm of chromosome 3 is the most common karyotypic defect in NPC (Lo et al., 1997). Through comparative hybridization (CGH) analysis, chromosomal gains and losses in primary NPC were checked. Chromosomal gain in 1q, 3q, 8, 12, 19 and loss in 1p, 3p, 9p, 9q, 11q, 13q, 14q, 16q were found. The most frequent chromosomal regions showing gain and loss are 12 and 3p respectively (Hui et al., 1999). 1.2.5.1.1 Inactivation of tumour suppressor genes Studies on these abnormal chromosomes suggest that inactivation of some - 28 - Introduction tumour suppressor genes and alteration of some oncogenes may play an important role in development of NPC. RASSF1A at chromosome 3p21.3, fragile histidine triad protein (FHIT) gene at chromosome 3p14.2, p16/INK4A at chromosome 9p, tumour suppressor in lung cancer 1 (TSLC1) at 11q23 and endothelin receptor β (EDNRB) at chromosome 13q22 are proposed to be the tumour suppressor genes involved. Their expression was down-regulated in NPC, especially p16. Lack of p16 protein is very common in NPC primary tumours (Chow et al., 2004; Deng et al., 2001; Lo et al., 1995; Hui et al.. 2003; Gulley et al., 1998; Lo et al., 2002). One possible way to inactive tumour suppressor genes is to hypermethylate the promoters of these genes. Studies showing that widespread aberrant methylation exist in NPC cells. Compared with some EBV negative neck and head cancers, the frequency of aberrant methylation is much higher in EBV associated NPC, which suggests the unusually close relationship of aberrant methylation and EBV infection (Kwong et al., 2002). One scenario is that some EBV genes may cause methylation of some promoters of cellular genes, including the promoters of tumour suppressor genes, and results in down-regulation of the expression of these tumour suppressor genes. 1.2.5.1.2 Oncogene activation Until now, our knowledge about oncogene alterations in NPC is still lacking. Some researches show that oncogenes bcl2, cyclin D1, c-myc, ras, PIK3CA and p63 are activated in primary tumours and may involve in the development of NPC (Lu et al., 1993; Lai et al., 2002; Porter et al., 1994; Hui et al., 2002; Crook et al., 2000). Aberrant - 29 - Introduction activation of these oncogens may be caused by some cellular or viral genes. 1.2.5.1.3 HLA association The human leukocyte antigen (HLA) was first demonstrated to be associated with NPC in Singapore Chinese. HLA-A2, B46 (originally termed BSin2) and A33, B58 haplotype were found to be associated with high risk of NPC. On the contrary, people with HLA A11 and B13 seem not likely to develop NPC. One hypothesis about the role of HLA in NPC is that some particular HLA antigen cannot cause effective host immune response to EBV infection, and make the EBV persist in nasopharyngeal epithelial cells (Chan et al., 1981). Further studies suggest that a gene closely linked to the HLA loci on short arm of chromosome 6 may confer greatly increased risk of NPC (Lu et al., 1990). Subsequent research showed that microsatellite locus D6S211 (allele 4) close to HLA-A region on chromosome 6 was associate with increased risk of NPC (Lu et al., 2003). 1.2.5.2 Environmental factor Epidemiological data of NPC patients suggest that some environmental factors may contribute to the development of this carcinoma. Cantonese-style salted fish was suspected to be an important etiological factor for NPC. Case-control studies reveal the positive relationship between salted fish and NPC, and show higher risk of NPC is associated with earlier age exposed to salted fish (Yu et al., 1986; Ning et al., 1990). Animal model experiments strength the hypothesis. Rats fed with Chinese salted fish - 30 - Introduction can develop malignant nasal cavity tumours (Yu et al., 1989). Some preserved foods are also considered as nasopharyngeal carcinogens. These foods include salted and pickled leafy/stem vegetables and roots, salted and fermented eggs, fermented beans and bean pastes, and various seafood pastes. Carcinogenic nitrosamines / precursors and genotoxic and EBV-activating substances were detected in these foods (Yu et al., 1988; Poirier et al., 1989; Shao et al., 1988). Studies on low-risk population (white and black residents in the United States) show the increased risk of NPC is significantly associated with intake of the preserved food (Farrow et al., 1998). Further research on cytochrome P450 2E1 (CYP2E1), an enzyme that can catalyzes the metabolic process of nitrosamines, show different CYP2E1 genotypes exhibit different risk of development of NPC. c2 / c2 genotype experienced 2.6-fold risk of NPC compared to the wild-type allele. This research strengthens the hypothesis that nitrosamine-containing preserved food is one of the causative agents for NPC (Hildesheim et al., 1997). Other possible environmental factors associated with NPC include some Chinese herbs, formaldehyde, tobacco and fewer intakes of fresh fruit and vegetables (Zeng et al., 1994; Blair et al., 1990; Yu et al., 1988). 1.2.5.3 EBV infection: EBV was first suspected to be associated with NPC based on the observation that the sera from NPC patients contain antibodies against EBV-infected Burkitt’s - 31 - Introduction lymphoma cells (Old et al., 1966). By in-situ hybridization, researchers proved that the EBV DNA exists in the nuclei of epithelial cells of NPC patients, and the full length EBV genome is contained in all malignant epithelial cells but not in most infiltrating lymphocytes (zur Hausen et al., 1970). EBV-encoded small nuclear RNAs (EBERS) is usually present in high copy numbers in the malignant epithelial cells. It suggests viral transcription exist in those cells (Wu et al., 1991). Conversely, EBV is always negative in untransformed squamous epithelia from the nasopharyngeal mucosa (Lin et al., 1997). In addition, elevated titers of IgG and IgA against EBV viral antigens exist in NPC patients, especially high titers of IgA antibodies against EBV EA and VCA complex (Henle et al., 1970). All these data support the association between EBV and NPC. Serological studies show that the association between EBV and NPC type Ⅲ and type Ⅱare constant regardless of the patient’s geographical origin (Krueger et al., 1981), but the association between EBV and NPC typeⅠ is still controversial. 1.2.5.3.1 EBV latent gene expression in NPC By studying NPC specimens, transcription of EBV EBNA-1, LMP-1, LMP-2, EBERs and BARTs are identified (Wu et al., 1991; Brooks et al., 1992; Sadler et al., 1995). This gene expression pattern is characteristic of many EBV-associated tumours and is termed EBV latency type Ⅱ. At protein level, EBNA1 has been identified in most NPC biopsies, and LMP1 has been detected in about 50% of tumours (Young et al., 1988). LMP 2 protein has not been detected in NPC samples, but serological analyses revealed that NPC patients have elevated titers antibody against this protein. It suggests - 32 - Introduction this protein may be expressed in NPC tumour (Frech et al., 1993). EBNA1 are stably expressed in all latently EBV-infected cells. Some data shows that expression of EBNA1 in an EBV-negative NPC cell line, which was then inoculated into both nude and severe combined immunodeficiency mice, can increase the tumourigenicity and metastatic capability of the cells. These data suggest that EBNA 1 may contribute to the development of NPC (Sheu et al., 1996). Unlike EBNA1, LMP1 is not consistently expressed in NPC biopsies. Though just about 50% NPC biopsies can detect LMP1 expression, serological study showed high titers of anti-LMP1 antibodies existed in more than 70% NPC patients, and high levels of serum anti-LMP1 correlated with more advanced stage of this carcinoma (Xu et al., 2000). Interestingly, by studying the preinvasive nasopharyngeal lesion related to NPC, including dysplasia and carcinoma in situ, LMP1 was found to be expressed in most cases. It suggests LMP1 may play a pathogenic role in the early stages of NPC development (Pathmanathan et al., 1995). As described in section 1.1.4.1.1, LMP1 has a profound effect on the EBV-infected cells. It is critical for the immortalization of primary B lymphocytes, and can induce proliferation in normal epithelial cells in vivo. It can make the transgenic mice highly sensitive to chemical carcinogens and develop significantly more small papillomas at a faster rate (Kaye et al., 1993; Curran et al., 2001). Taken together, LMP1 may contribute to the development of NPC at early stage. Until now, the exactly function of LMP1 in tumourigenesis of NPC is far from clear. Although LMP2 expression in NPC biopsies still needs to be confirmed, high titers of antibodies to LMP2 in most NPC patients suggests this protein may be - 33 - Introduction expressed during some stages of NPC. Available data about the function of LMP2 in NPC is limited. It seems that LMP2 has a different function in epithelial cells from that in lymphocytes. It may be involved in cell adhesion-initiated signaling pathways in epithelial cells (Scholle et al., 1999). 1.2.5.3.2 Lytic genes expression in NPC Until now most research about the function of EBV in NPC is focused on the EBV latent genes; information about the possible involvement of lytic genes in NPC is limited. Though no viral particles are detected in tumour tissue in situ, more and more data suggest that some lytic genes are expressed in NPC biopsies. The transcript of BRLF1, an important transcription activator, is detected in NPC biopsies. The IgG antibodies directed against BRLF1 were also detected in about 80% NPC plasma samples, but seldom in health carriers. This result indicates that the EBV immediate early lytic gene BRLF1 may be expressed in NPC (Feng et al., 2000). Previous study show BRLF1 can disrupt the viral latency in epithelial cells by itself through an epithelial specific mechanism (Zalani et al., 1996). Therefore, if BRLF1 is expressed in NPC tumour cells, it is possible that some other EBV lytic genes may be expressed in NPC. As for BZLF1, another important transcription activator, anti-BZLF1 antibodies were present in sera of most NPC patients, and transcripts of BZLF1were also found in some NPC tumour biopsies (Cochet et al., 1993). The importance of BZLF1 expression in NPC is under debate. Early EBV gene BARF1 has been shown to be transcribed and translated in more - 34 - Introduction than 80% NPC biopsies, and antibodies against BARF1 were found in sera of NPC patients. Together with BARF1 has the ability to transform primary monkey epithelial cells. It seems likely BARF1 protein is expressed in NPC and may play a role in NPC development (Tanner et al., 1997; Wei et al., 1997). EBV lytic gene BGLF5 encodes EBV DNase. This protein was found to be expressed in both fresh biopsies and transplanted tumour lines (Sbih et al., 1996), and NPC patients frequently have increased serum level of antibodies directly against EBV-DNase (Chen et al., 1985). These foundlings suggest EBV lytic gene BGLF5 may be expressed in NPC. Other proteins encoded by EBV lytic genes, including early antigen diffuse components (EA-D) and restricted components (EA-R), probably are expressed in NPC biopsies, but studies on these proteins yield conflicting results (Luka et al., 1988). In summary, the limited available data about EBV lytic gene expression in NPC biopsies raise the possibility that some lytic genes may be expressed in NPC and may contribute to the development of NPC. 1.2.6 Diagnosis of NPC Clinical symptoms, radiological, serological and pathological data could be used to diagnose NPC. Here we just concentrate on the serological diagnosis. 1.2.6.1 Serological diagnosis NPC patients are very sensitive to radiotherapy at early stage, and have high 5 - 35 - Introduction year survival rate which is about 70-80%, but in the patients with advanced stage the 5 year survival rate drops to 20%-40%. Therefore diagnosing NPC at early stage is important for improving treatment (Vokes et al., 1997). The presence of EBV in epithelial and in B lymphocyte cells in NPC patients causes a humoral immune response to EBV antigens, including producing antibodies against some EBV antigens. Therefore, testing antibodies against EBV antigens become a useful and worldwide method for early diagnosing NPC (Zong et al., 1992). The typical anti-EBV serological profile of NPC patients consists of an increase in both IgG and IgA antibodies against the Viral Capsid Antigen (VCA) and Early antigen (EA). Other antibodies that have the potential to be used for diagnosis include anti-EBNA, anti-DNase, anti-TK, anti-DNA polymerase, anti-BRLF1 and anti-BZLF1 (Littler et al., 1991; Liu et al., 1997; Joab et al., 1991). 1.2.6.1.1 EBV EA and VCA antibodies Compared with other head and neck neoplasms, NPC patients have high IgG and IgA antibodies against EBV EA, VCA and MA complex (Henle et al., 1970). Among these antibodies, EBV specific IgA-EA and IgA-VCA are the most valuable diagnostic markers for NPC (Mazeron et al., 1996). The clinical use of these antibodies as markers for detecting NPC in high risk groups was confirmed by large population trials. Immunofluorescence assay (IFA) is now used to detect IgA-EA and IgA-VCA as a useful and worldwide method to diagnose NPC, and it is also used to anticipate recurrences after therapy (Zeng et al., 1985; de-Vathaire et al., 1988). - 36 - Introduction 1.2.6.1.2 Other EBV antibodies in NPC patients The current standard method to diagnose NPC by IFA has been proven to be useful, but this method is not convenient to be used. It requires a certain amount of expertise, is labour-intensive, subjective and semi-quantitative. Using enzyme linked immunosorbent assay (ELISA) to detect the EBV specific antibodies becomes a new method to diagnose NPC (Chan et al., 2003). By ELISA test, anti-BZLF1 IgG was reported to be detected in most NPC patients and seldom in health carriers, but some other reports show that this antibody also appeared in other EBV-associated diseases such as IM, HD and BL (Mathew et al., 1994; Drouet et al., 1999). So the value of anti-BZLF1 antibody in diagnosis of NPC needs to further study. BMRF1 encodes EBV DNA polymerase accessory protein which forms part of EA-D component. IgA antibodies against BMRF1was found specifically in saliva and serum samples of NPC patients (Nadala et al., 1996). BXLF1 encodes EBV thymidine kinase (TK) which is a component of EA-R complex. IgG and IgA antibodies against TK was found in most sera of NPC patients, and interestingly IgA antibody seems specific appeared in NPC patients (Littler et al., 1990). BALF5 encodes EBV DNA polymerase which is also a component of EA complex. By Western blot analysis, moderate to high concentration of IgG specific antibodies against this protein were detected in most NPC sera and only in a small proportion of healthy EBV carriers (Lin et al., 1995). Together with the antibodies against BRLF1 and BGLF5 in NPC patients as we discussed before, all these antibodies seems have the potential to become markers - 37 - Introduction for early diagnosis of NPC. Some experiments have been done to evaluate the clinical value of these proteins. It seems that anti-TK and anti-DNase has great potential to be used for early diagnosing NPC, but these results need further confirmation (Littler et al., 1991; Liu et al., 1997). 1.2.7 Treatment NPC is a relatively radiosensitive tumour and thus radiation therapy is the standard treatment for almost all NPC patients. For early stage NPC patients, the local control rates is about 70%-80% after radiotherapy, but for higher advanced stage patients the outcome is worse with 20–40% failure rates and a higher risk of distant metastases (Sham et al., 1990). Except radiotherapy, chemotherapy is also used to treat NPC, though it is not the main treatment. NPC type II and type III have been shown to be sensitive to chemotherapy, and in some cases NPC can be locally controlled by chemotherapy alone (Cvitkovic, 1997). In order to improve the treatment outcome, concurrent combinations of chemotherapy and radiotherapy have been studied. - 38 - Introduction 1.3 OBJECTIVES OF THIS STUDY As discussed in the previous sections, NPC is consistently associated with EBV infection, and EBV genes may have some important functions in the development of NPC. Many studies have been done to investigate the EBV latent genes expression and their involvement in NPC. In contrast to the extensively studied EBV latent genes, EBV lytic genes expression and their possible contribution to the development of NPC is poorly understood. More and more data suggest the expression of some EBV lytic genes in NPC. However, there has never been a comprehensive study of EBV gene expression in NPC. The aims of this study are: 1. To construct a reliable profiling system which can detect the RNA expression of all EBV genes. 