Expression of EBV genes in nasopharyngeal carcinoma

... In contrast to the majority of cellular genes, many EBV genes expressed during lytic cycle are intronless, and SM may therefore be important in enhancing expression of other lytic EBV genes In ... regulator of viral gene expression and essential for virion production (Gruffat et al., 2002) SM protein can activate intronless genes expression and inhibit expression...

Ngày tải lên: 05/10/2015, 22:32

... hupUV genes are apparently intact, yet the hydrogen sensing system is not functional in T roseopersicina BBS Results Hydrogen independent hupSL expression The HupSL enzyme of T roseopersicina is ... E-value of 1.2e-140) The presence of the hupR gene in T roseopersicina is in apparent contradiction with the absence of a hydrogen- dependent regulation of...

Ngày tải lên: 16/03/2014, 23:20

... Analysis of recombinant protein production in these samples will indicate how much virus is needed to obtain maximal yield after a given time of infection Only this type of experiment, in combination ... procedure" in the case of secreted proteins, albeit not in every instance Comparative Protein Production in Different Systems: Expression of hu-LIF In order to exem...

Ngày tải lên: 11/04/2014, 09:41

... prognostic ability of bidimensional measurement of primary tumor and retropharyngeal nodes using MRI findings After analyzing trade-off, we chose 15 cm2 as the cut-off point in the validation ... consisting of cisplatin and 5-FU was arranged as guidelines [2] Using computed tomography-derived measurement, bidimensional measurement of primary tumor and retropharyngeal nodes...

Ngày tải lên: 09/08/2014, 09:20

... disturbances with the addition of fenofibrate in patients with HIV, which is accompanied by significant changes in the pattern of chemokine gene expression in circulating leukocytes The data suggest ... may be useful in the attempt to decrease the risk of atherosclerosis and may act as modulators of systemic inflammation and the associated vascular resp...

Ngày tải lên: 10/08/2014, 05:21

... Liu et al.: Comparison of the expression of cytokine genes in the bursal tissues of the chickens following challenge with infectious bursal disease viruses of varying virulence Virology Journal ... difference in the expression levels of cytokines was possibly influenced by the different degree of viral replication However, factors infl...

Ngày tải lên: 11/08/2014, 21:21

... doi :10 .11 86 /14 23- 012 7 -17 -77 Cite this article as: Yee and Sim: High cell density and latent membrane protein expression induce cleavage of the mixed lineage leukemia gene at 11 q23 in nasopharyngeal ... High cell density induces apoptosis and subsequent cleavage of the MLL breakpoint cluster region (bcr) To investigate the role...

Ngày tải lên: 10/08/2014, 05:21

... of mammalian origin by the fish intestine Comparison of zebrafish prp1, prp2, and prp3 developmental expression patterns The developmental expression patterns of prp1 and prp2 coding for long zebrafish ... distributed within the CNS 509 Expression of prion genes in the developing zebrafish and in specific areas outside the CNS of the developing zebrafish...

Ngày tải lên: 19/02/2014, 16:20

... picture of SARS- CoV-induced cytokines In some cases Growth of SARS- CoV in different cell lines Vero cells, which are standard for growth of SARS- CoV [30,31], lack type I IFN genes [32,33] and therefore ... induction of cytokines Interferon genes and their antiviral effectors To properly assess the cytokine profile of SARS- CoV infection, we compared it with...

Ngày tải lên: 20/06/2014, 01:20

... persistently HBV expressing cell line HepG2.215 and its parent cell line, a non-HBV expressing cell line HepG2 We found that cIAP1 and cIAP2 were clearly increased in the HBV expressing cells but XIAP ... expression in the HBV expressing cells was first investigated by the comparison of the gene expression profile in the HepG2.215 and HepG2 cells using gene arra...

Ngày tải lên: 02/11/2012, 11:17

... important for further investigation Number of ammonia oxidizers and copy number of amoA mRNA The time courses of the copy number of amoA mRNA and the number of ammonia oxidizer are shown in Fig No significant ... PCR-reaction-1) Community analysis of ammonia oxidizer based on amoA mRNA The difference of the effect of polyferric sulfate...

Ngày tải lên: 05/09/2013, 10:15

... level of Mcm expression in HeLa cells and cancer cells from human uterine cervix Although it remains to be determined how enhanced expression of Mcm proteins affects DNA replication in cancer cells, ... significance of Mcm proteins in the aberrant proliferation of cancer cells In addition, Mcm3 and proteins seem to be useful as a marker to...

Ngày tải lên: 20/02/2014, 23:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... DISCUSSION The findings in this study show that GR is highly expressed in epithelial cells of the male genital tract, especially in the Ó FEBS 2002 Glutathione reductase in male reproduction system ... level of expression of aldose reductase was also detected in the epithelia of the male genital tract In addition, glutathione S-transferase is pre...

Ngày tải lên: 17/03/2014, 17:20

... The amount of IgA present in each supernatant was calculated relative to a standard preparation with known concentration Verification of J-chain expression To examine production of J-chain, transfected ... density was analysed by TOTALLAB gel software (Phonetix, UK) The amount of SC present in each supernatant was calculated relative to a standard preparation with known con...

Ngày tải lên: 18/03/2014, 01:20