Characterization of gli2 2b genes in zebrafish hindbrain development 1

CHARACTERIZATION OF GLI2/2B GENES IN ZEBRAFISH HINDBRAIN DEVELOPMENT KE ZHIYUAN (B.Sc, Tsinghua University, China; M.Sc, South China Sea Institute of Oceanology, Chinese Academy of Sciences, China) A THESIS SUBMITTED FOR THE DEGREE OF THE DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2006 Acknowledgements ACKNOWLEDGEMENTS Time has passed by faster than I expected since I arrived here in July, 2001. To me the whole postgraduate study is quite challenging, and it would be impossible to get through it without the helps from many people who I should be thankful to. My foremost gratitude is to my honorific supervisors: A/P Gong Zhiyuan (Department of Biological Sciences) and A/P Vladimir Korzh (Institute of Molecular and Cell Biology), for giving me this opportunity to carry out research under their guidance. Their attitude toward research and personalities as well impressed me so much that it encourages me to keep on going forward without any hesitation even in the most frustrating time. Secondly, I would like to give my heartfelt thanks to A/P Hong Yunhan and A/P Wang Shu (Department of Biological Sciences), as my degree committee members, for sharing all the ideas and insights. My research work has been done in both labs in Department of Biological Sciences and Institute of Molecular and Cell Biology. Although the working styles are quite different in these two labs, the people from both labs are very energetic and also friendly to me. I have to admit that I enjoy the time that I have spent in these two big labs and I really appreciate the favors from all of you: Yan Tie, Yilian, Tong Yan, Bihui, Xinjun, Siew Hong, Xiufang, Zhiqiang, Qinwei, Huiqin, Shizhen, Wan Hai, Haiyan, Shalin, Prakash, Hu Jing, Xiaoming, Bensheng, Xukun, Shan Tao and Zeng sheng in Gong’s lab; and Sasha, Lana, Li Zhen, Steven, Catheleen, Lee Thean, Kar Lai, Sergei, Dmitri, Igor, Shangwei, William, Mike and Gao Rong from IMCB. Also, I would like to thank people in the general office and those handling the fish facility in the department and TLL/IMCB for their assistant whenever required. I am also grateful to my dearest parents for letting me go abroad to fulfill my dream although they would rather see me being together with them. And I am also in debt to my beloved wife for her self-giving support and care. Finally, I would like to render my appreciation to National University of Singapore for providing me the graduate research scholarship during these years. I Contents CONTENTS Acknowledgements I Contents II List of Figures and Tables VI List of Abbreviations VIII Publications X Summary XI Chapter I. Introduction 10 12 17 17 1.1 Zebrafish as an emerging model for development studies 1.1.1 Forward genetic approach 1.1.2 Reverse genetic approach: gain of function and loss of function 1.1.3 Transgenic approach 1.1.4 Duplication of teleost genome: pros and cons of duplicated genes 1.2 Early stages of embryonic development of the Zebrafish 1.3 General introduction to neural development 1.3.1 The induction of neural ectoderm 1.3.2 Prepatterning of neural plate along the anterioposterior and dorsoventral axis 1.3.3 The neurulation process in zebrafish and other vertebrates 1.3.4 Transcription factors in regionalization of neural tube 1.3.5 Sequential onset of neuronal and glial differentiation from neural progenitors 1.3.6 Delta/Notch signaling