2. To comprehensively study the EBV gene expression pattern in NPC biopsies by using the profiling system. - 39 - CHAPTER 2 MATERIALS & METHODS - 40 - Materials & Methods 2.1 SUBJECTS AND SAMPLES 10 NPC and 4 non-NPC nasopharyngeal tissue samples were included in this study. All the NPC patients were diagnosed as NPC based on histopathologic examination, and were recruited from Mount Elizabeth Medical Centre from 2002 to 2003. All biopsies are kept in RNAlaterTM Stabilization Reagent (QIAGEN) and stored at -20℃ until use. 2.2 CELL CULTURE TECHINIQUES 2.2.1 Maintenance of cell line EBV-positive cell lines B95-8, Raji, P3HR-1, C666-1 and EBV negative cell line BJAB were used in this study. B95-8, Raji and P3HR-1 are all lymphocyte cell lines. B95-8 and P3HR-1 cells are permissive for productive EBV replication with small number of cells spontaneously entering the lytic cycle, while Raji cells are not permissive for EBV replication. C666-1 cell line is a subclone of its parental cell line, C666, derived from an NPC xenograft of southern Chinese origin. This epithelial cell line consistently carries the EBV in long-term cultures. EBV genome negative Burkitt’s lymphoma cell line BJAB was used as a negative control in this study. All the cells were maintained in RPMI 1640 growth medium (Gibco BRL, Bethesda, MD) supplemented with 10% Fetal calf serum (FCS). The cells were kept in tissue culture flasks at 37℃ in a humidified CO2 (5%) incubator. Cells were fed every 3 days or split whenever they grew too dense. For suspension cell lines (B95-8, Raji, P3HR-1 and BJAB), about 3/4 volume of old medium was removed and replaced with - 41 - Materials & Methods the same volume of warmed, fresh growth medium. For adherent cell line C666-1, cells were treated with about 1/10 volume of trypsin after removal of old medium, and mixed with fresh growth medium to inactivate the trypsin. About 1/3 volume of the mixture was then transferred into a new flask containing warmed, fresh growth medium. 2.2.2 Induction of EBV lytic cycle in cell lines B95-8, Raji, C666-1 and P3HR-1 cells were grown to the logarithmic phase. After cell counting and viability checking, the suspension cells (B95-8, Raji and P3HR-1) were resuspended to a density of 0.3×106 cells/ml with equal volume of fresh and original medium. Then, the phorbol ester 12-O-tetradecanoylphorbol-13-acetate (TPA) and n-butyrate (Sigma) were added to final concentration of 20ng/ml and 3mM respectively. For adherent cell line (C666-1), when the cell confluence was about 60%, the medium was renewed, and TPA and n-butyrate were added to the final concentration of 20ng/ml and 3mM, respectively. The cell culture was gently swirled to mix the chemicals, and cultured at 37℃ in a humidified CO2 (5%) incubator for 3 days without feeding until harvested. 2.3 MOLECULAR TECHNIQUES 2.3.1 Primers To detect the RNA expression of EBV genes, we synthesized the primers for all EBV genes. Based on EBV DNA sequence of B95-8 strain (database accession number NC_001345), we designed the primers by using Vector NTI Suite 7 program. For the - 42 - Materials & Methods genes which are deleted in B95-8 EBV strain, we designed the primers based on the EBV DNA sequence of Raji strain (database accession number M35547). The primer designs were based on the following criteria: 1. The Tm of every primer was in the range of 60-62℃. 2. The primers did not form stable secondary structure, homo or hetero dimers. 3. The amplicon size was in the range of 300-800bp. 4. The amplicon location was within 1kb upstream of poly-adenylation signal except for the amplicons that encompass splice signals, because in oligo-dT-primed reverse transcription, the sequence too far upstream of poly-adenylation signal is not efficiently reverse transcribed. 5. Protein-coding sequences were preferred, because sequence variations among different EBV strains are less in protein-coding regions than in non-coding regions. 6. For spliced genes, additional primers were designed to amplify the sequences across the introns. The sequences of primers are listed in Appendix 1, and all primers were synthesized by Research Instruments Singapore Pte Ltd. 2.3.2 Total RNA/DNA extraction Total RNA and DNA were extracted simultaneously from cell lines and frozen biopsies using RNA/DNA isolation kit (QIAGEN). About 4×106 cells of every cell lines or 20mg of every tissue samples were used every time. The procedure described in the QIAGEN RNA/DNA Handbook was followed. To isolate nucleic acids from the - 43 - Materials & Methods preserved tissue, the tissue was first placed in liquid nitrogen, and grounded with a mortar and pestle. The tissue power was then solubilized in the lysis buffer supplied with the kit and homogenized by passing through a G26 needle. The purity and concentration of extracted RNA or DNA were determined by spectrophotometry using a GeneQuant RNA/DNA calculator (Biochrom Ltd.). The integrity of RNA or DNA was checked using agarose gel electrophoresis. 2.3.3 Removal of decontaminating DNA from RNA To eliminate the DNA contamination from RNA, all RNA samples were treated with RNase-free DNase I (QIAGEN). 5 Kunitz units of DNase I was used to treat 10μg of extracted RNA in the final volume of 20μl reaction mixture containing 1×reaction buffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 1mM dithiothreitol; PH 7.9). The mixture was incubated at 37℃ for 30 min, and then was heated at 72℃ for 5 min to inactivate the DNase I. The effect of DNase I treatment was checked by PCR. 2.3.4 Reverse Transcription cDNA was synthesized from RNA by using Omniscript Reverse Transcriptase Kit (QIAGEN) according to the manufacturer’s instruction. Briefly, the 1st strand cDNA was synthesized in total volume of 100μl reaction mixture containing 1×reaction buffer (proprietary), 0.5mM of each dNTP, 1μM oligo-dT15 primer, 50 units RNase inhibitor, 20units Omniscript Reverse Transcriptase and 10μg template RNA. The reaction was performed by incubating at 37℃ for 60 min, and followed by heating to 93℃ for 5 min - 44 - Materials & Methods to stop the reaction. At last, the reaction mixture was chilled on ice and stored in -20℃ until use. 2.3.5 PCR PCR reaction was performed by using HotStarTaq Polymerase (QIAGEN), according to the HotStarTaq PCR handbook. 1μl of synthesized cDNA was added into a final volume of 30μl PCR reaction mixture containing 1×PCR buffer (Tris-Cl, KCl, (NH4)2SO4, 15mM MgCl2; PH 8.7), 200μM of each dNTP, 0.2μM of each primer and 0.75 units HotStarTaq DNA polymerase. After heating to 95℃ for 15min to activate the polymerase, the amplification was carried out for 35 cycles with each consisting of 94℃ for 45 sec, 60℃ for 45 sec, and 72 ℃ for 2 min. At last, the mixture was heated to 72 ℃ for 10 min and then cooled to 4℃. When DNA was used as template to do PCR, 20ng of total DNA from EBV cell lines or NPC biopsies or 100ng of DNA from non-NPC tissues was added into each reaction. When RNA was used as the template for a negative control, 0.1μg RNA was added into each reaction. 2.3.6 One-Step RT-PCR One-Step RT-PCR was done using the QIAGEN OneStep RT-PCR kit, according to the manufacturer’s instruction. 2μg DNase I treated RNA was added to the total volume of 50μl reaction mixture containing 1×QIAGEN OneStep RT-PCR buffer (Tris-Cl, KCl, (NH4)2SO4, 12.5mM MgCl2, DTT; PH 8.7 ), 400μM of each dNTP, 0.6 μM of each of the gene-specific forward and reverse primers, 2.0μl QIAGEN OneStep - 45 - Materials & Methods RT-PCR enzyme Mix and 10 units of RNase inhibitor. First the mixture was incubated at 50℃ for 30 min to synthesis the 1st strand cDNA, and followed by heating to 95℃ for 15 min to inactivate the reverse transcriptase. Second, the amplification was carried out for 35 cycles with each consisting of 94℃ for 45 sec, 60℃ for 45 sec, and 72 ℃ for 2 min. Finally, the mixture was heated to 72 ℃ for 10 min and followed by cooling to 4℃. To test the direction of transcript, forward or reverse primer was omitted from the reaction mixture in the initial reverse transcription step (the step for incubation at 50℃ for 30 min). After heating of the reaction mixture at 95℃ for 15 min to inactivate the reverse transcriptases, the omitted primer was added back into the mixture, and the amplication was carried out using at the same conditions as described above. - 46 - CHAPTER 3 RESULTS & DISCUSSIONS - 47 - Results & Discussions 3.1 PART 1: TESTING OF PRIMERS In order to find what EBV genes are expressed in NPC biopsies, we constructed a profiling system. This system is based on RT-PCR techniques to detect the EBV RNA expression in NPC biopsies. We designed primers for every EBV gene and used DNA and RNA from different EBV-infected cell lines to test the primers. 3.1.1 Testing of primers To test the amplification efficiency and specificity of the designed primers, we extracted DNAs from different cell lines and used them in PCRs. We chose four EBV-positive cell lines, including B95-8, C666-1, Raji, P3HR-1, and one EBV-negative lymphocyte cell line BJAB as a negative control for EBV gene amplification. Parts of the testing results are shown in Fig. 3. As shown on Fig. 3, PCR products of expected sizes were amplified from most EBV cell lines. Neither EBV negative nor positive cell lines showed non-specific PCR products. This showed that most primers amplified EBV specific sequences from different EBV strains and non-specific amplification of cell genes was absent. For the primers that were unable to amplify EBV genes from all tested EBV strains, we redesigned new ones until we found the primers that served the purpose. For example, the primers for BBLF2 did not amplify the EBV DNA from Raji cells (as shown in Fig.3, BBLF2 lane 3). Therefore they were redesigned until they amplified EBV specific sequences from four EBV strains successfully (data not shown). - 48 - Results & Discussions BBRF1 BBRF2 M 1 2 3 4 5 1 2 3 4 5 1 BBLF3 2 3 4 5 1 BBLF2 2 3 4 BBRF3 5 1 2 3 4 BGLF5 5 1 2 3 4 5 700bp 500bp 300bp BGLF4 M 1 2 3 4 BGLF3 5 1 2 BGLF2 BGLF1 3 4 5 1 2 3 4 5 1 2 3 BDRF1 4 5 1 2 3 4 5 1 BDLF4 2 3 4 700bp 500bp 300bp Fig. 3 Testing of EBV-gene specific primers (partial results). PCRs were performed using the primers specific for EBV genes shown on the top of each panel, and the whole cell DNA of B95-8, Raji, P3HR-1, C666-1 and BJAB cells (lanes marked from 1 to 5 respectively) as the template. The products were electrophoresced on 1% agarose gel. Lane marked M contain 100bp DNA marker with sizes indicated on the left. Predicted sizes of PCR products of the twelve EBV genes: BBRF1: 583bp; BBRF2:649bp; BBLF3:480bp; BBLF2:671bp; BBRF3:661bp; BGLF5:657bp; BGLF4:663bp; BGLF3:581bp; BGLF2:628bp; BGLF1: 716bp; BDRF1:635bp; BDLF4: 447bp. Because the EBV DNA variations exist in different EBV strains (Bornkamm et al., 1980), DNAs from four different EBV cell lines were used to test the primers in this study, and an EBV genome negative Burkitt’s lymphoma cell line (BJAB) was used as a negative control. Based on the testing results, we can make a conclusion that our primers can work well to detect EBV genes from different EBV strains. - 49 - 5 Results & Discussions 3.1.2 Total RNA extraction, DNase I treatment and Reverse Transcription By using QIAGEN RNA/DNA isolation kit, total RNA and DNA was isolated from about 4 x 106 B95-8, C-666, Raji and P3HR-1 cells with/ without TPA induction. The products were analyzed using agarose gel electrophoresis. Typical results were shown in Fig. 4. The appearance of the RNA and DNA preparations suggested that the extracted RNA and DNA were intact. M RNA DNA 10,000bp 1,500bp 1,000bp 750bp Fig. 4 Analysis of RNA and DNA extracted from B95-8 cells without TPA induction. The RNA and DNA preparations which extracted form B95-8 cells were electrophoresced on 1% agarose gel. Lane marked M contain 1Kb DNA marker with sizes indicated on the left. The total RNA was treated with DNase I to eliminate the DNA contamination, and then about 10 μg of each DNase I treated RNA sample was used for cDNA synthesis in 100 μl reaction. To verify that the RNA was free of DNA contamination and that the cDNA synthesis was successful, we performed PCR-amplification of GAPDH gene sequence using the following samples as the template: (ⅰ) purified RNA without treated by DNase I, (ⅱ) DNase I treated RNA, and (ⅲ) cDNA synthesized from DNase I treated - 50 - Results & Discussions RNA. The results are shown in Fig. 5. GAPDH M 1 2 3 500bp 400bp 454bp Fig. 5 Analysis of cDNA quality. GAPDH amplifying PCR was performed using the following samples as template (1) B95-8 cell RNA without DNase I treatment. (2) B95-8 cell RNA with DNase I treatment. (3) cDNA synthesized from DNase I treated B95-8 cell RNA. Lane marked M contain 100bp DNA marker with sizes indicated on the left. The size of specific PCR product indicated on the right. Cellular gene GAPDH encodes Glyceraldehyde-3-phosphate dehydrogenase which is a glycolytic enzyme that catalyzes the conversion of glyceraldehyde-3-phosphate to 1, 3-diphosphoglycerate. This gene is constitutively expressed in almost all tissues at high levels, and its RNA is commonly used as an invariant control in studies of gene expression (Yajima et al., 1998). We chose this gene to test the effect of DNase I treatment, and the result of cDNA synthesis. As seen from Fig. 5, a PCR product was obtained from purified RNA (lane 1) indicating that the RNA was contaminated with cellular DNA. No PCR product was obtained from DNase I treated RNA (lane 2) indicating that the contaminating DNA in the RNA preparation - 51 - Results & Discussions had been reduced to an undetectable level through DNase I treatment. A strong PCR product was obtained from the cDNA synthesized from DNase I-treated RNA (lane 3). This showed that the cDNA synthesis was successful, and that the PCR product was derived entirely from cDNA but not from contaminating DNA in the RNA preparation. We regularly performed the same analysis for all samples derived from cell lines or nasopharyngeal tissues before subjecting the cDNA preparations to amplifications of EBV genes to make sure that the RT-PCR products obtained were indeed derived from RNA. 3.1.3 EBV RNA profiles of EBV cell lines 3.1.3.1 B-lymphocyte-derived cell lines In order to test whether our set of primers can be used to profile EBV RNAs, we used them to amplify cDNA prepared from different EBV-infected cell lines whose EBV RNA patterns had been documented. Generally, continuous cell lines established by EBV infection carry the virus genome in a latent state. Several agents have been identified that can disrupt latency in those cell lines. TPA is one of the agents (zur Hausen et al., 1978). EBV transformed marmoset lymphocyte cell line B95-8 can enter lytic cycle and produce infectious virus, but only a minority of cells can spontaneous enter lytic cycle (about 5%-10%). Treatment B95-8 with TPA can efficiently increase the number of virus-producing cells (Hudewentz et al., 1980). Human Burkitt’s lymphoma cell line P3HR-1 is also virus producing cell line. Like B95-8 cells, small proportion of cells (1-3%) can enter the - 52 - Results & Discussions lytic cycle spontaneously. Treatment with TPA considerably elevates the number of virus-producing cells (Kurakata et al., 1989). Unlike B95-8 and P3HR-1 cell lines, human Burkitt's lymphoma cell line Raji cannot produce virus even after TPA induction. The early stage of the viral cycle can be induced after treatment with TPA, but viral DNA synthesis is completely inhibited, consequently it is impossible for this cell line to produce viral particles. Some data show that EBV EA expression can be induced by TPA, but VCA cannot (Fresen et al., 1978). Absence of BALF2 gene expression may cause the inhibition of productive lytic cycle in Raji cell (Decaussin et al., 1995). The EBV gene expression patterns of B95-8, P3HR-1 and Raji cell lines without and with induction have been studied before (Hummel et al., 1982; Weigel et al., 1983; Anisimova et al., 1982). Therefore, cDNAs from uninduced and induced cells of these cell lines were used as the templates to test our EBV primers. The results are shown in Fig. 6 and the EBV RNA patterns of different cell lines were listed in Table 3. In order to achieve a semi-quantitative measurement of relative RNA level of most EBV genes, we used an amount of cDNA template for PCR such that the amounts of PCR products for these EBV genes were in positive relationship with the amount of input cDNA (Freeman et al., 1999). As such, we distinguished four relative RNA levels as shown in Table 3. - 53 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp GAPDH BHLF1 BHRF1(SJ) BNRF1 EBNA2 (SJ ) BCRF1 BCRF2 BFLF2 EBNA LP(SJ) BFLF1 EBNA2 BFRF1 Fig. 6 cDNA profiling results of different EBV cell clines. PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 54 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BFRF2 BaRF1 BFRF3 BMRF1 BPLF1 BMRF2 BOLF1 BMLF1 BORF1 BSLF2-BMLF1 BORF2 BSLF1 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 55 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BSRF1 EBNA3A BLLF3 EBNA3B(SJ) EBNA3B BLRF1 EBNA3C(SJ) BLRF2 EBNA3C BLLF2 BZLF2 BLLF1 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 56 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BKRF2 BZLF1(SJ) BKRF3 BRLF1 BRLF1-BZLF1(SJ) BKRF4 BBLF4 BRRF1 BBRF1 BRRF2 BBRF2 EBNA1 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 57 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BBLF3 BGLF4 BBLF2 BGLF3 BGRF1-BDRF1(SJ) BBLF2(SJ) BGLF2 BBRF3 BGLF1 BBLF1 BGLF5 BDLF4 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 58 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BDRF1 BTRF1 BDLF3 BXLF2 BDLF2 BXLF1 BDLF1 BXRF1 BcLF1 BVRF1 BcRF1 BVRF2 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 59 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BdRF1 BILF1 BILF2 BALF5 BILF1 ECRF4 RJLF3 BALF4 RJLF2 BART1 RJLF3 BART2 Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 60 - Results & Discussions 1,375bp 831bp 564bp 1,375bp 831bp 564bp BART3 LMP1 BALF3 LMP1(3’SJ) BALF2 LMP1(5’SJ) BALF1 LMP2A BARF1 LMP2B BNLF2 LMP2A&B(3’SJ) Fig. 6 cDNA profiling results of different EBV cell clines (continued). PCRs were performed by using the primers specific for EBV genes shown on the top of each