pathway and lateral inhibition 1.3.7 Zebrafish hindbrain development 1.3.8 Cranial motor neurons development in zebrafish 1.4 The Hedgehog signaling pathway 1.4.1 Gli/Ci and their roles in Hedgehog signaling pathway 1.4.1.1 The cascade of Shh-Patch-Ci signaling pathway is well studied in Drosophila 1.4.1.2 Gli protein structure 1.4.2 From fruit fly and zebrafish to human: evolutionary conservation and diversity of Ci/Gli 1.4.3 Roads to Gli: the crosstalk between different signaling pathways 1.4.4 Patterning of ventral neurons under the regulation of Gli through dorsal/ventral axis in spinal cord 1.4.5 Hh/Gli pathway and brain development 1.4.6 Hh signaling in disease and tumorigenesis 1.5 Objectives of this study Chapter II. Materials and Methods 19 23 24 26 28 29 32 33 34 35 37 39 42 44 48 49 51 53 II Contents 2.1 DNA applications and genomic mapping 2.1.1 DNA preparation and purification 2.1.1.1 Isolation and purification of plasmid DNA 2.1.1.2 Isolation of zebrafish genomic DNA 2.1.1.3 cDNA synthesis 2.1.1.4 Recovery of DNA fragments from agarose gel 2.1.2.1 Digestion of plasmid DNA by Restriction endonuclease 2.1.2.1.1 Restriction endonuclease digestion of DNA 2.1.2.1.2 DNA electrophoresis 2.1.2.2 Blunt-end ligation 2.1.2.2.1 Generating blunt-ended linear DNA 2.1.2.2.2 Removal of 5’ phosphate from digested DNA 2.1.2.2.3 Ligation and inactivating the ligase after Ligation 2.1.2.3 Sticky-end ligation 2.1.2.4 Transformation 2.1.2.4.1 Preparation of competent cells 2.1.2.4.2 Transformation 2.1.3 Polymerase chain reaction (PCR) 2.1.3.1 Standard PCR 2.1.3.2 Reverse transcription PCR (RT-PCR) 2.1.3.3 Rapid amplification of cDNA ends (RACE) 2.1.3.4 Colony screening 2.1.3.5 PCR product subcloning 2.1.3.6 Real-time PCR 2.1.4 Automatic DNA sequencing 2.1.5 Southern blot 2.1.5.1 Prehybridization 2.1.5.2 Hybridization 2.1.5.3 Post hybridization wash 2.1.5.4 Autoradiography 2.1.6 Genomic mapping 2.1.7 Phylogenetic analysis 2.1.8 DNA vectors 2.1.8.1 pBluescript SK(+) 2.1.8.2 pGEM®-T and pGEM®-T Easy 2.1.8.3 pCS2+ 2.1.8.4 pEGFP-N2 2.2 RNA applications 2.2.1 Isolation of total RNA 2.2.1.1 Isolation of total RNA from zebrafish embryos 2.2.1.2 Measurement of RNA concentration 2.2.1.3 RNA gel electrophoresis 2.2.2 Synthesis of 5’ capped mRNA 2.2.3 Northern blot 2.2.3.1 Hybridization 2.2.3.2 Membrane striping 2.3 Protein applications 2.3.1 in vitro coupled transcription and translation 2.3.2 SDS-polyacrylamide gel electrophoresis (PAGE) 2.4 Expression Analysis 54 54 54 55 55 56 56 57 57 57 57 58 58 58 58 58 59 59 59 60 60 61 62 62 63 64 64 64 65 65 65 66 67 67 68 69 70 71 71 71 71 71 72 72 72 73 73 73 73 74 III Contents 2.4.1 Zebrafish 2.4.1.1 Fish maintenance 2.4.1.2 Mutant lines of zebrafish 2.4.2 Microinjection 2.4.3 Anti-sense morpholino design 2.4.4 Whole mount in situ hybridization on zebrafish embryos 2.4.4.1 Synthesis of labeled RNA probe 2.4.4.1.1 Linearization of plasmid DNA 2.4.4.1.2 Probe incubation and precipitation 2.4.4.1.3 Quantification of labeled probe 2.4.4.2 Preparation of zebrafish embryos 2.4.4.2.1 Embryo collection and fixation 2.4.4.2.2 Proteinase K treatment 2.4.4.2.3 Prehybridization 2.4.4.3 Hybridization 2.4.4.4 Post-Hybridization washes 2.4.4.5 Antibody incubation 2.4.4.5.1 Preparation of preabsorbed DIG 2.4.4.5.2 Incubation with preabsorbed antibodies 2.4.4.6 Color development 2.4.4.7 Mounting and photography 2.4.5 Two-color whole mount in situ hybridization 2.4.6 Immunohistochemical