panel, and the cDNAs from B95-8 cells without and with induction, C666-1cells without and with induction, Raji cells without and with induction, P3HR-1 cells without and with induction (lanes marked from a to h respectively) were used as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain Lambda DNA/EcoR I+Hind III Markers with sizes indicated on the left. Lanes marked with (SJ) indicated that the product across spliced region. - 61 - Results & Discussions Table 3. EBV gene expression pattern in different cell lines No. Gene name Gene PCR characteris product tic size(bp) Bu Bi Cu Ci Ru Ri Pu Pi +++ +++ +++ - +/- + 1 GAPDH cellular 454 +++ +++ +++ +++ +++ 2 BNRF1 late 712 + ++ - - - 3 BCRF1 late 510 + ++ - 4 BCRF2 unknown 551 - + - - 5 EBNA-LP(SJ) latent 103/187 +/- - - - 6 EBNA2 latent 706 ++ ++ - - 7 BHLF1 early 237 +++ +++ +++ 8 BHRF1(SJ) early 588/997 ++ +++ 9 EBNA2(SJ) latent 388/859 ++ 10 BFLF2 early 606 11 BFLF1 early 12 BFRF1 13 - - - - +/- ++ ++ - - - +/- +/- - - +++ ++ +++ - - - +/- - ++ - ++ +/- - - + +/- - - + +++ - +/- - ++ ++ ++ 667 +/- +/- - - - +/- +/- +/- early/late 696 +/- +/- - - - - +/- +/- BFRF2 early/late 666 - +/- - +/- - +/- +/- + 14 BFRF3 early/late 458 + +++ + ++ +/- ++ ++ +++ 15 BPLF1 unknown 394 ++ ++ +/- +/- - - +/- ++ 16 BOLF1 unknown 706 - - - - - - - - 17 BORF1 late 681 +/- + - +/- - +/- +/- + 18 BORF2 early 682 ++ +++ + +++ +/- ++ ++ +++ 19 BaRF1 early 668 +/- + +/- +/- - + + ++ 20 BMRF1 early 708 ++ +++ ++ +++ +/- ++ ++ +++ 21 BMRF2 late 547 +++ +++ +++ +++ +/- +++ ++ +++ 22 BMLF1 early 673 ++ +++ ++ +++ +/- +++ ++ +++ 23 BSLF2- early 413/517 +/- ++ +/- ++ - ++ + ++ + +/- + ++ ++ +/- - + +/- ++ +/- +/- ++ BMLF1(SJ) 24 BSLF1 early 544 + ++ +/- 25 BSRF1 late 657 +/- + - 26 BLLF3 early 729 +/- +/- - +/- - + - + 27 BLRF1 late 304 ++ +++ +/- + - + + +++ 28 BLRF2 late 411 ++ ++ + ++ - + + ++ 29 BLLF2 early 520 ++ ++ +/- +/- - +/- +/- ++ 30 BLLF1(SJ) late 364/983 ++ ++ - +/- - + +/- ++ 31 EBNA3A latent 621 +/- ++ - - +/- +/- - - 32 EBNA3B(SJ) latent 550/628 +/- ++ - - - +/- +/- ++ 33 EBNA3B latent 394 ++ +++ +/- +/- +/- +/- + ++ 34 EBNA3C(SJ) latent 605/678 - - - - - - - - 35 EBNA3C 3’ latent 648 +/- + - - - - - - - 62 - Results & Discussions Table 3. EBV gene expression pattern in different cell lines (continued) No. Gene name Gene PCR characteris product tic size(bp) Bu Bi Cu Ci Ru Ri Pu Pi 36 BZLF2 late 598 +/- + - - - - - +/- 37 BZLF1(SJ) early 558&663 ++ +++ ++ ++ - ++ + +++ /871 38 BRLF1 early 616 +/- + - +/- - + +/- ++ 39 BRLF1- early 742/3000 - +/- - +/- - +/- - +/- BZLF1(SJ) 40 BRRF1 early 651 ++ +++ +/- ++ + ++ + +++ 41 BRRF2 late 732 ++ ++ +/- + +/- + + ++ 42 EBNA1 latent 666 ++ ++ ++ ++ ++ ++ ++ + 43 BKRF2 late 334 + +++ +/- +/- +/- + + +++ 44 BKRF3 unknown 534 + ++ +/- ++ +/- +/- +/- ++ 45 BKRF4 early 454 ++ +++ +/- ++ +/- ++ + +++ 46 BBLF4 early 711 +/- ++ +/- ++ - ++ +/- ++ 47 BBRF1 late 583 + ++ - - +/- + +/- ++ 48 BBRF2 late 649 ++ +++ +/- + +/- + + +++ 49 BBLF3 early 480 +++ +++ +/- ++ - ++ + +++ 50 BBLF2 early 522 + ++ - + - + + ++ 51 BBLF2(SJ) early 624/752 ++ ++ +/- + - ++ + ++ 52 BBRF3 late 661 ++ ++ +/- + - + + ++ 53 BBLF1 late 209 +++ +++ +++ +++ +/- +++ ++ +++ 54 BGLF5 early 657 +/- + +/- + + ++ +/- ++ 55 BGLF4 early 663 + ++ +/- +/- - + +/- ++ 56 BGLF3 unknown 581 +/- + +/- +/- - +/- +/- ++ 57 BGRF1- late 616/4500 +/- + - +/- - +/- +/- ++ BDRF1(SJ) 58 BGLF2 late 628 + ++ - +/- - + +/- ++ 59 BGLF1 late 716 +/- + - +/- - - +/- + 60 BDLF4 early 447 +/- ++ - +/- +/- + +/- + 61 BDRF1 late 635 +/- ++ - +/- - + +/- ++ 62 BDLF3 late 652 ++ +++ - - - - +/- ++ 63 BDLF2 late 504 ++ ++ - - - - +/- ++ 64 BDLF1 late 652 + ++ - - - - +/- + 65 BcLF1 late 628 + ++ - - - - +/- ++ 66 BcRF1 early 729 - +/- - - - - - +/- 67 BTRF1 late 643 - +/- - - - - - +/- 68 BXLF2 late 675 ++ +++ +/- ++ - ++ +/- +++ - 63 - Results & Discussions Table 3. No. Gene name EBV gene expression pattern in different cell lines (continued) Gene PCR characteris product tic size(bp) Bu Bi Cu Ci Ru Ri Pu Pi 69 BXLF1 early 673 +/- +/- - +/- - +/- +/- +/- 70 BXRF1 late 612 +/- + - - - - +/- + 71 BVRF1 early 708 + +++ +/- ++ - ++ + +++ 72 BVRF2 late 623 +/- + - - - - +/- + 73 BdRF1 late 686 +++ +++ +/- + - ++ ++ +++ 74 BILF2 late 565 +++ +++ +/- + - ++ ++ +++ 75 BILF1 5 ’ unknown 603 +/- + +/- +/- - + +/- + 76 RJLF3 early 178 - - +/- +/- - ++ - ++ 77 RJLF2 unknown 676 - - + ++ - ++ + +++ 78 RJLF1 unknown 774 - - - - - - - - 79 BILF1 unknown 607 ++ ++ ++ ++ +/- ++ + ++ 80 BALF5 early 655 +/- + +/- + - + +/- + 81 ECRF4 unknown 636 + + + +/- +/- + +/- + 82 BALF4 late 626 +++ +++ + ++ +/- +/- +/- +++ 83 BART1(SJ) latent 690/5000 - - - - - - - - 84 BART2(SJ) latent 773/1802 +/- + + +/- +/- + +/- +/- 85 BART3(SJ) latent 939/1110 - - - - - - - - 86 BALF3 unknown 674 - - - - - - - - 87 BALF2 early 586 +/- + - + - - +/- + 88 BALF1 early 686 +/- ++ - +/- - - +/- + 89 BARF1 early 608 + ++ +/- ++ - - +/- ++ 90 BNLF2 late 497 ++ ++ +/- + ++ ++ ++ ++ 91 LMP1 3’ latent 692 + ++ - - ++ + + + 92 LMP1 3’(SJ) latent 405/481 ++ +++ - - ++ + +/- ++ 93 LMP1 5’(SJ) latent 633/788 + ++ - - + +/- +/- +/- 94 LMP2A 5’ latent 256 + + - - - +/- +/- +/- 95 LMP2B 5’ latent 119 +/- +/- - - - +/- - - 96 LMP23’(SJ) latent 694/5000 ++ ++ +/- + ++ ++ ++ +++ *According to intensity of PCR products, the PCR products were classified into four groups: +/-: weak band; +: clear band; ++: strong band; +++: very strong band. *Bu: B95-8 cell without TPA induction; Bi: B95-8 cell with TPA induction; Cu: C-666 cell without TPA induction; Ci: C-666 cell with TPA induction; Ru: Raji cell without TPA induction; Ri: Raji cell with TPA induction; Pu: P3HR-1 cell without TPA induction; Pi: P3HR-1 cell with TPA induction. *SJ: Sequences across spliced region. The predicted sizes of PCR products of spliced and unspliced transcripts are indicated before and after / respectively. *For the PCR product across spliced region, we only show the spliced product in this table. - 64 - Results & Discussions The first gene we detected was GAPDH, a cellular gene which was used as an invariant control in this study. The intensities of the PCR products of GAPDH from 8 different samples (Fig. 6, lanes 1a-1h) were similar. We roughly estimated that the cell numbers for every PCR reaction were similar. In B95-8 cells, we detected RNA expression of most EBV genes, and the expression patterns were different between before and after TPA induction. For latent genes, B95-8 cell without TPA induction expressed RNAs of EBNA1, EBNA2, EBNA3s, EBNA-LP, LMP1, LMP2A, LMP2B and BARTs (as shown in Fig. 6, lanes 42a, 9a, 31a, 33a, 35a, 5a, 91a, 94a, 95a and 84a respectively). In our profiling system, we did not detect the RNAs of EBV EBERs, because it is nonpolyadenylated, noncoding RNAs. Our profiling method using oligodT-primed cDNA synthesis cannot detect nonpolyadenylated RNAs. Using separate one-step RT-PCRs with gene-specific primers, we detected the transcripts of EBERs both in EBV cell lines and NPC biopsies (data not shown). Based on our profiling results, all EBV latent genes were expressed in B95-8 cells, and this expression pattern belonged to latency type III. This result was consistent with previous studies (Young et al., 2000). After TPA induction, the spliced form transcripts of two latent genes EBNA-LP and EBNA 2 were decreased clearly and the unspliced form of the two genes were increased (as shown in Fig. 6, lanes 5a, 5b and 9a, 9b). Because only the spliced transcripts can give rise to proteins, we deduced that the 2 latent proteins were decreased after cell entering the lytic cycle. This expression change consisted with previous report that the expression of EBV latent proteins was repressed when EBV got - 65 - Results & Discussions into lytic cycle (Kenney et al., 1989). The unspliced transcripts of some other latent genes also increased, such as EBNA3A, EBNA3B and EBNA3C (as shown in Fig. 6, lanes 31a and 31b, 33a and 33b, 35a and 35b).The increase in unspliced transcripts of latent genes could be caused partly by the expression of EBV SM lytic protein which can activate intronless genes expression and inhibit expression of intron-containing genes (Ruvolo et al., 1998). It also could be partly due to the increased DNA template resulted from the DNA replication upon induction. For lytic genes, we can detect most transcripts before induction, but their levels were low. After induction, transcripts of most lytic genes increased greatly. This result indicated that a small percentage of spontaneous lytic cells existed in an uninduced B95-8 culture, and treatment with TPA greatly increased the lytic cell number. This gene expression pattern in B95-8 cells consisted with other reports (Hummel et al., 1982). Only a few transcripts of lytic genes are spliced. Unlike latent genes, the spliced transcripts of lytic genes were increased upon induction, such as lytic gene BHRF1 (as shown in Fig.6, lanes 8a and 8b). It suggested that the expression of EBV lytic proteins increased upon induction and the cells got into the lytic cycle. Based on our profiling results on B95-8 cells, our profiling system could detect RNAs of most EBV genes and correctly reflected the RNA expression change between uninduced and induced B95-8 cells. In P3HR-1 cells, before TPA induction we detected RNAs of five latent genes, including: EBNA1, EBNA3B, LMP1, LMP2A and BARTs (as shown in Fig. 6, lanes 42g, 33g, 91g, 94g and 84g respectively) , and very low level RNAs of lytic genes. The - 66 - Results & Discussions very low level RNAs of lytic genes might come from the P3HR-1 cells which spontaneously entered lytic cycle, and its expression level was generally lower than in B95-8 cells without TPA induction indicating that lower percentage of P3HR-1 cells spontaneously entered lytic cycle. For example, RNAs of lytic genes BLLF2 and BcLF1 in uninduced P3HR-1 cells was less than in uninduced B95-8 cells (as shown in Fig. 6, lanes 29g and 65g). This result consisted with previous reports about these two EBV cell lines (Kurakata et al., 1989; Hudewentz et al., 1980). After induction, the RNAs of most EBV lytic genes were detected including some RNAs which were not detected before induction, and the expression level increased greatly. For example, the RNA of lytic gene BLLF3 was detected only after induction (as shown in Fig 6. lane 26h). It demonstrated that more P3HR-1 cells got into lytic cycle after induction. Our results are consistent with the results of previous studies about EBV RNA expression in P3HR-1 cells without and with TPA induction (Weigel et al., 1983), again showing that our profiling system was suitable for detect EBV RNAs in P3HR-1 cells. Raji cell line is different form B95-8 and P3HR-1 cell lines; it is a nonproducer Burkitt’s lymphoma cell line (Fresen et al., 1978). After TPA induction, EBV early antigens (EA) are expressed in Raji cells, but no EBV VCA synthesis and no viral particle production (Anisimova et al., 1982). Our study got the same results as previous study. Before TPA induction, Raji expressed some latent genes including: EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA-LP, LMP1 and BARTs (as shown in Fig. 6, lanes 42e, 9e, 31e, 33e, 5e, 91e and 84e respectively). Very low level RNAs of less than 1/3 - 67 - Results & Discussions lytic genes were detected. It suggested that only very small numbers of Raji cells spontaneously entered the lytic cycle. After induction, transcripts of about 80% lytic genes were detected, including the genes which encode the EBV EA components, such as BMRF1 which encodes early antigen diffuse components (EA-D) (as shown in Fig. 6, lane 20f). However, not all transcripts of early genes were detected. For example, RNA of early gene BALF2 which encodes a DNA binding protein was not detected (as shown in fig 6. lane 87f). This result is consistent with other reports that EBV early lytic genes could be efficiently induced by TPA (Anisimova et al., 1982; Decaussin et al., 1995). The RNAs of some EBV lytic late genes were detected after induction, but the expression level was low, and generally lower than in B95-8 and P3HR-1 cells. Transcripts of many late genes were not detected, including the genes which encode the EBV VCA components. For example, RNA of BcLF1 which encodes the structural nucleocapsid protein that is one of the major components of VCA was not detected in Raji cells (Fig. 6, lanes 65e and 65f). Expression of BcLF1 usually indicates the completion of EBV lytic cycle (Rickinson & Kieff, 1996). This result indicated that Raji cells did not complete lytic cycle nor produce viral particles even after TPA induction. These cells seemed stay in an abortive lytic stage. This was in accordance with previous studies (Polack et al. 1984; Anisimova et al., 1982). The profiling results of the three different EBV-positive cell lines (B95-8, P3HR-1 and Raji) showed that our profiling system detected transcripts of most EBV genes in different cell lines, and correctly reflected the gene expression change before - 68 - Results & Discussions and after induction. Compared with previous studies, our profiling results were consistent with them. All these suggest that our profiling system can work well to detect transcripts of EBV genes in different EBV cell lines, and can be used for profiling EBV gene expression in NPC cells. 3.1.3.2 NPC-derived cell line C666-1 Epithelial cell line C666-1 is a new EBV infected cell line. It is derived from the NPC xenograft and consistently carries EBV in long-term cultures (Cheung et al., 1999). This cell line can be used as a model to study NPC tumour cells. Unlike other EBV-positive B-lymphocyte-derived cell lines which were used in this study, the EBV gene expression of this cell line has not been well studied. Previous research just studied the latent genes expression. EBNA 1 protein and transcripts of BARTs, LMP1 and LMP2 are expressed (Cheung et al., 1999; de Jesus et al., 2003). We chose this epithelial cell line as a prelude to the study of the EBV gene expression in NPC tumour cells. Our profiling results showed that RNAs of three latent genes were detected in C666-1 cells without induction, including EBNA1, LMP2 and BARTs (as shown in Fig 6. lanes 42c, 96c and 84c respectively). Transcript of LMP1 was not detected in our study. This result is inconsistent with previous study which showed expression of EBV LMP1 in this cell line (Cheung et al., 1999). This could be due to the different methods we used to detect EBV RNA. Cheung’s study used nested PCR plus probe hybridization, a more sensitive method than ours, to detect LMP1 RNA. They detected a very low - 69 - Results & Discussions level of LMP1 transcript. However their western blot analysis was unable to detect LMP1 protein. It is likely that the RNA expression level of LMP1 is very low in C666-1 cells so that it cannot be detected in our method. It is not possible for us to use such a highly sensitive but tedious method to detect RNAs of all EBV genes. Moreover, extreme low levels of RNA expression which can only be detected by this highly sensitive method may not be physiologically significant. Based on our results, latent gene expression in this cell line seems belong to latency type I/II which is typical of NPC cells (Kieff & Rickinson, 2001). For lytic genes, transcripts of more than half lytic genes were detected before induction, but the expression level was very low except 3 lytic genes BHLF1, BBLF1 and BMRF2 (as shown in Fig. 6, lanes 7c, 53c and 21c respectively), which were expressed at very high level. Though transcripts of more than half lytic genes were expressed in C666-1 cell without induction, transcripts of many EBV lytic late genes were not detected. TPA induction increased transcripts of many EBV lytic genes in C666-1 cells. However, transcripts of more than 20% lytic genes were not detected even after induction, including late gene BcLF1 (as shown in Fig. 6, lane 65d) which codes for the major capsid protein. It showed that C666-1 cell line could not complete the lytic cycle and produce viral progeny even after TPA induction. EBV in C666-1 cells seemed to stay in an abortive lytic stage like in Raji cells. Comparing the RNA expression in C666-1 cells with Raji cells without induction, we found more EBV lytic genes were expressed in C666-1 cells than in Raji cells (as shown in Table 3). However, less EBV genes were - 70 - Results & Discussions induced by TPA in C666-1 cells such that TPA-treated C666-1 cells expressed less EBV genes than TAP-induced Raji cells (Table 3). It suggested that the lytic cycle is blocked by different regulatory mechanisms in the two cell lines. In summary, based on the profiling results of four EBV infected cell lines, our profiling system is suitable for detecting EBV RNAs in different EBV cell lines and is usable for profiling EBV gene expression in NPC cells. Profiling results on C666-1 cell line indicates that its resident EBV is in type I/II latency and is defective in lytic replication. - 71 - Results & Discussions 3. 2 PART 2: TEST EBV GENE EXPRESSION IN NPC BIOPSIES 3. 2. 1 DNA and RNA extraction Ten NPC and four non-NPC nasopharyngeal biopsies were investigated in our study. Total RNA and DNA were isolated from 20 mg of every tissue sample as described in section 2.3.2. The products were analyzed using agarose gel electrophoresis. We got the similar results as shown in Fig. 4. The appearance of the RNA and DNA preparations suggested that the extracted RNA and DNA from biopsies were intact. 