staining 2.4.6.1 Primary antibody incubation 2.4.6.2 Secondary antibody incubation 2.4.6.3 Staining 2.4.7 in situ hybridization and immunohistochemistry on sections 2.4.7.1 Cryostat section 2.4.7.2 Immunohistochemistry on sections 2.4.8 DAPI staining 2.4.9 Confocal microscopy and imaging of living embryos after anesthetizing Chapter III. Results 3.1 Characterization of zebrafish gli2b gene 3.1.1 Isolation of full length zebrafish gli2b cDNA 3.1.2 The novel gli cDNA encodes a second Gli2 of zebrafish 3.1.3 Phylogenetic analysis of gli2b 3.1.4 Genome mapping of gli2b 3.2 Expression analysis of gli2b in zebrafish 3.2.1 Temporal expression of gli2b in zebrafish embryos 3.2.2 Comparison of expression patterns of the two gli2s of zebrafish during early development 3.2.3 Specific expression of gli2b during hindbrain development 3.3 The regulation of gli2b expression 3.3.1 gli2b expression and Shh signaling 3.3.2 gli2b expression is altered in embryos deficient in components of Notch signaling 3.3.3 gli2b expression in the lateral domains and MHB is not regulated by Fgf3/8 74 74 75 75 76 78 78 78 79 79 79 79 80 81 81 81 81 81 82 82 83 83 84 85 85 85 85 85 86 87 87 88 89 89 91 91 99 102 102 103 105 107 107 110 112 IV Contents 3.4 gli2b and regulation of neural precursors 3.4.1 The anti-sense Gli2b MO effectively inhibits Gli2b function 3.4.2 Classification of phenotypes of gli2b morphants 3.4.3 Comparison of the phenotypes of gli2 and gli2b morphants 3.4.4 Gli2b morphant showed cell proliferation defects in the hindbrain 3.4.5 zath3 expression was affected in Gli2/Gli2b morphants 3.4.6 Gli2/2b and regulation of expression of bmp2 3.4.7 Inhibition of gli2b caused the disruption of notch1 and gfap expression 3.4.8 Inhibition of gli2b did not affect the segmentation of hindbrain 3.5 Characterization of gli2/gli2b function within the Hh pathway 3.5.1 gli2b and nkx2.2 expression 3.5.2 Inhibition of Gli2b caused abnormal development of oligodendrocytes 3.5.3 Gli2b and neuronal differentiation 3.5.5 Gli2b and axonogenesis 3.5.6 Gli2b and formation of axonal scaffold 114 114 119 122 123 125 129 Chapter IV. Discussion 150 153 154 155 4.1 Zebrafish Gli2b belong to Ci/Gli zinc finger transcription factor family 4.2 Genome mapping of gli2b reveal a conserved synteny 4.3 Comparative analysis of gli2/2b expression and function 4.4 Mutant analysis demonstrated that gli2b is regulated by an integration of different signaling pathways 4.5 Gli2s play important roles in zebrafish development similar to that in mouse 4.6 The interaction of Gli2b and Notch signaling in the hindbrain development 4.7 Gli2b roles along the D-V axis differ 4.8 Gli2/2b activate Hh downstream genes in ventral hindbrain 4.9 Gli2b regulates differentiation of motor neuron and oligodendrocytes 4.10 Gli2/2b and regulation of expression of netrin-1a 4.11 Concluding remarks 131 134 136 136 139 143 146 148 157 159 161 163 165 166 167 170 Chapter V. Conclusion 173 Chapter VI. References 175 V List of Figures and Tables LIST OF FIGURES AND TABLES Fig. 1-1 Camera lucida sketches of the zebrafish embryos at selected 16 stages. Fig. 1-2 and 10 hpf neural fate maps, modified from Woo and 20 Fraser (1995). Fig. 1-3 Schematic showing the expression of Hox genes in mouse 31 and zebrafish. Fig. 1-4 Intracellular transduction of the Hedgehog signal. 37 Table 1-1 Hedgehog signaling-related diseases. 