3.2.2 EBV DNA profiling of tissue samples Because we found that most EBV genes were not expressed in NPC biopsies after a preliminary study of tissue samples (data not shown), we omitted some genes that were never expressed in any of the preliminary samples and chose half of EBV genes be tested in the subsequent samples. The genes we chose were listed in Table 4. - 72 - Results & Discussions Table 4. EBV gene profiling arrangement for tissue samples No. Gene Gene Predicted name characteri size(bp) of stic PCR No. Gene Gene predicted name characteri size(bp) of stic PCR products products 1 GAPDH cellular 454 25 BKRF4 late 454 2 BNRF1 late 712 26 BBLF4 early 711 3 BCRF1 late 510 27 BBLF1 late 209 4 EBNA- latent 103/187 28 BGLF5 early 657 LP3’(SJ) 5 EBNA2 latent 706 29 BGLF4 early 663 6 BHLF1 early 237 30 BDLF4 early 447 7 BHRF1 early 558/997 31 BDLF3 late 652 latent 388/859 32 BcLF1 late 628 5’(SJ) 8 EBNA2 5’(SJ) 9 BFRF3 early/late 458 33 BTRF1 late 643 10 BORF2 early 682 34 BXLF2 late 675 11 BMRF1 early 708 35 RJLF3 early 178 12 BMRF2 late 547 36 RJLF2 unknown 676 13 BMLF1 early 673 37 BILF1 unknown 607 14 SM(SJ) early 413/517 38 BALF5 early 655 15 BLLF3 early 729 39 BART2 latent 773/1802 (SJ) 16 BLRF2 late 411 40 BALF2 early 586 17 BLLF1 late 364/983 41 BALF1 early 686 (SJ) 18 EBNA 3A latent 621 42 BARF1 early 608 19 EBNA 3C latent 648 43 LMP1 3’ latent 692 20 BZLF1 early 558& 44 LMP1 latent 405/481 latent 633/788 (SJ) 21 BRLF1 663/871 early 616 3’(SJ) 45 LMP1 5’(SJ) 22 BRRF1 early 651 46 LMP2A latent 256 23 BRRF2 late 732 47 LMP2B latent 119 24 EBNA1 latent 666 48 LMP2 latent 694/5000 3’(SJ) *SJ indicated the PCR product across spliced region. The predicted sizes of PCR products of spliced and unspliced transcripts are indicated before and after / respectively. *latent: EBV latent gene; early: EBV lytic early gene; late: EBV lytic late gene; cellular: cell gene. - 73 - Results & Discussions For each sample, we first tested whether our primers could amplify EBV sequences from the extracted DNA. For NPC biopsies, we used about 20ng DNA as template for each PCR. Fig. 7 shows the results of such an analysis of a typical NPC biopsy. In general, most primers efficiently amplified specific EBV sequences from NPC samples, and only occasional primers did not work well. For instance, for this particular NPC sample, primers for GAPDH and EBNA3C amplified gene specific sequences, but also amplified some non-specific sequences (as shown in Fig. 7, lanes 1 and 19 respectively). Furthermore, primers for EBNA-LP, BHLF1 and LMP2B correctly amplified EBV sequences, but the amount of PCR products were less than others (as shown in Fig. 7, lanes 4, 6 and 47 respectively). This could be due to the variant EBV DNA sequences existing in different samples so that some primers could not work well in individual NPC biopsies. However, most primers successfully amplified EBV specific gene sequences in all NPC biopsies, and only a small number of primers did not work well in 1-2 of total 10 samples. So this problem should not affect significantly our interpretation of results. For non-NPC tissue samples, we used more DNA template (100ng) for each PCR. Fig. 8 shows the analysis results for a typical non-NPC sample. In general, more than half of the reactions could produce specific PCR products from a non-NPC tissue sample, but the amounts of EBV-specific PCR products were much less than those obtained from NPC biopsies. For this particular non-NPC sample, thirteen reactions did not give any signals, including EBNA-LP, EBNA2, BHLF1, BFRF3, BLLF3, EBNA3C, BKRF4, BTRF1, RJLF3, BART2, LMP1, LMP2B and LMP2 (as shown in Fig. 8, lanes - 74 - Results & Discussions 4, 5, 6, 9, 15, 19, 25, 33, 35, 39, 44, 47 and 48 respectively). Six reactions produced weak specific and non-specific products, including GAPDH, BNRF1, EBNA1, BBLF1, BILF1 and BALF4 (as shown in Fig. 8, lanes 1, 2, 24, 27, 37 and 41 respectively). Our results showed that the EBV DNA existed in normal nasopharyngeal tissues, but in extremely low levels. Though more DNA from non-NPC biopsies was used as template to do PCR, it gave no or less products than that from NPC biopsies. This should most likely be due to the small amounts of EBV DNA existing in non-NPC tissues. Previous studies reported that EBV genome was contained in all malignant epithelial cells, but always negative in untransformed squamous epithelia from the nasopharyngeal mucosa (Lin et al., 1997). According to previous reports, normal nasopharyngeal tissues are frequently infiltrated by lymphocytes and a small fraction (1/104-6) of some infiltrated B lymphocytes contains EBV genome (Alan et al., 1999). The EBV DNA detected in our study could come from infiltrating EBV infected B lymphocytes. Since the EBV signals from normal nasopharyngeal tissues were so much lower than those obtained from NPC tissues, the EBV signals obtained from NPC tissues were therefore largely tumour-specific. - 75 - Results & Discussions GAPDH EBNA-LP BHLF1 EBNA 3C 1000bp 800bp 600bp 500bp 400bp 200bp 100bp LMP2B 1000bp 900bp 700bp 600bp 400bp 200bp 100bp Fig. 7 DNA profiling results of one NPC biopsy. PCRs were performed using primers specific for 48 EBV genes listed in Table 4 (lanes marked 1 to 48), the DNA extracted from a NPC biopsy as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain 100bp DNA markers with sizes indicated on the left. The predicted sizes of PCR products from reactions 1-48 were listed in Table 4. The genes that could not be efficiently amplified were pointed out on the top of lanes. For the reactions which produced nonspecific products, the specific products were pointed out by white arrows. - 76 - Results & Discussions GAPDH EBNA1 BNRF1 900bp 700bp 500bp 400bp 200bp BBLF1 BILF1 BALF1 900bp 700bp 500bp 400bp 200bp Fig. 8 DNA profiling results of one non-NPC tissue biopsy. PCRs were performed using primers specific for 48 EBV genes listed in Table 4 (lanes marked 1 to 48), the DNA extracted from a non-NPC biopsy as the template. The products were electrophoresced on 1% agarose gel. Lanes marked M contain 100bp DNA markers with sizes indicated on the left. The predicted sizes of PCR products from reactions 1-48 were listed in Table 4. The genes that could not be efficiently amplified were pointed out on the top of lanes. For the reactions which produced nonspecific products, the specific products were pointed out by white arrows. 3.2.3 EBV RNA profiling of tissue samples We used our profiling system to check RNA expression of EBV genes in 14 tissue - 77 - Results & Discussions samples, including 10 NPC and 4 non-NPC tissues. In order to prevent the false positive results caused by DNA contamination, we used DNase I to treat the isolated RNA before subjecting the RNA to reverse transcription to synthesize cDNA. We confirmed the absence of DNA contamination with DNase I treated RNA preparation by performing a “no-RT” PCR whereby the RNA preparation itself was used as the template. An RNA preparation free of DNA contamination would not produce a PCR product. Initially, for each RNA preparation, we perform the “no-RT” PCR only on the positive control gene GAPDH. Later on, we realized that even when the “no-RT” PCR for GAPDH did not produce a product, the “no-RT” PCRs for some EBV genes could still produce products (data not shown). This could be due to the possibility that the copy number of EBV genome is higher than that of human genome in a given cell or tissue sample. Indeed, a typical EBV latency infected cell contains ten or more copies of EBV genome. Another possible reason for getting “no-RT” PCR products for some EBV genes but not for GAPDH could be that the amplification efficiencies for these EBV genes were somehow higher than that for GAPDH. Given this observation, we did a “no-RT” PCR control to accompany the RT-PCR for each EBV gene studied in the RNA profiling. The results of RNA profiling for a typical NPC and non-NPC biopsies are shown in Fig. 9 and 10 respectively. For these two tissue samples no product appeared in “no-RT” negative control PCRs lanes 1’-48’. It showed that the PCR products obtained in RT-PCR were indeed amplified form cDNAs. - 78 - Results & Discussions 1000bp 700bp 500bp 300bp 200bp 1000bp 800bp 600bp 300bp 200bp GAPDH BBLF1 BHLF1 BDLF3 RJLF3 RJLF2 BMLF1 BILF1 BART2 BALF2 BALF1 EBNA1 LMP2A LMP2B LMP2 Fig. 9 RNA Profiling results of one NPC patient tissue sample. PCRs were performed using primers specific for 48 EBV genes which listed in Table 4, the RNA preparation (lanes marked 1’-48’) and the synthesized cDNA (lanes marked 1-48) as the templates. The products were electrophoresced on 1% agarose gel. Lanes marked M contain 100bp DNA markers with sizes indicated on the left. The predicted sizes of PCR products from reactions 1-48 were listed in Table 4. The gene-specific primers which amplified EBV specific sequences were pointed out on the top of lanes. - 79 - Results & Discussions 1000bp 700bp 500bp 300bp 200bp 1000bp 700bp 500bp 300bp 200bp GAPDH BXLF2 BMRF2 BILF1 Fig. 10 RNA Profiling results of one non-NPC patient tissue sample. PCRs were performed using primers specific for 48 EBV genes which listed in Table 4, the RNA preparation (lanes marked 1’-48’) and the synthesized cDNA (lanes marked 1-48) as the templates. The products were electrophoresced on 1% agarose gel. Lanes marked M contain 100bp DNA markers with sizes indicated on the left. The predicted sizes of PCR products from reactions 1-48 were listed in Table 4. The gene-specific primers which amplified EBV specific sequences were pointed out on the top of panels. - 80 - Results & Discussions After profiling all tissue samples, the profiling results for 10 NPC biopsies and 4 non-NPC biopsies were summarized in Table 5. Table 5 RNAs profiling results of tissue biopsies Latent NPC genes biopsies(n=10) EBNA1 9 EBNA2 0 EBNA3 0 EBNA-LP 2 LMP1 4 LMP2A 9 LMP2B 5 BART2 7 non-NPC biopsies(n=4) 0 0 0 0 0 0 0 0 Lytic NPC non-NPC genes biopsies(n=10) biopsies(n=4) BHLF1 9 0 BBLF1 7 0 BALF5 7 0 BARF1 7 0 RJLF3 6 0 RJLF2 6 0 BALF2 4 0 BALF1 4 0 BMRF2 3 1 BMRF1 2 1 BRLF1 2 0 SM 2 0 BILF1 7 2 BNRF1 2 2 BNLF1 1 0 BRRF1 1 0 BDLF3 1 0 BXLF2 0 1 * Except EBNA2 and EBNA3, EBV genes that never gave positive results in RT-PCR are omitted. As shown in this table, among latent genes, only EBNA1 and LMP2A were consistently expressed in almost all NPC biopsies; BARTs were expressed in the majority (70%) of NPC samples; LMP1 and LMP2B were expressed in about half of the cases. Transcript of EBNA-LP was detected only in 2 samples. In these two samples, the EBNA-LP transcripts detected were unspliced. Therefore they were not the messages for EBNA-LP protein production. The transcripts of EBNA3s and EBNA2 - 81 - Results & Discussions were absent. Based on our result, latent genes EBNA1, LMP2s, LMP1 and BARTs were expressed in most NPC biopsies, and this EBV gene expression pattern belongs to latency type I/II. This is consistent with previous studies (Brooks et al., 1992; Sadler et al., 1995). In addition to some latent genes, some lytic genes were found to be expressed in NPC biopsies. Among these lytic genes, the most consistently expressed gene was BHLF1. The transcripts of BHLF1 were detected in 90% NPC biopsies. In contrast no BHLF1 expression was detected from non-NPC samples. Although the RNA expression levels of BHLF1 were variable in different NPC samples, they were generally high compared with other EBV genes, especially in 2 samples. In addition to BHLF1, a few other lytic genes were also found to be expressed in NPC tissues. Transcripts of BBLF1, BALF5, BARF1, RJLF3 and RJLF2 were detected in more than half of NPC samples but not in non-NPC samples. Transcripts of BILF1 were found in 70% NPC samples, but they were also detected in 2 of 4 non-NPC samples. Transcripts of BALF2 and BALF1 were only found in 4 NPC samples. Transcripts of BMRF2, BMRF1, BRLF1, SM, BNRF1, BNLF1, BRRF1 and BDLF1 were detected in 1-3 samples of 10 NPC biopsies, and among these 8 genes, BMRF2, BMRF1 and BNRF1 were also detected in non-NPC samples. Totally, we found EBV RNAs derived from the genomic regions of 17 lytic genes. Compared with the RNA profiling results of NPC cell line C666-1, we found that the number of genes expressed in NPC tissue samples is much less than in C666-1 cell line. The most outstanding result of our RNA profiling of tissue samples is the - 82 - Results & Discussions presence of BHLF1 RNA specifically in NPC tissues and the transcription levels were relatively high. Since the BHLF1 RNA is polyadenylated, it is likely that it is translated to produce BHLF1 protein. It is unlikely that the transcript of BHLF1 was from the infiltrating B lymphocytes in the NPC biopsies, because it was not found in non-NPC nasopharyngeal tissues which also contain a lot of B lymphocytes. It is more likely that this gene is expressed in NPC malignant epithelial cells. To confirm this possibility, we need to do RNA in situ hybridization for BHLF1 on NPC tissues. BBLF1 sequence-containing RNA was also found in most NPC biopsies, but we are not sure if BBLF1 is expressed at the protein level. BBLF1 is located in a nested transcription unit that includes two other genes BGLF5 and BGLF4. Since BBLF1 is downstream of BGLF5 and BGLF4, the RNAs for the translation of BGLF5 or BGLF4 also contain BBLF1 sequence (as shown in Fig. 11). With only the RT-PCR data, we cannot tell if the BBLF1 sequence-containing RNA is for BBLF1 translation. BBLF1 BGLF5 BGLF4 Fig. 11 BBLF1, BGLF1 and BGLF4 transcription map. The transcript of individual gene (from the transcription initiation site to polyadenylation signal) was indicated with . EBV lytic gene BGLF5 has been reported to be expressed in NPC biopsies (Sbih-Lammali et al., 1996). However, in our profiling study, we did not detect the - 83 - Results & Discussions BGLF5 sequence-containing RNA. Since the BGLF5 sequence is relatively far (2kb) upstream of the polyadenylation signal, the cDNA synthesis primed with oligo-dT and performed by a reverse transcriptase with low-processing activity as in our study may reach this sequence very inefficiently. That may explain why we were unable to detect BGLF5 RNA in our profiling study. To study if BGLF5 might be expressed, we performed RT-PCR using BGLF5 gene specific reverse primer to synthesize the cDNA. With this method, we detected BGLF5 sequence-containing RNA from a NPC biopsy (data not shown). However, this detected RNA could be the one for BGLF5 or BGLF4 translation. We did not study this case any further. Transcript of BARF1 was found to be expressed in about 70% NPC biopsies and not in non-NPC biopsies. It has been reported that this gene are expressed in about 80% NPC tumour biopsies (Tanner et al., 1997). Our results are consistent with these data. In NPC biopsies, we frequently detected RNAs derived from the EBV genomic region where BALF5, RJLF3, RJLF2, BALF2, BALF1 and BILF1 genes reside. This EBV genomic region is actually transcribed in both directions (as shown in Fig. 12). While the leftward transcription gives rise to the RNAs of the above mentioned genes, and the rightward transcription gives rise to a huge (22kb) primary transcript called BART which is then differentially spliced into many small RNAs (Smith et al., 2001). Since our RNA profiling reactions do not distinguish the orientation of the RNA in a genomic region, we could not tell whether the detected transcripts were those of the leftward-oriented genes or BARTs. This issue was resolved by orientation-specific RT-PCR (see section 3.2.4). - 84 - Results & Discussions BILF1 RJLF2 RJLF3 BALF5 BALF4 BALF3 BALF2 BALF1 Bam HI A rightward transcripts (BARTs) Fig. 12 Transcription map of genes within or near Bam HI A region The transcript of individual gene (from the transcription initiation site to polyadenylation signal) was indicated with . We also found some other lytic genes occasionally expressed in NPC biopsies, such as BRLF1, BMRF2 and BMRF1. According to previous paper, BRLF1 RNA should be expressed in most NPC biopsies (Feng et al., 2000), but in our study the results were different. This might be due to the different method we used for detecting RNAs. In the previous study, nested PCR and subsequent probe hybridization were employed to detect the EBV RNAs. This method is more sensitive than our method. This might explain the difference in the results. The EBV RNA profile of C15, a nasopharyngeal carcinoma tumour propagated in nude mice (Hitt et al., 1989), is similar to that of the NPC tissues which we obtained. RNAs from the EBV Bam HI-A region and a low level of RNA from the BamHI-H region were detected in C15. A further study on C15 indicated that BHLF1 might be expressed in malignant epithelial cells (Xue et al., 2000). - 85 - Results & Discussions 3.2.4 Orientation-Specific RT-PCR In order to tell the orientation of the transcripts of BILF1, RJLF3, RJLF2, BALF5, BALF2, BALF1 and BARTs, we added only EBV gene specific forward or reverse primers to prime the reverse transcription. If the transcripts were leftward, the specific PCR product should be appeared only when forward primers were used to prime the RTs (refer to Fig. 13, lanes 1’-10’). In opposite, if the transcripts were rightward, the specific PCR products should be appeared only when we used reverse primers to prime the RTs (refer to Fig. 13, lanes 1-10). The testing results were shown in Fig. 13. In this test, we got a number of non-specific products in many reactions, for example, the reaction for BALF5 using either the reverse or forward primer to prime the RT (Fig. 13, lanes 3 and 3’). We have not optimized this orientation-specific RT-PCR protocol. However, the current results were clear enough for us to draw the conclusions as described below. The specific PCR products at the BALF2, BALF5, BILF1, RJLF1, RJLF2, RJLF3 and BALF1 regions appeared when we used reverse primers to prime the RTs (as shown in Fig. 13, lanes 1, 3, 4, 5, 6, 7 and 10 respectively), and not appeared when forward primers were used. It showed that all these RNAs were rightward transcripts, and therefore the transcripts of these genes were indeed the BARTs which have been reported to be expressed in NPC tissues (Sadler et al., 1995). The transcripts of BALF2, BALF5, BILF1, RJLF2, RJLF3 and BALF1 which we detected in NPC biopsies were actually not expressed in the NPC tissues. - 86 - Results & Discussions BALF2 BART BALF5 BILF1 RJLF1 RJLF2 RJLF3 900bp 600bp 500bp 400bp 200bp BHLF1 BARF1 BALF1 1000bp 600bp 500bp 400bp 200bp 100bp Fig. 13 Orientation test of transcripts of some EBV genes. One-Step PCRs were performed using the primers specific for EBV genes shown on the top of each panel, and reverse primers (lanes marked with 1-10) or forward primers were used to prime (lanes marked with 1’-10’) the RTs. The products were electrophoresced on 1% agarose gel. Lanes marked M contain 100bp DNA markers with sizes indicated on the right. For each reaction the specific product was pointed by white arrow. We also used the same method to check the orientation of the RNAs detected in the BHLF1 and BARF1 regions. The specific PCR product at the BHLF1 region presented when forward primer were used to prime the RTs (as shown in Fig. 13, lane 8’). On the contrary, the specific PCR product at BARF1 region presented when reverse primer were used (as shown in Fig. 13, lane 9). It showed that the directions of transcripts of BHLF1 and BARF1 were correct, and therefore these two genes were - 87 - Results & Discussions really expressed in NPC biopsies. In addition, there might be a small amount of rightward RNA in the BHLF1 region because the specific product also appeared when reverse primer was used to prime the RTs (as shown in Fig. 13, lane 8). For BART, we detected several PCR products in the range of 100bp-400bp when we used reverse primer to prime the RTs (as shown in Fig. 13, lane 2). It showed that BART was differentially spliced in NPC biopsies as previously described (Smith et al., 2001). In conclusion, though we found RNAs from several lytic gene regions in NPC biopsies, BHLF1, BARF1 and BGLF5 may be the only lytic genes that are really expressed. BGLF5 (Sbih et al., 1996) and BARF1 (Tanner et al., 1997) had been reported to be expressed in NPC biopsies before. Expression of BHLF1 in NPC has never been reported. Comparing the RNAs profiling results of NPC biopsies with those of the NPC cell line C666-1, we found that most of the EBV RNAs we detected in NPC biopsies were also appeared in this cell line. The EBV latent gene expression patterns of the NPC biopsies studied were similar to that of C666-1 cell line. In term of lytic genes, transcripts from the genetic regions of BHLF1, BBLF1 and BARF1 which were found to be expressed in more than half of NPC biopsies were also detected in C666-1 cells. Therefore, C666-1 cell line should be a good model for studying EBV gene expression regulation in NPC tumour cells. - 88 - Results & Discussions 3. 3 PART 3: CONCLUSION NPC is a malignancy of the stratified squamous epithelium of nasopharynx. This carcinoma is rare in most countries, but it has a high incidence in South-East Asia. As we had discussed before, this carcinoma is consistently associated with EBV infection, and EBV have been considered as an important factor in the oncogenesis of NPC. EBV has been proven to exist in the nasopharyngeal epithelial cells of NPC patients, but not in untransformed squamous epithelia from the nasopharyngeal mucosa (zur Hausen et al., 1970; Lin et al., 1997). It is generally accepted that EBV infection in NPC tumour cells is predominantly latent, and EBV latent gene expression is consistently detected in tumour cells, including EBNA1, LMP1, LMP2, BARTs and EBERs. Previous studies mainly focus on these EBV latent genes and their function in oncogenesis of NPC. In contrast, less research has been done to study the EBV lytic genes. However more and more data suggest that EBV lytic genes are expressed in NPC tumour cells, and maybe contribute to the development of NPC (Wei et al., 1997; Sbih-Lammali et al., 1996; Feng et al., 2000). Based on this background, our study was designed to find what EBV genes are expressed in NPC biopsies. In fact, this is the first comprehensive study of EBV gene expression in primary NPC tissues. The results present in this study add some valuable information to current knowledge of EBV lytic genes expression pattern in NPC tumour cells, and provide some clues to understand the involvement of EBV in the development of NPC. - 89 - Results & Discussions 3.3.1 Successfully construct a profiling system to check the transcripts of EBV genes By using RT-PCR technique, we constructed a reliable profiling system to detect the transcripts of EBV genes in NPC biopsies. We have shown that this system successfully detected the transcripts of EBV genes in different EBV cell lines and NPC biopsies. This profiling system should be a useful tool for revealing the EBV gene expression in tissues of other EBV associated diseases. This system also has some defects. First, our profiling method is not as sensitive as nested PCR plus probe hybridization which has been used in previous studies. Therefore some transcripts which have been reported to be expressed in EBV cell lines or NPC biopsies were not detected in our study. It is not possible for us to use such a highly sensitive but tedious method to detect RNAs of all EBV genes. Moreover, extreme low levels of RNA expression which can only be detected by this highly sensitive method may not be physiologically significant. Based on this consideration, we prefer to use our method in this study. Second, our profiling system only can detect EBV RNAs, and we do not know whether the RNAs translate to proteins. Third, this system only looks at RNAs in batch, but not in individual cells. Though this system has some defects, it is good to be used in a preliminary study of EBV gene expression to provide clues for further studies. 3.3.2 Lytic gene expression in NPC biopsies Although it is generally accepted that EBV infection in NPC is predominantly - 90 - Results & Discussions latent, our profiling results of NPC tissue biopsies and NPC cell line (C666-1), as well as data from other groups (Feng et al., 2000; Tanner et al., 1997; Wei et al., 1997; Sbih et al., 1996), show that a small number of EBV lytic genes are expressed in NPC in addition to latent genes. It appears that the lack of expression of some genes essential for the lytic replication disallows virus production and cell killing, and locks the cells in an abortive lytic stage. Some of the expressed lytic genes may contribute to the proliferation potential of the tumour cells. For instance, among the lytic genes frequently expressed in NPC biopsies, BARF1 was shown to have the transforming ability (Wei et al., 1989; Deaussin et al., 2000). 3.3.3 BHLF1 expression in NPC biopsies The transcript of BHLF1 was first found in this study to be expressed in NPC biopsies. BHLF1 is an unusual gene. It consists almost entirely of tandem repeats of a 125bp G-C-rich sequence. Each sequence repeat contains a recognition site for the rare-cutting restriction enzyme Not I and therefore is called Not I-repeats (Pfitzner et al., 1987). Accordingly, the BHLF1-encoded protein consists almost entirely of tandem repeats of 125 amino acids. It is a very basic protein consisting mainly of proline (22%), alanine (16%), glycine (16%) and arginine (13%). It has been detected in EBV infected lymphocyte cell lines, exists in nuclear patches colocalizing with nucleoli, and has the ability to strongly bind single-stranded DNA in vitro (Lieberman et al., 1989; Nuebling et al., 1989). In vitro studies on latently infected B-lymphocyte cell lines have shown that BHLF1 is an early lytic gene and its transcripts are the most abundant EBV-specific - 91 - Results & Discussions transcripts in the early phase of lytic cycle (Laux et al., 1985). BHLF1-encoded protein belongs to subgroup EA-D of EBV-encoded antigens. Although the BHLF1 is the most actively transcribed gene during lytic EBV infection, the precise function of the BHLF1 gene product remains unknown. With the fact that the promoter of BHLF1 overlaps with the essential domain of the viral origin of lytic replication (Hammerschmidt et al., 1988), BHLF1 may play a role in the regulation of lytic replication. A study on human tonsillar lymphocytes has suggested that BHLF1 protein has a function in the regulation of viral gene transcription (Yamamoto et al., 1989). Previous study about EBV gene expression in NPC biopsies did not detect the transcripts of BHLF1 (Xue et al., 2000). This may caused by the different primers we used for PCR. We tried to repeat their experiments, and found that their primers for BHLF1 could not efficiently amplify EBV specific sequence even from EBV DNA. Therefore, after reverse transcription, they could not detect the transcript of BHLF1. 3.3.4 Further studies on BHLF1 In this preliminary study, we showed that transcripts of BHLF1 were consistently expressed in NPC biopsies. Further studies need to do to confirm our results and to evaluate the possible significance of BHLF1 in the development of NPC. First, we need to profile more tissue samples to confirm that the transcripts of BHLF1 are expressed in most NPC biopsies and not expressed in non-NPC tissues samples, because the number of biopsies which we used in this study is not enough, especially the number of non-NPC samples. Second, we need to test the origin of BHLF1 transcripts. RNA in situ - 92 - Results & Discussions hybridization should be performed using BHLF1 gene-specific probes to test whether the transcripts come from the NPC tumour cells or just from infiltrating B-lymphocytes. Third, in order to test if the BHLF1 encoded protein is present in NPC cancer cells, we may clone, express and purify the BHLF1 encoded protein, and use the purified protein to immunize animals to get BHLF1-specific antibody, and then use the antibody to perform immunohistochemical studies to test the if BHLF1 encoded protein present in NPC tumour cells. Fourth, in order to test if BHLF1 has an effect on cell proliferation, we can express the BHLF1 encoded protein in primary monkey epithelial cells to observe the effect of this protein on the growth of epithelial cells or we can silence BHLF1 gene expression in NPC cell line C666-1 using siRNA to observe the change of the cells. In addition, we can use the purified BHLF1 encoded protein to profile antibody response in NPC patients’ blood. If the antibodies against BHLF1 encoded protein specifically appear in most NPC patients’ blood and do not appear in normal people’s blood, it is possible for this protein to be a new candidate of NPC diagnostic markers. In summary, in this study we first successfully constructed a profiling system which can detect the RNA expression of EBV genes in EBV-infected cells. Then we used this system to profile EBV transcripts in NPC biopsies. Profiling results showed that some lytic genes were transcribed in NPC biopsies. Among these lytic genes, BHLF1 have not been found to be expressed in NPC before. Additional studies are required to determine the relevance of BHLF1 expression to the development of NPC. - 93 - CHAPTER 4 REFERENCES - 94 - References Abbot SD, Rowe M, Cadwallader K, Ricksten A, Gordon J, Wang F, Rymo L, Rickinson AB. 1990. Epstein-Barr virus nuclear antigen 2 induces expression of the virus-encoded latent membrane protein. J Virol. 64(5):2126-2134. Alan G. Gibb Chapter 2: Anatomy and Development. 1999. In: C. Andrew van Hasselt, Alan G. Gibb, eds. Nasopharyngeal Carcinoma, 2nd ed. Chinese University Press ; London : Greenwich Medical Media Ltd. p.13-30. Anisimova E, Saemundsen AK, Roubal J, Vonka V, Klein G. 1982. Effects of n-butyrate on Epstein-Barr virus-carrying lymphoma lines. J Gen Virol. 58(1):163-171. Baer R, Bankier, AT, Biggin, MD, Deninger, PL., Farrell, PJ, Gibson, TJ, Hatfull, G, Hudson, GS, Satchwell, SC, Seguin, C, Tuffnell, PS & Barrell, BG. 1984. DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature. 310(5974):207-211. Blair A, Saracci R, Stewart PA, Hayes RB, Shy C. 1990. Epidemiologic evidence on the relationship between formaldehyde exposure and cancer. Scand J Work Environ Health. 16(6):381-393. Bornkamm GW, Delius H, Zimber U, Hudewentz J, Epstein MA. 1980. Comparison of Epstein-Barr virus strains of different origin by analysis of the viral DNAs. J Virol. 35(3): 603-618. Bornkamm G.W., Hudewentz J., Freese U. K., Zimber U. 1982. Deletion of the nontransforming Epstein-Barr virus strain P3HR-1 causes fusion of the large internal repeat to the DSL region. J Virol. 43(3):952-968. Boyle MJ, Sewell WA, Sculley TB, Apolloni A, Turner JJ, Swanson CE, Penny R, Cooper DA. 1991. Subtypes of Epstein-Barr virus in human immunodeficiency virus-associated non-Hodgkin lymphoma. Blood. 78(11):3004-3011. Brooks L, Yao QY, Rickinson AB, Young LS. 1992. Epstein-Barr virus latent gene transcription in nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts. J Virol. 66(5):2689-2697. Burgstahler, R, Kempkes B, Steube K, and Lipp M. 1995. Expression of the chemokine receptor BLR2/EBI1 is specifically transactivated by Epstein-Barr virus nuclear antigen 2. Biochem. Biophys. Res. Commun. 215(2):737-743. - 95 - References Burkitt D, O’Conor GT. 1961. Malignant lymphoma in African children. I.A clinical syndrome. Cancer 14:258 -/269. Caldwell R. G, Wilson J.B., Anderson S. J., Longnecker R. 1998. Epstein-Barr virus LMP2A drives B cell development and survival in the absence of normal B cell receptor signals. Immunity. 9(3):405-411. Chan KH, Gu YL, Ng F, Ng PS, Seto WH, Sham JS, Chua D, Wei W, Chen YL, Luk W, Zong YS, Ng MH. 2003. EBV specific antibody-based and DNA-based assays in serologic diagnosis of nasopharyngeal carcinoma. Int J Cancer. 105(5):706-709. Chan SH, Day NE, Khor TH, Kunaratnam N and Chia KB. 1981. HLA markers in the development and prognosis of NPC in Chinese. In: Grundmann E, Krueger GRF and Ablashi DV, eds. Cancer campaign, Nasopharyngeal carcinoma. New York: Gustav Fischer Verlag Stuttgart. Vol 5, p205-211. Chen JY, Liu MY, Chen CJ, Hsu MM, Tu SM, Lee HH, Kuo SL, Yang CS. 1985. Antibody to Epstein-Barr virus-specific DNase as a marker for the early detection of nasopharyngeal carcinoma. J Med Virol. 17(1):47-49. Cheung ST, Huang DP, Hui AB, Lo KW, Ko CW, Tsang YS, Wong N, Whitney BM, Lee JC. 1999. Nasopharyngeal carcinoma cell line (C666-1) consistently harbouring Epstein-Barr virus. Int J Cancer. 83(1):121-126. Chow LS, Lo KW, Kwong J, To KF, Tsang KS, Lam CW, Dammann R, Huang DP. 2004. RASSF1A is a target tumorsuppressor from 3p21.3 in nasopharyngeal carcinoma. Int. J Cancer. 109(6): 839-847. Cochet C, Martel-Renoir D, Grunewald V, Bosq J, Cochet G, Schwaab G, Bernaudin JF, Joab I. 1993. Expression of the Epstein-Barr virus immediate early gene, BZLF1, in nasopharyngeal carcinoma tumor cells. Virology. 197(1):358-365. Coffin WF, Erickson KD, Hoedt-Miller M, Martin JM. 2001. The cytoplasmic amino-terminus of the Latent Membrane Protein-1 of Epstein-Barr Virus: relationship between transmembrane orientation and effector functions of the carboxy-terminus and transmembrane domain. Oncogene. 20(38):5313-5330. Cordier-Bussat M. Billaud, M. Calender A. Lenoir GM. 1993. Epstein-Barr virus (EBV) nuclear-antigen-2-induced up-regulation of CD21 and CD23 molecules is dependent on a permissive cellular context. Int. J. Cancer 53(1):153-160. - 96 - References Crawford DH, Ando I. 1986. EB virus induction is associated with B-cell maturation. Immunology. 59(3):405-409. Crook T, Nicholls JM, Brooks L, O’Nions J, Allday MJ. 2000. High level expression of deltaN-p63: a mechanism for the inactivation of p53 in undifferentiated nasopharyngeal carcinoma(NPC)? Oncogene. 19(30):3439-3444. Curran JA, Laverty FS, Campbell D, Macdiarmid J, Wilson JB. 2001. Epstein-Barr virus encoded latent membrane protein-1 induces epithelial cell proliferation and sensitizes transgenic mice to chemical carcinogenesis. Cancer Res. 61(18):6730-6738. Cvitkovic E. 1997. UCNT: chemocurable sometimes, but not very often. Ann Oncol. 8(8):723-725. Dawson CW, Tramountanis G, Eliopoulos AG, Young LS. 2003. Epstein-Barr virus latent membrane protein 1 (LMP1) activates the phosphatidylinositol 3-kinase/Akt pathway to promote cell survival and induce actin filament remodeling. J Biol Chem. 278(6):3694-3704. de Jesus O, Smith PR, Spender LC, Elgueta Karstegl C, Niller HH, Huang D, Farrell PJ. 2003. Updated Epstein-Barr virus (EBV) DNA sequence and analysis of a promoter for the BART (CST, BARF0) RNAs of EBV. J Gen Virol. 84(6):1443-1450. de-Vathaire F, Sancho-Garnier H, de-The H, Pieddeloup C, Schwaab G, Ho JH, Ellouz R, Micheau C, Cammoun M, Cachin Y, et al. 1988. Prognostic value of EBV markers in the clinical management of nasopharyngeal carcinoma (NPC): a multicenter follow-up study. Int J Cancer. 42(2):176-181. Deaussin, G., F. Sbih-Lammali, M. De Turenne-Tessier, A. M. Bouguermouh, and T. Ooka. 2000. Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Res. 60(19):5584-5588. Decaussin G, Leclerc V, Ooka T. 1995. The lytic cycle of Epstein-Barr virus in the nonproducer Raji line can be rescued by the expression of a 135-kilodalton protein encoded by the BALF2 open reading frame. J Virol. 69(11):7309-7314. Decaussin, G, Sbih-Lammali F, de Turenne-Tessier M, Bouguermouh A, Ooka T. 2000. Expression of BARF1 gene encoded by Epstein-Barr virus in nasopharyngeal carcinoma biopsies. Cancer Res. 60(19):5584-5588. - 97 - References Deng YF, Tian F, Lu YD, Chen ZC, Xie DH, Yang XM, Shao XY. 2001. Mutation and abnormal expression of fragile histidine triad gene in nasopharyngeal carcinoma. Laryngoscope 111(9):1589-1592. Devergne O, Hatzivassiliou E, Izumi KM, Kaye KM, Kleijnen MF, Kieff E, Mosialos G. 1996. Association of TRAF1, TRAF2, and TRAF3 with an Epstein-Barr virus LMP1 domain important for B-lymphocyte transformation: role in NF-kappaB activation. Mol Cell Biol. 16(12):7098-7108. Drouet E, Brousset P, Fares F, Icart J, Verniol C, Meggetto F, Schlaifer D, Desmorat-Coat H, Rigal-Huguet F, Niveleau A, Delsol G. 1999. High Epstein-Barr virus serum load and elevated titers of anti-ZEBRA antibodies in patients with EBV-harboring tumor cells of Hodgkin's disease. J Med Virol. 57(4):383-389. Farrell PJ, Rowe DT, Rooney CM, Kouzarides T. 1989. Epstein-Barr virus BZLF1 trans-activator specifically bind to a consensus AP-1 site and is related to c-fos. EMBO J. 8(1):127-132. Farrow DC, Vaughan TL. Berwick M, Lynch CF, Swanson GM, Lyon JL. 1998. Diet and nasopharyngeal cancer in a low-risk population. Int J Cancer. 78(6):675-679. Faulkner GC, Burrows SR, Khanna R, Moss DJ, Bird AG, Crawford DH. 1999. X-linked agammaglobulinemoia patients are not infected with Epstein-Barr virus: Implication for the biology of the virus. J. Virol. 73(2):1555-1564. Feederle R, Kost M, Baumann M, Janz A, Drouet E, Hammerschmidt W, Delecluse HJ. 2000. The Epstein-Barr virus lytic program is controlled by the co-operative functions of two transactivators. EMBO J. 19(12):3080-3089. Feng P, Ren EC, Liu D, Chan SH, Hu H. 2000. Expression of Epstein-Barr virus lytic gene BRLF1 in nasopharyngeal carcinoma: potential use in diagnosis. J Gen Virol. 81(10):2417-2423. Frech B, Zimber-Strobl U, Yip TT, Lau WH, Mueller-Lantzsch N. 1993. Characterization of the antibody response to the latent infection terminal proteins of Epstein-Barr virus in patients with nasopharyngeal carcinoma. J Gen Virol. 74 (5):811-818. Freeman WM, Walker SJ, Vrana KE. 1999. Quantitative RT-PCR: pitfalls and potential. Biotechniques 26(1):112-122, 124-125. - 98 - References Fresen KO, Cho MS, zur Hausen H. 1978. Recovery of transforming EBV from non-producer cells after superinfection with non-transforming P3HR-1 EBV. Int J Cancer. 22(4):378-383. Fries KL, Sculley TB, Webster-Cyriaque J, Rajadurai P, Sadler RH, Raab-Traub N. 1997. Identification of a novel protein encoded by the BamHI A region of the Epstein-Barr virus. J Virol. 71(4):2765-2771. Gilligan KJ, Rajadurai P, Lin JC, Busson P, Abdel-Hamid M, Prasad U, Tursz T, Raab-Traub N. 1991. Expression of the Epstein-Barr virus BamHI A fragment in nasopharyngeal carcinoma: evidence for a viral protein expressed in vivo J Virol. 65(11):6252-6259. Gires O, Kohlhuber F, Kilger E, Baumann M, Kieser A, Kaiser C, Zeidler R, Scheffer B, Ueffing M, Hammerschmidt W 1999. Latent membrane protein 1 of Epstein-Barr virus interacts with JAK3 and activates STAT proteins. EMBO J. 18(11):3064-3073. Greenspan JS, Greenspan D, Lennette ET, Abrams DI, Conant MA, Petersen V, Freese UK. 1985. Replication of Epstein-Barr virus within the epithelial cells of oral “hairy” leukoplakia, an AIDS-associated lesion. N. Engl. J. Med. 313(25): 1564-1571. Gruffat H, Batisse J, Pich D, Neuhierl B, Manet E, Hammerschmidt W, Sergeant A. 2002. Epstein-Barr virus mRNA export factor EB2 is essential for production of infectious virus. J. Virol. 76(19):9635-9644. Gulley ML, Nicholls JM, Schneider BG, Amin MB, RoJY, Geradts J. 1998. Nasopharyngeal carcinomas frequently lack the p16/MTS1 tumour suppressor protein but consistently express the retinoblastoma gene product. Am J Pathol. 152(4):865- 869. Gutsch DE, Marcu KB, Kenney SC. 1994. The Epstein-Barr virus BRLF1 gene product transactivates the murine and human c-myc promoters. Cell Mol Biol 40(6): 747-760. Hammerschmidt W, Sugden B. 1988. Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein-Barr virus. Cell. 55(3):427-433. Han I, Harada S, Weaver D, Xue Y, Lane W, Orstavik S, Skalhegg B, Kieff E. 2001. EBNA-LP associates with cellular proteins including DNA-PK and HA95. J. Virol. 75(5):2475-2481. - 99 - References Henderson S, Huen D, Rowe M, Dawson C, Johnson G, Rickinson A. 1993. Epstein-Barr virus-coded BHRF1 protein, a viral homologue of Bcl-2, protects human B cells from programmed cell death. Proc Natl Acad Sci U S A. 90(18): 8479-8483. Henle W, Henle G, Ho HC, Burtin P, Cachin Y, Clifford P, de Schryver A, de-The G, Diehl V, Klein G. 1970. Antibodies to Epstein-Barr virus in nasopharyngeal carcinoma, other head and neck neoplasms, and control groups. J Natl Cancer Inst. 44(1):225-231. Herbst H, Stein H, Niedobitek G. 1993. Epstein-Barr virus and CD30+ malignant lymphomas. Crit Rev Oncog. 4(2):191-239. Hildesheim A, Anderson LM, Chen CJ, Cheng YJ, Brinton LA, Daly AK, Reed CD, Chen IH, Caporaso NE, Hsu MM, Chen JY, Idle JR, Hoover RN, Yang CS, Chhabra SK. 1997. CYP2E1 genetic polymorphisms and risk of nasopharyngeal carcinoma in Taiwan. J Natl Cancer Inst. 89(16):1207-1212. Hinuma Y, Grace JT Jr. 1967. Cloning of immunoglobulin-producing human leukemic and lymphoma cells in long-term cultures. Proc Soc Exp Biol Med. 124(1):107-111. Hitt MM, Allday MJ, Hara T, Karran L, Jones MD, Busson P, Tursz T, Ernberg I, Griffin BE. 1989. EBV gene expression in an NPC-related tumour. EMBO J. 8(9):2639-2651. Hochberg D, Middeldorp JM, Catalina M, Sullivan JL, Luzuriaga K, Thorley-Lawson DA. 2004. Demonstration of the Burkitt's lymphoma Epstein-Barr virus phenotype in dividing latently infected memory cells in vivo. Proc Natl Acad Sci U S A. 101(1):239-244. Hsieh JJ, Hayward SD. 1995. Masking of the CBF1/RBPJ kappa transcriptional repression domain by Epstein-Barr virus EBNA2. Science. 268(5210):560-563. Hsieh JJ, Henkel T, Salmon P, Robey E, Peterson MG, Hayward SD.1996. Truncated mammalian Notch1 activates CBF1/RBPJk-repressed genes by a mechanism resembling that of Epstein-Barr virus EBNA2. Mol Cell Biol. 16(3):952-959. Hsieh JJ, Zhou S, Chen L, Young DB, Hayward SD. 1999. CIR, a corepressor linking the DNA binding factor CBF1 to the histone deacetylase complex. Proc Natl Acad Sci U S A. 96(1):23-28. - 100 - References Hudewentz J, Bornkamm GW, Zur Hausen H. 1980. Effect of the diterpene ester TPA on Epstein-Barr virus antigen- and DNA synthesis in producer and nonproducer cell lines. Virology. 100(1):175-178. Hui AB, Lo KW, Leung SF, Teo P, Fung MKF, To KF, Wong N, Choi PHK, Lee JCK, Huang DP. 1999. Detection of recurrent chromosomal gains and losses in primary nasopharyngeal carcinoma by comparative genomic hybridization. Int J Cancer. 82(4):498-503. Hui AB, Lo KW, Teo PM, To KF, Huang DP. 2002. Genome-wide detection of oncogene amplifications in nasopharyngeal carcinoma by array-based comparative genomic hybridization. Int J Oncol. 20(3):467-473. Hui AB, Lo KW, Kwong J, Teo PM, Lam EC, Chan YY, To KF, Chow LS, Chan AS, Huang DP. 2003. Silencing of TSLC1 gene expression by promoter hypermethylation in nasopharyngeal carcinoma. Mol Carcinogenesis. 38(4):170-178. Hummel M, Kieff E. 1982. Epstein-Barr virus RNA. VIII. Viral RNA in permissively infected B95-8 cells. J Virol. 43(1):262-272. Jarriault S, Brou C, Logeat F, Schroeter EH, Kopan R, Israel A. 1995. Signalling downstream of activated mammalian Notch. Nature. 377(6547):355-358. Jeang KT, Hayward SD. 1983. Organization of the Epstein-Barr virus DNA molecule. III. Location of the P3HR-1 deletion junction and characterization of the NotI repeat units that form part of the template for an abundant 12-O-tetradecanoylphorbol-13-acetate-induced mRNA transcript. J Virol. 48(1):135-148. Joab I, Nicolas JC, Schwaab G, de-The G, Clausse B, Perricaudet M, Zeng Y. 1991. Detection of anti-Epstein-Barr-virus transactivator (ZEBRA) antibodies in sera from patients with nasopharyngeal carcinoma. Int J Cancer. 48(5):647-649. Jochner N, Eick D, Zimber-Strobl U, Pawlita M, Bornkamm GW, Kempkes B. 1996. Epstein-Barr virus nuclear antigen 2 is a transcriptional suppressor of the immunoglobulin mu gene: implications for the expression of the translocated c-myc gene in Burkitt's lymphoma cells. EMBO J. 15(2):375-382. - 101 - References Jones JF, Shurin S, Abramowsky C, Tubbs RR, Sciotto CG, Wahl R, Sands J, Gottman D, Katz BZ, Sklar J. 1988. T-cell lymphomas containing Epstein-Barr viral DNA in patients with chronic Epstein-Barr virus infections. N Engl J Med. 318(12):733-741. Joseph AM. Babcock GJ. Thorley-Lawson DA. 2000. Cells expressing the Epstein-Barr virus growth program are present in and restricted to the naive B-cell subset of healthy tonsils. J Virol. 74(21):9964-9971. Kaiser C, Laux G, Eick D, Jochner N, Bornkamm GW, Kempkes B. 1999. The proto-oncogene c-myc is a direct target gene of Epstein-Barr virus nuclear antigen 2. J Virol. 73(5):4481-4484. Kaye KM, Izumi KM, Kieff E. 1993. Epstein-Barr virus latent membrane protein 1 is essential for B-lymphocyte growth transformation. Proc Natl Acad Sci U S A. 90(19):9150-9154. Kaykas A, Worringer K, Sugden B. 2002. LMP-1's transmembrane domains encode multiple functions required for LMP-1's efficient signaling. J Virol. 76(22):11551-11560. Kenney S, Kamine J, Holley-Guthrie E, Lin JC, Mar EC, Pagano J. 1989. The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J Virol. 63(4):1729-1736. Khanna R., Burrows S.R., and Moss D. J. 1995. Immune regulation in Epstein-Barr virus-associated diseases. Microbiol Rev. 59 (3):387-405. Kieff E. and Rickinson A. Epstein-Barr Virus and Its Replication. 2001. In: David M. Knipe, Peter M. Howley, eds. Fundamental virology, 4th ed. Philadelphia: Lippincott Williams & Wilkins, p.1185-1248. Kilger E., Kieser A., Baumann M., Hammerschmidt W. 1998. Epstein-Barr virus-mediated B-cell proliferation is dependent upon latent membrane protein 1, which simulates an activated CD40 receptor. EMBO J. 17(6):1700-1709. King W, Dambaugh T , Heller M, Dowling J, and Kieff E. 1982. Epstein-Barr virus DNA XII. A variable region of the Epstein-Barr virus genome is included in the P3HR-1 deletion. J Virol. 43(3):979-986. Knowles DM. 1998. The molecular genetics of post-transplantation lymphoproliferative disorders. Springer Semin Immunopathol. 20(3-4):357-373. - 102 - References Knowles DM. 1999. Immunodeficiency-associated lymphoproliferative disorders. Mod Pathol. 12(2):200-217. Komano J, Sugiura M, Takada K. 1998. Epstein-Barr virus contributes to the malignant phenotype and to apoptosis resistance in Burkitt's lymphoma cell line Akata. J Virol. 72(11):9150-9156. Krueger GR, Kottaridis SD, Wolf H, Ablashi DV, Sesterhenn K, Bertram G. 1981. Histological types of nasopharyngeal carcinoma as compared to EBV serology. Anticancer Res. 1(4):187-194. Kurakata S, Ramos OF, Klein G, Klein E. 1989. Lysis of P3HR-1 cells induced to enter the viral cycle by antibody-dependent and independent immunological mechanisms. Cell Immunol. 123(1):134-147. Kwong J, Lo KW, To KF, Teo PM, Johnson PJ, Huang DP. 2002. Promoter hypermethylation of multiple genes in nasopharyngeal carcinoma. Clin Cancer Res. 8(1):131-137. Lai JP, Tong CL, Hong C, Xiao JY, Tao ZD, Zhang Z, Tong WM, Betz CS. 2002. Association between high initial tissue levels of cyclin D1 and recurrence of nasopharyngeal carcinoma. Laryngoscope. 112(2):402-408. Laux G, Freese UK, Bornkamm GW. 1985. Structure and evolution of two related transcription units of Epstein-Barr virus carrying small tandem repeats. J Virol. 56(3):987-995. Lee MA, Yates JL. 1992. BHRF1 of Epstein-Barr virus, which is homologous to human proto-oncogene bcl2, is not essential for transformation of B cells or for virus replication in vitro. J. Virol. 66(4):1899-1906. Levitskaya J, Coram M, Levitsky V, Imreh S, Steigerwald-Mullen PM, Klein G, Kurilla MG, Masucci MG. 1995. Inhibition of antigen processing by the internal repeat region of the Epstein-Barr virus nuclear antigen-1. Nature. 375(6533):685-688. Lieberman PM, Hardwick JM, Hayward SD. 1989. Responsiveness of the Epstein-Barr virus NotI repeat promoter to the Z transactivator is mediated in a cell-type-specific manner by two independent signal regions. J Virol. 63(7):3040-3050. Lin CT, Lin CR, Tan GK, Chen W, Dee AN, Chan WY. 1997. The mechanism of Epstein-Barr virus infection in nasopharyngeal carcinoma cells. Am J Pathol. 150(5):1745-1756. - 103 - References Lin LS, Ro LH, Lo MS, Huang WL, Ma J, Chang TH, Shu CH, Chow KC, Liu WT, Chen KY, et al. 1995. Expression of the Epstein-Barr virus DNA polymerase in Escherichia coli for use as antigen for the diagnosis of nasopharyngeal carcinoma. J Med Virol. 45(1):99-105. Littler E, Newman W, Arrand JR. 1990. Immunological response of nasopharyngeal carcinoma patients to the Epstein-Barr-virus-coded thymidine kinase expressed in Escherichia coli. Int J Cancer. 45(6):1028-1032. Littler E, Baylis SA, Zeng Y, Conway MJ, Mackett M, Arrand JR. 1991. Diagnosis of nasopharyngeal carcinoma by means of recombinant Epstein-Barr virus proteins. Lancet. 337(8743):685-689. Liu MY, Chang YL, Ma J, Yang HL, Hsu MM, Chen CJ, Chen JY, Yang CS. 1997. Evaluation of multiple antibodies to Epstein-Barr virus as markers for detecting patients with nasopharyngeal carcinoma. J Med Virol. 52(3):262-269. Lo K, Huang PW, Lee CK. 1997. Genetic changes in nasopharyngeal carcinoma. Chin Med J (Engl). 110(7):548-559. Lo KW, Hung DP, Lau KM. 1995. p16 gene alterations in nasopharyngeal carcinoma. Cancer Res. 55(10):2039-2043. Lo KW, Teo PM, Hui AB, To KF, Tsang YS, Chan SY, Mak KF, Lee JC, Huang DP. 2000. High-resolution allelotype of microdissected primary nasopharyngeal carcinoma. Cancer Res. 60(13):3348-3353. Lo KW, Tsang YS, Kwong J, To KF, Teo PM, Huang DP. 2002. Promoter hypermethylation of the EDNRB gene in nasopharyngeal carcinoma. Int J Cancer. 98(5):651-655. Longnecker R, Druker B, Roberts TM, Kieff E. 1991. An Epstein-Barr virus protein associated with cell growth transformation interacts with a tyrosine kinase. J Virol. 65(7):3681-3692. Lu CC, Chen JC, Jin YT, Yang HB, Chan SH, Tsai ST. 2003. Genetic susceptibility to nasopharyngeal carcinoma within the HLA-A locus in Taiwanese. Int. J. Cancer. 103(6):745-751. Lu QL, Elia G, Lucas S, Thomas JA. 1993. Bcl2 proto-oncogene expression in Epstein-Barr virus-associated nasopharyngeal carcinoma. Int J Cancer 53(1):29-35. - 104 - References Lu SJ, Day NE, Degos L, Lepage V, Wang PC, Chan SH, Simons M, McKnight B, Easton D, Zeng Y, et al. 1990. Linkage of a nasopharyngeal carcinoma susceptibility locus to the HLA region. Nature. 346(6283):470-471. Luka J, Deeb ZE, Hartmann DP, Jenson B, Pearson GR. 1988. Detection of antigens associated with Epstein-Barr virus replication in extracts from biopsy specimens of nasopharyngeal carcinomas. J Natl Cancer Inst. 80(14):1164-1167. Lukes RJ, Butler JJ. 1966. The pathology and nomenclature of Hodgkin’s disease. Cancer Res. 26(6): 1063-1081. MacLennan IC, Liu YL, Ling NR. 1988. B cell proliferation in follicles, germinal centre formation and the site of neoplastic transformation in Burkitt's lymphoma. Curr Top Microbiol Immunol. 141:138-148. Magrath I, Jain V, Bhatia K. 1992. Epstein-Barr virus and Burkitt’s lymphoma. Sem Cancer Biol 3(5):285-295. Mannick JB, Cohen JI, Birkenbach M, Marchini A, Kieff E. 1991. The Epstein-Barr virus nuclear protein encoded by the leader of the EBNA RNAs is important in B-lymphocyte transformation. J. Virol. 65(12):6826-6837. Mannick JB, Tong X, Hemnes A, Kieff E. 1995. The Epstein-Barr virus nuclear antigen leader protein associates with hsp72/hsc73. J. Virol. 69(12):8169-8172. Marafioti T, Hummel M, Anagnostopoulos I, Foss HD, Falini B, Delsol G, Isaacson PG, Pileri S, Stein H. 1997. Origin of nodular lymphocyte-predominant Hodgkin’s disease from a clonal expansion of highly mutated germinal-center B cells. New Engl J Med. 337(7): 453-458. Marks JE, Phillips JL, Menck HR. 1998. The National Cancer Data Base report on the relationship of race andnational origin to the histology of nasopharyngeal carcinoma. Cancer. 83(3): 582-588. Marschall M, Schwarzmann F, Leser U, Oker B, Alliger P, Mairhofer H, Wolf H. 1991. The BI'LF4 trans-activator of Epstein-Barr virus is modulated by type and differentiation of the host cell. Virology. 181(1): 172 - 179. Mathew A, Cheng HM, Sam CK, Joab I, Prasad U, Cochet C. 1994. A high incidence of serum IgG antibodies to the Epstein-Barr virus replication activator protein in nasopharyngeal carcinoma. Cancer Immunol Immunother. 38(1):68-70. - 105 - References Matsuda G, Nakajima K, Kawaguchi Y, Yamanashi Y, Hirai K. 2003. Epstein-Barr virus (EBV) nuclear antigen leader protein (EBNA-LP) forms complexes with a cellular anti-apoptosis protein Bcl-2 or its EBV counterpart BHRF1 through HS1-associated protein X-1. Microbiol Immunol. 47(1):91-99. Mazeron MC. 1996. Value of anti-Epstein-Barr antibody detection in the diagnosis and management of undifferentiated carcinoma of the nasopharynx. Bull Cancer Radiother. 83(1):3-7. Mellinghoff I, Daibata M, Humphreys RE, Mulder C, Takada K, Sairenji T. 1991. Early events in Epstein-Barr virus genome expression after activation: Regulation by second messengers of B cell activation. Virology 185(2):922-928. Miller CL, Lee JH, Kieff E, Longnecker R 1994. An integral membrane protein (LMP2) blocks reactivation of Epstein-Barr virus from latency following surface immunoglobulin crosslinking. Proc Natl Acad Sci U S A. 91(2):772-776. Miller IG Jr, El-Guindy A. 2002. Regulation of Epstein-Barr virus lytic cycle activation in malignant and nonmalignant disease. J Natl Cancer Inst. 94 (23): 1733-1735. Minarovits J, Hu LF, Imai S, Harabuchi Y, Kataura A, Minarovits-Kormuta S, Osato T, Klein G. 1994. Clonality, expression and methylation patterns of the Epstein-Barr virus genomes in lethal midline granulomas classified as peripheral angiocentric T cell lymphomas. J Gen Virol. 75(1):77-84. Molesworth SJ, Lake CM, Borza CM, Turk SM, Hutt-Fletcher LM 2000. Epstein-Barr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. J Virol. 74(14):6324-6332. Moore KW, Rousset F, Banchereau J. 1991. Evolving principles in immunopathology: interleukin 10 and its relationship to Epstein-Barr virus protein BCRF1. Springer Semin Immunopathol. 13(2):157-166. Morrison TE, Mauser A, Wong A, Ting JP, Kenney SC. 2001. Inhibition of IFN-gamma signaling by an Epstein-Barr virus immediate-early protein. Immunity. 15(5):787-799. Mueller N, Evans A, Harris NL, Comstock GW, Jellum E, Magnus K, Orentreich N, Polk BF, Vogelman J. 1989. Hodgkin's disease and Epstein-Barr virus. Altered antibody pattern before diagnosis. N Engl J Med. 320(11):689-695. Muir CS, 1992. Cancer Incidence in Five Continents, Classification. IARC Sci Publ. 120:25-30. - 106 - References Munoz N, Davidson RJ, Witthoff B, Ericsson JE, De-The G. 1978. Infectious mononucleosis and Hodgkin's disease. Int J Cancer. 22(1):10-13. Murray PG, Young LS. 2001. Epstein-Barr virus infection: basis of malignancy and potential for therapy. Expert Rev Mol Med. Nov 15:1-20. Nadala EC, Tan TM, Wong HM, Ting RC. 1996. ELISA for the detection of serum and saliva IgA against the BMRFI gene product of Epstein-Barr virus. J Med Virol. 50(1):93-96. Nalesnik M.A. 2002. Clinicopathologic characteristics of post-transplant lymphoproliferative disorders. Recent Results Cancer Res. 159:9–18. Niedobitek G, Agathanggelou A, Herbst H, Whitehead L, Wright DH, Young LS. 1997. Epstein-Barr virus (EBV) infection in infectious mononucleosis: Virus latency, replication and phenotype of EBV-infected cells. J. Pathol. 182(2):151-159. Niedobitek G, Agathanggelou A, Steven N, Young LS. 2000. Epstein-Barr virus (EBV) in infectious mononucleosis: detection of the virus in tonsillar B lymphocytes but not in desquamated oropharyngeal epithelial cells. Mol Pathol. 53(1):37-42. Ning JP, Yu MC, Wang QS, Henderson BE. 1990. Consumption of salted fish and other risk factors for nasopharyngeal carcinoma(NPC) in Tianjin, a low-risk region for NPC in the People’s Republic of China. J Natl Cancer Inst. 82(4):291-296. Nitsche F, Bell A, Rickinson A. 1997. Epstein-Barr virus leader protein enhances EBNA-2-mediated transactivation of latent membrane protein 1 expression: a role for the W1W2 repeat domain. J. Virol. 71(9):6619-6628. Nonkwelo C, Skinner J, Bell A, Rickinson A, Sample J. 1996. Transcription start sites downstream of the Epstein-Barr virus (EBV) Fp promoter in early-passage Burkitt lymphoma cells define a fourth promoter for expression of the EBV EBNA-1 protein. J Virol. 70(1):623-627. Nuebling CM, Mueller-Lantzsch N. 1989. Identification and characterization of an Epstein-Barr virus early antigen that is encoded by the NotI repeats. J Virol. 63(11):4609-4615. - 107 - References Old LJ, Boyse EA, Oettgen HF, De Harven E, Geering G, Williamson B, Clifford P. 1966. Precipating antibody in human serum to an antigen present in cultured Burkitt's lymphoma cells. Proc. Natl. Acad. Sci. USA 56(6):1699–1704. Oudejans JJ, van den Brule AJ, Jiwa NM, de Bruin PC, Ossenkoppele GJ, van der Valk P, Walboomers JM, Meijer CJ. 1995. BHRF1, the Epstein-Barr virus (EBV) homologue of the BCL-2 protooncogene, is transcribed in EBV-associated B-cell lymphomas and in reactive lymphocytes. Blood. 86(5):1893-1902. Pallesen G, Hamilton-Dutoit SJ, Rowe M, Young LS. 1991. Expression of Epstein-/Barr virus latent gene products in tumor cells of Hodgkin’s disease. Lancet. 337(8737): 320-322. Parker G.A., Touitou R. and Allday M.J. 2000. Epstein-Barr virus EBNA3C can disrupt multiple cell cycle checkpoints and induce nuclear division divorced from cytokinesis Oncogene, 19(5): 700-709. Patel M., Leevers S.J., Brickell P.M. 1990. Regulation of c-fgr proto-oncogene expression in Epstein-Barr virus infected B-cell lines. Int J Cancer. 45(2):342-346. Pathmanathan R, Prasad U, Sadler R, Flynn K, Raab-Traub N. 1995. Clonal proliferations of cells infected with Epstein-Barr virus in preinvasive lesions related to nasopharyngeal carcinoma. N Engl J Med. 333(11):693-698. Penn I, 1994. The problem of cancer in organ transplant recipients: an overview. Transplant. Sci. 4(1):23–32. Pfitzner AJ, Tsai EC, Strominger JL, Speck SH. 1987. Isolation and characterization of cDNA clones corresponding to transcripts from the BamHI H and F regions of the Epstein-Barr virus genome. J Virol. 61(9):2902-2909. Pingfan Liu and Samuel H. Speck 2003. Synergistic autoactivation of the Epstein-Barr virus immediate-early BRLF1 promoter by Rta and Zta. Virology. 310(2): 199-206. Poirier S, Bouvier G, Malaveille C, Ohshima H, Shao YM, Hubert A, Zeng Y, de The G, Bartsch H. 1989. Volatile nitrosamine levels and genotoxicity of food samples from high-risk areas for nasopharyngeal carcinoma before and after nitrosation. Int J Cancer. 44(6):1088-1094. - 108 - References Polack A, Delius H, Zimber U, Bornkamm GW. 1984. Two deletions in the Epstein-Barr virus genome of the Burkitt lymphoma nonproducer line Raji. Virology. 133(1):146-157. Porter MJ, Field JK, Leung SF, Lo D, Lee JC, Spandidos DA, van Hasselt CA. 1994. The detection of the c-myc and ras oncogens in nasopharyngeal carcinoma by immunohistochemistry. Acta Otolaryngol. 114(1):105-109. Ragoczy T, Heston L, Miller G. 1998. The Epstein-Barr virus Rta protein activates lytic cycle genes and can disrupt latency in B lymphocytes. J Virol. 72(10):7978-7984. Reddy SP, Raslan WF, Gooneratne S, Kathuria S, Marks JE. 1995. Prognostic significance of keratinization in nasopharyngeal carcinaoma. Am J Otolaryngol 16(2):103-108. Rickinson A and Kieff E. Epstein-Barr virus. 1996. In: Fields BN, Knipe DM, Howley PM, eds. Fields Virology, 3rd ed. Philadelphia: Lipponcot-Raven, p. 2397-2446. Robertson ES, Lin J, Kieff E. 1996. The amino-terminal domains of Epstein-Barr virus nuclear proteins 3A, 3B, and 3C interact with RBPJ(kappa). J Virol. 70(5):3068-3074. Rousset F, Garcia E, Defrance T, Peronne C, Vezzio N, Hsu DH, Kastelein R, Moore KW, Banchereau J. 1992. Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc Natl Acad Sci U S A. 89(5):1890-1893. Rowe DT, Rowe M, Evan GJ, Wallace LE, Farrell PJ, Rickinson AB. 1986. Restricted expression of EBV latent genes and T-lymphocyte-detected membrane antigen in Burkitt’s lymphoma cells. EMBO J. 5(10):2599-2607. Ruvolo V, Wang E, Boyle S, Swaminathan S. 1998. The Epstein-Barr virus nuclear protein SM is both a posttranscriptional inhibitor and activator of gene expression. Proc Natl Acad Sci U S A. 95(15):8852-8857. Ruvolo V, Gupta AK, Swaminathan S. 2001. Epstein-Barr virus SM protein interacts with mRNA in vivo and mediates a gene-specific increase in cytoplasmic mRNA. J. Virol. 75(13):6033-6041. Ruvolo V, Navarro L, Sample CE, David M, Sung S, Swaminathan S. 2003. The Epstein-Barr virus SM protein induces STAT1 and interferon-stimulated gene expression. J. Virol. 77(6):3690-3701. - 109 - References Sadler RH, Raab-Traub N. 1995. Structural analyses of the Epstein-Barr virus BamHI A transcripts. J Virol. 69(2):1132-1141. Sample J, Hummel M, Braun D, Birkenbach M, Kieff E. 1986. Nucleotide sequences of mRNAs encoding Epstein-Barr virus nuclear proteins: a probable transcriptional initiation site. Proc Natl Acad Sci U S A. 83(14):5096-5100. Sbih-Lammali F, Berger F, Busson P, Ooka T. 1996. Expression of the DNase encoded by the BGLF5 gene of Epstein-Barr virus in nasopharyngeal carcinoma epithelial cells. Virology. 222(1):64-74. Scholle F, Longnecker R, Raab-Traub N. 1999. Epithelial cell adhesion to extracellular matrix proteins induces tyrosine phosphorylation of the Epstein-Barr virus latent membrane protein 2: a role for C-terminal Src kinase. J Virol. 73(6):4767-4775. Segouffin-Cariou C, Farjot G, Sergeant A, Gruffat H. 2000. Characterization of the Epstein-/Barr virus BRRF1 gene, located between early genes BZLF1 and BRLF1. J Gen Virol. 81(7):1791-/1799. Sham JS, Wei WI, Kwan WH, Chan CW, Kwong WK, Choy D. 1990. Nasopharyngeal carcinoma. Pattern of tumor regression after radiotherapy. Cancer. 65(2):216-220. Shao YM, Poirier S, Ohshima H, Malaveille C, Zeng Y, de The G, Bartsch H. 1988. Epstein-Barr virus activation in Raji cells by extracts of preserved food from high risk areas for nasopharyngeal carcinoma. Carcinogenesis. 9(8):1455-1457. Sheng W, Decaussin G, Sumner S, Ooka T. 2001. N-terminal domain of BARF1 gene encoded by Epstein-Barr virus is essential for malignant transformation of rodent fibroblasts and activation of BCL-2. Oncogene. 20(10):1176-1185. Sheu LF, Chen A, Meng CL, Ho KC, Lee WH, Leu FJ, Chao CF. 1996. Enhanced malignant progression of nasopharyngeal carcinoma cells mediated by the expression of Epstein-Barr nuclear antigen 1 in vivo. J Pathol. 180(3):243-248. Shimizu N, Tanabe-Tochikura A, Kuroiwa Y, Takada K. 1994. Isolation of Epstein-Barr virus (EBV)-negative cell clones from the EBV-positive Burkitt's lymphoma (BL) line Akata: malignant phenotypes of BL cells are dependent on EBV. J Virol. 68(9):6069-6073. - 110 - References Sinclair AJ, Brimmell M, Farrell PJ. 1992. Reciprocal antagonism of steroid hormones and BZLF1 in switch between Epstein-Barr virus latent and productive cycle gene expression. J Virol. 66(1):70-77. Sinclair AJ, Palmero I, Peters G, Farrell PJ. 1994. EBNA-2 and EBNA-LP cooperate to cause G0 to G1 transition during immortalization of resting human B lymphocytes by Epstein-Barr virus. EMBO J. 13(14):3321-3328. Sixby JW, Yao QY. 1992. Immunoglobulin A-induced shift of Epstein-Barr virus tissue tropism. Science. 255(5051):1578-1580. Skinner DW, Van Hasselt CA, Tsao SY. 1991. Nasopharyngeal carcinoma: modes of presentation. Ann Otol Rhinol Laryngol. 100(7):544-551. Smith P. 2001 Epstein-Barr virus complementary strand transcripts (CSTs/BARTs) and cancer. Semin Cancer Biol. 11(6):469-476. Spano JP, Busson P, Atlan D, Bourhis J, Pignon JP, Esteban C, Armand JP. 2003. Nasopharyngeal carcinomas: an update. Eur J Cancer. 39(15):2121-2135. Spano JP, Busson P, Atlan D, Bourhis J, Pignon JP, Esteban C, Armand JP. 2003. Nasopharyngeal carcinomas: an update. Eur J Cancer. 39(15):2121-2135. Speck P, Kline KA, Cheresh P, Longnecker R. 1999. Epstein-Barr virus lacking latent membrane protein 2 immortalizes B cells with efficiency indistinguishable from that of wild-type virus. J Gen Virol. 80 (8):2193-2203. Strockbine LD, Cohen JI, Farrah T, Lyman SD, Wagener F, DuBose RF, Armitage RJ, Spriggs MK. 1998. The Epstein-Barr virus BARF1 gene encodes a novel, soluble colony-stimulating factor-1 receptor. J Virol. 72(5):4015-4021. Subar M, Neri A, Inghirami G, Knowles DM, Dalla-Favera R. 1988. Frequent c-myc oncogene activation and infrequent presence of Epstein-Barr virus genome in AIDS-associated lymphoma. Blood. 72(2):667-671. Sung NS, Kenney S, Gutsch D, Pagano JS. 1991. EBNA-2 transactivates a lymphoid-specific enhancer in the BamHI C promoter of Epstein-Barr virus. J Virol. 65(5):2164-2169. Swaminathan, S.,Tomkinson, B., and Kieff, E. 1991. Recombinant Epstein-Barr virus with small RNA (EBER) gene transform lymphocytes and replicates in vitro. Proc Natl Acad Sci U S A. 88(4):1546-1550. - 111 - References Szekely L, Selivanova G, Magnusson KP, Klein G, Wiman KG. 1993. EBNA-5, an Epstein-Barr virus-encoded nuclear antigen, binds to the retinoblastoma and p53 proteins. Proc Natl Acad Sci U S A. 90(12):5455-5459. Takada K, Shimizu N, Sakuma S, Ono Y. 1986. trans activation of the latent Epstein-Barr virus (EBV) genome after transfection of the EBV DNA fragment. J Virol. 57(3):1016-1022. Tanner JE, Wei MX, Alfieri C, Ahmad A, Taylor P, Ooka T, Menezes J. 1997 Antibody and antibody-dependent cellular cytotoxicity responses against the BamHI A rightward open-reading frame-1 protein of Epstein-Barr virus (EBV) in EBV-associated disorders. J Infect Dis. 175(1):38-46. Thompson MP, Kurzrock R. 2004. Epstein-Barr virus and cancer. Clin Cancer Res. 10(3):803-821. Tomkinson B, Robertson E, Kieff E. 1993. Epstein-Barr virus nuclear proteins EBNA-3A and EBNA-3C are essential for B-lymphocyte growth transformation. J Virol. 67(4):2014-2025. Thorley-Lawson DA, Gross A. 2004. Persistence of the Epstein-Barr virus and the origins of associated lymphomas. N Engl J Med. 350(13):1328-1337. van Grunsven WM, Nabbe A, Middeldorp JM. 1993. Identification and molecular characterization of two diagnostically relevant marker proteins of the Epstein-Barr virus capsid antigen complex. J Med Virol. 40(2):161-169. Vieira P, de Waal-Malefyt R, Dang MN, Johnson KE, Kastelein R, Fiorentino DF, deVries JE, Roncarolo MG, Mosmann TR, Moore KW. 1991. Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein-Barr virus open reading frame BCRFI. Proc Natl Acad Sci U S A. 88(4):1172-1176. Vokes EE, Liebowitz DN, Weichselbaum RR. 1997. Nasopharyngeal carcinoma. Lancet. 350(9084):1087-1091. Wagner HJ, Bein G, Bitsch A, Kirchner H. 1992. Detection and quantification of latently infected B lymphocytes in Epstein-Barr virus-seropositive, healthy individuals by polymerase chain reaction. J Clin Microbiol. 30(11): 2826–2829. Wei MX, Ooka T. 1989. A transforming function of the BARF1 gene encoded by Epstein-Barr virus. EMBO J. 8(10):2897-2903. - 112 - References Wei MX, de Turenne-Tessier M, Decaussin G, Benet G, Ooka T. 1997. Establishment of a monkey kidney epithelial cell line with the BARF1 open reading frame from Epstein-Barr virus. Oncogene 14(25):3073-3081. Weigel R, Miller G. 1983 Major EB virus-specific cytoplasmic transcripts in a cellular clone of the HR-1 Burkitt lymphoma line during latency and after induction of viral replicative cycle by phorbol esters. Virology. 125(2):287-298. Weiss LM, Jaffe ES, Liu XF, Chen YY, Shibata D, Medeiros LJ. 1992. Detection and localization of Epstein-Barr viral genomes in angioimmunoblastic lymphadenopathy and angioimmunoblastic lymphadenopathy-like lymphoma. Blood. 79(7):1789-1795. Wu TC, Mann RB, Epstein JI, MacMahon E, Lee WA, Charache P, Hayward SD, Kurman RJ, Hayward GS, Ambinder RF. 1991. Abundant expression of EBER1 small nuclear RNA in nasopharyngeal carcinoma. A morphologically distinctive target for detection of Epstein-Barr virus in formalin-fixed paraffin-embedded carcinoma specimens. Am J Pathol. 138(6):1461-1469. Xu J, Ahmad A, D'Addario M, Knafo L, Jones JF, Prasad U, Dolcetti R, Vaccher E, Menezes J. 2000. Analysis and significance of anti-latent membrane protein-1 antibodies in the sera of patients with EBV-associated diseases. J Immunol. 164(5):2815-2822. Xue SA, Lu QL, Poulsom R, Karran L, Jones MD, Griffin BE. 2000. Expression of two related viral early genes in Epstein-Barr virus-associated tumors. J Virol. 74(6):2793-2803. Yajima T, Yagihashi A, Kameshima H, Kobayashi D, Furuya D, Hirata K, Watanabe N. 1998 Quantitative reverse transcription-PCR assay of the RNA component of human telomerase using the TaqMan fluorogenic detection system. Clin Chem. 44(12):2441-2245. Yamamoto M, Tabata T, Smith M, Tanaka A, Nonoyama M. 1989. Cycloheximide-resistant gene of Epstein-Barr virus in freshly infected B lymphocytes. Virology. 170(1):307-310. Yao QY, Rickinson AB, Epstein MA. 1985. A re-examination of the Epstein-Barr virus carrier state in healthy seropositive individuals. Int. J. Cancer. 35(1):35-42. - 113 - References Young L, Alfieri C, Hennessy K, Evans H, O'Hara C, Anderson KC, Ritz J, Shapiro RS, Rickinson A, Kieff E, et al. 1989. Expression of Epstein- Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease. New Engl J Med 321(16):1080-1085. Young LS, Dawson CW, Clark D, Rupani H, Busson P, Tursz T, Johnson A, Rickinson AB. 1988. Epstein-Barr virus gene expression in nasopharyngeal carcinoma. J Gen Virol. 69 (5):1051-1065. Young LS, Dawson CW, Eliopoulos AG. 2000. The expression and function of Epstein-Barr virus encoded latent genes. Mol Pathol. 53(5):238-247. Yu MC, Ho JH, Lai SH, Henderson BE. 1986. Cantonese-style salted fish as a cause of nasopharyngeal carcinoma: report of a case-control study in Hong Kong. Cancer Res. 46(2):956-961. Yu MC, Mo CC, Chong WX, Yeh FS, Henderson BE. 1988. Preserved foods and nasopharyngeal carcinoma: a case-control study in Guangzhou, China. Cancer Res. 48(7):1954-1959. Yu MC, Nichols PW, Zou XN, Estes J, Henderson BE. 1989. Induction of malignant nasal cavity tumours in Wistar rats fed Chinese salted fish. Br J Cancer. 60(2):198-201. Zalani S, Holley-Guthrie E, Kenney S. 1996. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism. Proc Natl Acad Sci U S A. 93(17):9194-9199. Zeng Y. 1985. Seroepidemiological studies on nasopharyngeal carcinoma in China. Adv Cancer Res. 44:121-138. Zeng Y, Zhong JM, Ye SQ, Ni ZY, Miao XQ, Mo YK, Li ZL. 1994. Screening of Epstein-Barr virus early antigen expression inducers from Chinese medicinal herbs and plants. Biomed Environ Sci. 7(1):50-55. Zhao B, Sample CE 2000. Epstein-barr virus nuclear antigen 3C activates the latent membrane protein 1 promoter in the presence of Epstein-Barr virus nuclear antigen 2 through sequences encompassing an spi-1/Spi-B binding site. J Virol. 74(11):5151-5160. Zong YS, Sham JS, Ng MH, Ou XT, Guo YQ, Zheng SA, Liang JS, Qiu H. 1992. Immunoglobulin A against viral capsid antigen of Epstein-Barr virus and indirect mirror examination of the nasopharynx in the detection of asymptomatic nasopharyngeal carcinoma. Cancer. 69(1):3-7. - 114 - References zur Hausen H, Schulte-Holthausen H, Klein G, Henle W, Henle G, Clifford P, Santesson L. 1970. EBV DNA in biopsies of Burkitt tumours and anaplastic carcinomas of the nasopharynx. Nature. 228(276):1056-10058. zur Hausen H, O'Neill FJ, Freese UK, Hecker E. 1978 Persisting oncogenic herpesvirus induced by the tumour promotor TPA. Nature. 272(5651):373-375. - 115 - APPENDIX - 116 - Appendix Appendix 1: Sequences of oligonucleotide primers No. Gene name Genome Oligonucleotide Sequence Coordinates 1 GAPDH 5’primer 5’ACGCCTGCTTCACCACCTTCT TG3’ 3’primer 5’GGAGCCAAAAGGGTCATCAT CTCTG3’ 2 BNRF1 5’primer 4671-4692 5’TGCTGCTGGGAACCTGGTCAT C3’ 3’primer 5382-5359 5’TTAGTAAATTGCAGGCCCAGG CAC3’ 3 BCRF1 5’primer 9712-9734 5’TGCTGCTTTACCTGGCACCTG AG3’ 3’primer 10221-10198 5’TGCACCCATCTCCTGCTTCCA GGG3’ 4 BCRF2 5’primer 46753-46774 5’CAGGCCCCAGAGTCCAGAGG TC3’ 3’primer 47303-47282 5’GGAGAAAAGCTGGCGCCCTT GC3’ 5 EBNA-LP 5’primer 47761-47780 (SJ) 5’CCACTACGGCCACGTCCCCG3 ’ 3’primer 47947-47925 5’ATTGGCGCTGGGTGGTTACTG TG3’ 6 EBNA2 3’ 5’primer 48815-48837 5’TGCCTGGACACAAGAGCCAT CAC3’ 3’primer 49520-49496 5’CTGGCCTTGAGTCTTAGAGGG TTGC3’ 7 BHLF1 5’primer 50325-50352 5’GGCTGCTTTTAGCCTAATTGT GTATTGC3’ 3’primer 50561-50540 5’CTGCCCATGGAATGCTCAGAC C3’ 8 BHRF1(SJ) 5’primer 53835-53858 5’GGTTTCGTCTGTGTGTTGAAG GGC3’ 3’primer 54830-54808 5’GTAGACCAGCCGCCCTGTTGA TG3’ 9 EBNA2(SJ) 5’primer 47761-47780 5’CCACTACGGCCACGTCCCCG3 ’ 3’primer 48619-48597 5’TGTTCCTGGTAGGGATTCGAG GG3’ - 117 - Appendix Sequences of oligonucleotide primers (continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 10 BFLF2 5’primer 56133-56156 5’CAGAAGGCGTCCCCTACTAGG TCC3’ 3’primer 56738-56715 5’ATCAATATGTTCCCGGCACAC CAG3’ 11 BFLF1 5’primer 57087-57113 5’ACAAGCGTAATTAACGAGTCA CAGACC3’ 3’primer 57753-57730 5’TGCCTACCAGAAACCGAGTTC AGC3’ 12 BFRF1 5’primer 58900-58923 5’CCGGAAGAGAGGCTCCTAGA CGAG3’ 3’primer 59595-59573 5’GTTATCCAAGTCCCAACCACC GC3’ 13 BFRF2 5’primer 60606-60629 5’GCTGATCATGCCTCGGCTCTA TTG3’ 3’primer 61271-61250 5’GATGATGGCATCCAAGAGGCG G3’ 14 BFRF3 5’primer 61588-61613 5’CAAGAGCTGAACCAGAATAA TCTCCC3’ 3’primer 62045-62021 5’CGTGCCCTCTACTGTTTCTTAC GTG3’ 15 BPLF1 5’primer 62154-62178 5’TGGCTCACGAAGCGAGACAG TACTC3’ 3’primer 62547-62524 5’CCCAAACATACACCGTGCGA AAAG3’ 16 BOLF1 5’primer 72264-72288 5’ATACAGGATGTCGTCCATGCT GAGG3’ 3’primer 72969-72947 5’CACCCTGAGATACAGCACGA CGG3’ 17 BORF1 5’primer 75473-75494 5’GCTTCAGCTGGTCTGGGTGGC G3’ 3’primer 76153-76130 5’CATAGCGGTGCATGATGGATG GTG3’ 18 BORF2 5’primer 78076-78098 5’GGCACGATTGGGCAGGAACA GAC3’ 3’primer 78757-78735 5’CCTGGGCCCTTGCTCATGATG TC3’ - 118 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 19 BaRF1 5’primer 79121-79145 5’CTTCGAGAGCCACGACATTGA TCAC3’ 3’primer 79788-79763 5’GCATGGTGTAATCGGAACTCT CTTGC3’ 20 BMRF1 5’primer 80067-80090 5’GGGCTAATCAGCTTCGAGGTC TCC3’ 3’primer 80774-80750 5’AACACTAAGATCCAACGGCA GGTCC3’ 21 BMRF2 5’primer 81477-81501 5’CATCGAGATTGTTTACATCTG CCCG3’ 3’primer 82023-82000 5’GATAAACAGCACGGTCTTGCC CAG3’ 22 BMLF1 5’primer 82790-82811 5’CCGGAGAGAGAATGGCCCTG AC3’ 3’primer 83462-83439 5’GACCCGTTCCTACAGTCGATG CTG3’ 23 BSLF2- 5’primer 83753-83776 BMLF1(SJ) 5’GCTTGCCATAACTTTCATCGG TGC3’ 3’primer 84269-84245 5’TCTCCCGAACTAGCAGCATTT CCTC3’ 24 BSLF1 5’primer 84423-84447 5’AAGCACTGACTCATGAAGGT GACCG3’ 3’primer 84966-84943 5’CGCATACCTACAAGGTGGACA GGG3’ 25 BSRF1 5’primer 86924-86949 5’ATGGCCTTCTATCTCCCAGAC TGGTC3’ 3’primer 87580-87558 5’CTACGTTAACGCGAGCTCCGT GG3’ 26 BLLF3 5’primer 87625-87650 5’GGATATGAAGGTGTCATTGAC CCGAG3’ 3’primer 88353-88321 5’GGACCTAGGCCTCTATGCCCG CC3’ 27 BLRF1 5’primer 88555-88579 5’GGTCCTAAGAAAGCCGTTTGC AAAG3’ 3’primer 88858-88834 5’CATCTAATCCGTCAGCAGCGT GTTC 3’ - 119 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 28 BLRF2 5’primer 88927-88951 5’GTCAGCTCCACGCAAAGTCA GATTG3’ 3’primer 89337-89314 5’TTTGATTCTCGTGGTCGTGTT CCC3’ 29 BLLF2 5’primer 89435-89459 5’CATAGGTCTCGGCGTCATCATA TGG3’ 3’primer 89954-89929 5’GGAAACAGTTCCACATCCAC AAAACC3’ 30 BLLF1(SJ) 5’primer 89701-89725 5’GTGGTCGCATTGTATCTCGGT CTTG3’ 3’primer 90683-90661 5’AGTCCATCTCCATGGGACAAC GG3’ 31 EBNA 3A 5’primer 93566-93588 5’CACTTATGGCACACCTAGGCC GC3’ 3’primer 94186-94164 5’GGCTGCACCTCAACACTAGCC TG3’ 32 EBNA 3B 5’primer 95627-95650 (SJ) 5’CTCGCCAGCCTAGATTTGTGG ATG3’ 3’primer 96254-96232 5’GTGCCCAGCCCAATCCATATA GC3’ 33 EBNA 3B 5’primer 96834-96855 5’ACTGAGTGTCCAGGCTCGGCT G3’ 3’primer 97227-97206 5’CACCGGCCATGGAGTTTGTGC G3’ 34 EBNA 3C 5’primer 98586-98608 (SJ) 5’CATCAGGCGAAGGCGGAGAA GAC3’ 3’primer 99263-99240 5’GATGTGGTGCAGAGAGCCAC ACAG3’ 35 EBNA3C 3’ 5’primer 100675-100698 5’AGGCTCCATACCAGGGATACC AGG3’ 3’primer 101323-101301 5’TCAGCAGTAGCTTGGGAACA CCG3’ 36 BZLF2 5’primer 101486-101512 5’GGAATGAACACTCATGGTGTG AGACTG3’ 3’primer 102083-102059 5’TTTACCGCCATCGCACTTGTTA TTG3’ - 120 - Appendix Sequences of oligonucleotide primers (Contiuned) No. Gene name Genome Oligonucleotide Sequence Coordinates 37 BZLF1(SJ) 5’primer 102167-102190 5’TAGTAAACGAGGCGTGAAGC AGGC3’ 3’primer 103031-103009 5’CTCCTTTGCCTTGTGTGCTGT GG3’ 38 BRLF1 5’primer 103340-103364 5’GAGGAGGAGGCAGTTTTCAG AAGTG3’ 3’primer 103955-103931 5’AAAGGAAGAAGGGCCTCAGG GATAG3’ 39 BRLF1- 5’primer 102167-102190 BZLF1(SJ) 5’TAGTAAACGAGGCGTGAAGC AGGC3’ 3’primer 105123-105100 5’CAGCTGGGCTCTCTGGTCTCT GAC3’ 40 BRRF1 5’primer 105385-105407 5’CAAGCTGCTGGAAGACACCA TCG3’ 3’primer 106035-106013 5’GGCAGGGTAATGGCATCCGTG AC3’ 41 BRRF2 5’primer 107178-107204 5’CGCGTTGTTGTTATTGATTCCT CTTTG3’ 3’primer 107909-107885 5’GACGCTCAGTGAATACAGGG AGTGC3’ 42 EBNA1 5’primer 109205-109227 5’AAGAAGGTGGCCCAGATGGT GAG3’ 3’primer 109870-109849 5’CCTGCCCTTCCTCACCCTCAT C3’ 43 BKRF2 5’primer 109959-109982 5’TGCGTGCTGTTGGTGTATTTC TGG3’ 3’primer 110292-110269 5’TCCAGGGTGGTTAACAACTCA CGG3’ 44 BKRF3 5’primer 110494-110517 5’CTTGCTGCCGTTATTGCCTGT GTC3’ 3’primer 111027-111005 5’ACTCTTTCGGGTGCTGTTCTG GG3’ 45 BKRF4 5’primer 111187-111210 5’CTTGTCGGACGAGGAGGAAG AGAC3’ 3’primer 111640-111617 5’ACCCTTGTCTTTGGTGGATTG CTG3’ - 121 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 46 BBLF4 5’primer 111838-111862 5’CCAGTAGTGCGCGTGAGTTCT TTAG3’ 3’primer 112548-112525 5’CCGCTGTCTTCTATGCCCGAG TAC3’ 47 BBRF1 5’primer 115095-115117 5’CTGGCCCATCTGGAGCAGAA CTC3’ 3’primer 105677-105653 5’CGCTTTCCCAAAGTTCAGTCA GATC3’ 48 BBRF2 5’primer 116072-116096 5’CCAACGTCCCTGAGTTCTACA ATGC3’ 3’primer 116720-116697 5’GTCTGGCACTGGAAATGCTTG GTC3’ 49 BBLF3 5’primer 116826-116850 5’GATTTCCATAGGAATGGTGTA GCCG3’ 3’primer 117305-117283 5’CGCAGACACATTCGGGTGAA GGC3’ 50 BBLF2 5’primer 117523-117544 5’GTGGCTCCTCTGAAGGATGGG C3’ 3’primer 118044-118021 5’TGCTACTGGACCTGAACCTGG GAG3’ 51 BBLF2(SJ) 5’primer 116826-116850 5’GATTTCCATAGGAATGGTGTA GCCG3’ 3’primer 117577-117555 5’GAGTTCATCCTGGGCTTTGTG GC3’ 52 BBRF3 5’primer 119610-119635 5’TTTGCACTTTCTGGCCTCAGT TCTAC3’ 3’primer 120270-120246 5’CCTGGTTGACCTGGAGGAAG ATGAG3’ 53 BBLF1 5’primer 120790-120815 5’TCAGAGTCCTCATCATATTCG AGCCC3’ 3’primer 120998-120975 5’AGACAATACTTTTGACACCGC GCC3’ 54 BGLF5 5’primer 121351-121373 5’CGCTTGGGTCCGTCATTACGT AG3’ 3’primer 122007-121984 5’GGCAGTCTGAGAACCTGATGT GGG3’ - 122 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 55 BGLF4 5’primer 122467-122491 5’TGCAAGAATTGACTCATATGC TCCG3’ 3’primer 123129-123105 5’CTGGCATGATGGTAGTATTGA GCCC3’ 56 BGLF3 5’primer 124220-124242 5’CAGGCGGCTAACGTCAAAGG GAG3’ 3’primer 124800-124777 5’TCCTGCTCGTGTCCAATATCCT CC3’ 57 BGRF1- 5’primer 125797-125820 BDRF1(SJ) 5’AGACCAGCACCATCACGTTTA GGC3’ 3’primer 129751-129726 5’TGATGCGGATGTGTTGTTGGT ATAGG3’ 58 BGLF2 5’primer 125904-125928 5’TGTAGAGCATAGCCCGGCTGT AAAG3’ 3’primer 126531-126509 5’GAGGCGGTGCCTGTGGAGATT AG3’ 59 BGLF1 5’primer 127242-127267 5’CGGGAGTAGGAGGTGGGAAT AACAAC3’ 3’primer 127957-127936 5’CAGGAGTCTGCTGCGGCTATG C3’ 60 BDLF4 5’primer 128486-128511 5’TAGAGACTGAGGACCACATC CACCAC3’ 3’primer 128932-128908 5’GGAGTTCCATCTCCCGTTACC TGAG3’ 61 BDRF1 5’primer 129690-129715 5’GCCTAGCCTCCTCCCTCTACG TGTAC3’ 3’primer 130324-130300 5’CTGTGTTGTTGCGAGAAAATG AGCC3’ 62 BDLF3 5’primer 130402-130424 5’GCATTCGTGAGCAGGGCTTCG TC3’ 3’primer 131053-131031 5’GAGACAAGGCAGGCGCTGTT ATG3’ 63 BDLF2 5’primer 131182-131204 5’GTGAGCCGGTCAACACGACA TTG3’ 3’primer 131685-131662 5’GTCTTATGGGTGTCCGACCAA TCC3’ - 123 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 64 BDLF1 5’primer 132527-132549 5’TCATCCGCCACTGACAGGTCA TC3’ 3’primer 133178-133155 5’TGGGCTTGGGTCAGGTGTACT CTC3’ 65 BcLF1 5’primer 133806-133830 5’CGGCAACCTCCTGATTGTAGT TTTC3’ 3’primer 134433-134409 5’CTCGTTTCAATCAGTGGAATG ACCG3’ 66 BcRF1 5’primer 138988-139010 5’CGGCCGTGTCAAACTGGAAC TCG3’ 3’primer 139716-139694 5’ACACTTGAGCATCACGGCAGT GG3’ 67 BTRF1 5’primer 139948-139974 5’CCCTATATCCTAGAGGGACAG CTGACG3’ 3’primer 140590-140567 5’CCTTGGTTTCAGCCTCACTGA TGG3’ 68 BXLF2 5’primer 140937-140963 5’CTTGTGAACCAGAAAGATACC CAGAGC3’ 3’primer 141611-141589 5’TCACCGTGCTACCTCAGCCTA CG3’ 69 BXLF1 5’primer 143063-143087 5’TCAGAGATCACCTTGCTCAGA CCAG3’ 3’primer 143735-143714 5’AGTCTGGTGCCAGGTCAGTC GC3’ 70 BXRF1 5’primer 144901-144925 5’CCTGGCAAAATTTCACAGTCT TCCC3’ 3’primer 145512-145490 5’GCAGTGAGTTGCGAAGGCTT GGG3’ 71 BVRF1 5’primer 146459-146481 5’CCGGATCGCCAACCAGATCTT TG3’ 3’primer 147166-147143 5’CTTTTTGCCAATGACCCACTC CAG3’ 72 BVRF2 5’primer 147935-147957 5’GGCACCGTCTGTATACGTCTG CG3’ 3’primer 148557-148533 5’GAAATCCAGCATCGATTGCCT TAGC3’ - 124 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 73 BdRF1 5’primer 149012-149033 5’GGCGATGGACGCTCACACCTA C3’ 3’primer 149697-149676 5’GGTGGGCTGACACAGACTTG GC3’ 74 BILF2 5’primer 149821-149842 5’CAGCCACCCCAGACAGGAGA TG3’ 3’primer 150385-150364 5’GGTCTCTCGGATCGAGTTGGG C3’ 75 BILF1 5 ’ 5’primer 150602-150626 5’TATTCTGCAACAACAGCCATA CCCG3’ 3’primer 151204-151181 5’AAGATGCACTTGCATATTCCG GGC3’ 76 RJLF3 5’primer RJ*851-874 5’TCAGAATAACAGGGGAAGCA AGGC3’ 3’primer RJ*1028-1007 5’AGGGACAGGGGGAGACTTTC GG3’ 77 RJLF2 5’primer RJ*9334-9361 5’GGCTACGATATTCCCGTTAAAT GTCTTG3’ 3’primer RJ*10009-9988 5’CGAGTGCCTGCCTTACCTGCT G3’ 78 RJLF1 5’primer RJ*10862-10884 5’ACGCCGCCTCCTGGAATGTAA AC3’ 3’primer RJ*11635-11612 5’TCATTTGTGTAGGTGCGGCTA TCC3’ 79 BILF1 5’primer 152262-152285 5’TAATGAGCAACAGGGCCAAA CAGG3’ 3’primer 152868-152847 5’GAACTGCTGCTCTGGGTGCTG G3’ 80 BALF5 5’primer 153721-153743 5’AAATTCTGGAGGACGGAGAG GGC3’ 3’primer 154375-154354 5’TCTCCCTGGAGGCCGAGAAG AC3’ 81 ECRF4 5’primer 155444-155466 5’CGGTGATGCGGACCTTGGTGT TG3’ 3’primer 156079-156057 5’AGCACGGGTGTCGGATCTTTG AG3’ - 125 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 82 BALF4 5’primer 156785-156807 5’GGCGGTCTCTGGATCGTGATA GC3’ 3’primer 157410-157387 5’TTGCCTCCCTGGAGCTGTACT CAC3’ 83 BART1(SJ) 5’primer 156051-156073 5’GTTGGCCTCAAAGATCCGACA CC3’ 3’primer 157360-157338 5’TTTGACCTGGAGGGCATCTTC CG3’ 84 BART2(SJ) 5’primer 159120-159142 5’CACTGGATGTCCGAGGAGAA GCG3’ 3’primer 160921-160900 5’TGGATCTGCTGGGCCGCTTTC G3’ 85 BART3(SJ) 5’primer 159812-159836 5’AGCTCAGGGTCTGGGTAAAC AGGTG3’ 3’primer 160921-160900 5’TGGATCTGCTGGGCCGCTTTC G3’ 86 BALF3 5’primer 160451-160472 5’ACAGGGCAGAGAGGCGGGAA TG3’ 3’primer 161124-161103 5’GCTGCTCGCCCCTGGTAGAAA G3’ 87 BALF2 5’primer 161501-161524 5’CTCGGCCACGCTGATAAAGTT GTC3’ 3’primer 162086-162065 5’CGCGGCCACAGACTGTCTTAG C3’ 88 BALF1 5’primer 164862-164886 5’GATTTCAGGAAGTCAGTCAG GCTGG3’ 3’primer 165547-165525 5’ACACAGGAGGCCAACAGGAG GAG3’ 89 BARF1 5’primer 165514-165536 5’TCATCGCTCAGCTCCTCCTGT TG3’ 3’primer 166121-166098 5’GTCATTTTTCCCAACGCAGGT CAC3’ 90 BNLF2 5’primer 166964-166989 5’CATCAATAATAAGGGCGCCAT CTAGC3’ 3’primer 167460-167437 5’GCTAGAGCAGCAGTCCTCTGC CTG3’ - 126 - Appendix Sequences of oligonucleotide primers (Continued) No. Gene name Genome Oligonucleotide Sequence Coordinates 91 LMP1 3’ 5’primer 167531-167554 5’AGGACAAGGAAAGAAGGCCA GAGG3’ 3’primer 168222-168199 5’TCTGGTTCCGGTGGAGATGAT GAC3’ 92 LMP1 3’ 5’primer 168592-168616 (SJ) 5’GCCTAGGTTTTGAGAGCAGA GTGGG3’ 3’primer 169072-169049 5’ATTGTGCTGTTCATCTTCGGG TGC3’ 93 LMP1 5’ 5’primer 168592-168616 (SJ) 5’GCCTAGGTTTTGAGAGCAGA GTGGG3’ 3’primer 169379-169357 5’CCTCTTGGCGCTACTGTTTTG GC3’ 94 LMP2A 5’ 5’primer 166656-166680 5’ATCTGCTTCTGGCTCTTCTGG GAAC3’ 3’primer 166911-166888 5’TCTGCCCGCTTCTTCGTATATG TG3’ 95 LMP2B 5’ 5’primer 169754-169777 5’GCAACAGGAAATGGAAAGGC AGTG3’ 3’primer 169872-169851 5’GCCAACGACCTCCCAACGTT GC3’ 96 LMP2 3’ 5’primer 1305-1330 (SJ) 5’TGTCGCTGGCATACTCTTCATT CTTG3’ 3’primer 5801-5779 5’GTTCACGTCCAGCTTCTCCAT GC3’ 97 EBER1 5’primer 6647-6671 5’GAGGTTTTGCTAGGGAGGAG ACGTG3’ 3’primer 6780-6757 5’CCAGCTGGTACTTGACCGAA GACG3’ 98 EBER2 5’primer 6959-6982 5’ACAGCCGTTGCCCTAGTGGTT TCG3’ 3’primer 7117-7094 5’ACAAGCCGAATACCCTTCTCC CAG3’ RJ*: indicate sequences from EBV Raji strain (SJ): indicate the PCR product across spliced region - 127 - [...]... intronless genes expression and inhibit expression of intron-containing genes (Ruvolo et al., 1998) In contrast to the majority of cellular genes, many EBV genes expressed during lytic cycle are intronless, and SM may therefore be important in enhancing expression of other lytic EBV genes In addition, SM shows gene specificity, preferentially activating expression of some but not all intronless genes (Ruvolo... chromosomes during mitosis and is a key mediator of EBV DNA binding to chromosomes EBNA1 also has some function in regulation of gene expression For example, it can interact with two sites downstream of Qp to negatively regulate its own expression (Nonkwelo et al., 1996) In addition, EBNA1 has a central role in maintaining latent EBV infection EBNA1 has Gly-Ala repeats located in its N-terminal The repeats... elements (ZREs) which are present in the promoters of some EBV genes, including the promoters of BZLF1 and BRLF1 (Kieff and Rickinson, 2001) BRLF1 expression is controlled by Rp promoter, and several cis elements involved in regulating Rp activity - 12 - Introduction including sites for binding cellular transcription factors NF1, Sp1, YY1, Zif and EBV ZEBRA ZEBRA can activate Rta in all cell backgrounds that... experiment In general, the expression patterns can be defined in 5 stages, which are described in the following 1 In healthy carriers, EBV mainly stays in memory B cells which are in a resting stage where no viral proteins are expressed (Hochberg et al., 2004) This gene expression pattern is called latency (resting) program 2 In dividing memory B cells, only EBNA1 protein is expressed This gene expression. .. 1999) LMP2A N-terminal domain includes some -9- Introduction phosphorylated tyrosine residues which may provide binding sites for the cellular protein containing Src homology 2 (SH2) (Longnecker et al., 1991) Several phosphotyrosine kinases (PTKs) bind to LMP2A via their SH2 domain and are then activated to regulate cellular growth LMP2A expression in B cells results in the bypass of normal B-lymphocyte... specific DNA binding phosphoprotein that is required for the replication and maintenance of the episomal EBV genome This function is achieved through the binding of EBNA1 to oriP which contains multiple EBNA1 binding sites OriP is a cis-acting element in EBV genome By associated with EBNA1, it enables the viral persistence of episomes in EBV infected-cells (Kieff & Rickinson, 2001) EBNA1 is the only... Replication Fig 2 EBV life cycle in vivo Diagram describing the EBV life cycle and different transcription programs used by EBV in different stage of its life (Thorley & Gross, 2004) 1.1.6 EBV associated malignancies EBV has been implicated in the development of a wide range of malignancies, including Burkitt’s lymphoma, Hodgkin’s disease, non-Hodgkin’s lymphoma, nasopharyngeal carcinoma, lymphoproliferative... origin and contain the patients’ intrinsic EBV (Knowles, 1999) Both type I and type II EBV strains are - 24 - Introduction detectable This shows two types EBV can co-infect the host (Boyle et al., 1991) According to the EBV association and EBV gene expression patterns, ARLs can be separated into 2 types One type is diffuse large B-cell lymphoma This type is closely associated with EBV, and EBV gene expression. .. numerous early genes (Feederle et al., 2000) ZEBRA is a sequence-specific DNA-binding protein of 35 KD, and distantly related to c-fos which binds DNA via degenerate AP-1 and CREB-like binding sites (Farrell et al., 1989) Previous study shows that introduction of the BZLF1 gene of Epstein-Barr virus into latently-infected B cells leads to induction of the entire lytic cycle program of the virus (Takada... transform epithelial cells in vitro Previous studies suggested that EBV glycoprotein gH and EBV- specific immunoglobulin A (IgA) may be associated with EBV infection in epithelial cells in vivo (Sixby et al., 1992; Molesworth et al., 2000) Infection of primary human B lymphocytes with EBV results in conversion and continuous proliferation into long term lymphoblastoid cell lines (LCLs) During growth transformation ... In contrast to the majority of cellular genes, many EBV genes expressed during lytic cycle are intronless, and SM may therefore be important in enhancing expression of other lytic EBV genes In. .. regulator of viral gene expression and essential for virion production (Gruffat et al., 2002) SM protein can activate intronless genes expression and inhibit expression of intron-containing genes. .. activating expression of some but not all intronless genes (Ruvolo et al., 2001) Except regulation of viral gene expression, SM protein can increase expression of some cell genes, such as some interferon-stimulated