50 Fig. 2-1 Mechanism of SMART cDNA systhesis (reproduced from user 61 manual). Fig. 2-2 pBluescript SK (+/-) vector map (reproduced from 67 www.stratagene.com) Fig. 2-3 pGEM-T vector map (reproduced from www.promega.com) 68 Fig. 2-4 pCS2+ vector map (reproduced from Dave Turner/Ralph Rupp, 69 tuebingen, Germany) Fig. 2-5 pEGFP-N2 Vector map (reproduced from http://www.clontech.com) 70 Table 2-1 Ingredients of SDS-polyacrylamide gel 73 Fig. 2-6 Structures of DNA and morpholino oligonucleotides. R and R’ denote 77 continuation of the oligomer chain in the 5’ or 3’ direction, respectively. (Reproduced from Corey et al., 2001) Fig. 3-1 Isolation and cloning of full length zebrafish gli2b cDNA 90 clone. Fig. 3-2 The complete nucleotide sequence of the zebrafish gli2b 92 cDNA and deduced amino acid sequence. Fig. 3-3 Alignment of the zebrafish Gli2b with zebrafish (z) and 96 mouse (m) Gli2 proteins. Fig. 3-4 The phylogenetic tree of vertebrate Gli family comprising 98 Gli1, Gli2 and Gli3. Fig. 3-5 gli2b genomic sequence used to design primers for gene 100 mapping. Fig. 3-6 Mapping of zebrafish gli2b and synteny analysis. 101 Fig. 3-7 Temporal expression of gli2b as defined by RT-PCR. 102 VI List of Figures and Tables Fig. 3-8 The spatial pattern of gli2b expression during zebrafish 104 embryogenesis. Table 3-1 Summary of expression patterns of zebrafish gli2s and 105 mouse Gli2. Fig. 3-9 gli2b expression in the hindbrain during late development. 106 Fig. 3-10 gli2b expression in the 48 hpf hindbrain is Hh dependent. 109 Fig. 3-11 Late gli2b expression is affected in mib-/- embryos. 111 Fig. 3-12 gli2b and Fgf3/8. 113 Fig. 3-13 Validation of gli2b MO for blocking translation of zebrafish 116 gli2b. Fig. 3-14 gli2b MO blocks zebrafish gli2b mRNA splicing. 117 Table 3-2 Phenotypes obtained after injection of gli2b morpholino 120 oligonucleotides in zebrafish embryos. Fig. 3-15 Classification of Gli2b morphants. 121 Fig. 3-16 Comparative analysis of Gli2b and Gli2 morphants. 122 Fig. 3-17 gli2b and cell proliferation. 124 Fig. 3-18 Gli2/Gli2b regulate expression of zath3. 127 Fig. 3-19 Gli2b and expression of bmps. 130 Fig. 3-20 Expression of early neurodifferentiation markers in the 133 hindbrain of Gli2b morphant. Fig. 3-21 Expression of segmentation markers in Gli2b morphants. 135 Fig. 3-22 Gli2/Gli2b regulate nkx2.2 expressions in the hindbrain at 30 138 hpf, dorsal view. Fig. 3-23 gli2b is required for differentiation of oligodendrocytes. 141 Fig. 3-24 Gli2/Gli2b and differentiation of motor neurons and 145 Rohon-Beard sensory neurons (RB). Fig. 3-25 Gli2/Gli2b regulate expression of netrin1a. 147 Fig. 3-26 Axonal scaffold and formation of neuronal clusters in the 48 149 hpf Gli2b morphant. Fig. 4-1 Diagram of the regulatory regions of gli2 and gli2b genes. 156 VII List of Common Abbreviations LIST OF COMMON ABBREVIATIONS ace ANR A-P APS ATP BCIP bHLH BMN BMP bp BSA cDNA Ci CIP CMN CNS Cos2 Ct cyc DANA DEPC DIG DMSO DNA dNTP dtr DTT D-V EDTA ENU EST EtOH FBS FGF Fu GFP GTP HPE hpf kb LB LG LINE MBT MHB mib MNP acerebellar anterior neural ridge antero-posterior amomonium persulfate adenosine triphosphate 5-bromo-3-chloro-3-indolyl phosphate basic helix-loop-helix branchiomotor neuron bone morphogenetic protein base pair bovine serum albumin DNA complementary to RNA Cubitus interruptus calf intestinal alkaline phosphatase Cranial motor neuron central nervous system Costal2 Cycle of threshold cyclops Danio retroposon A diethyl pyrocarbonate digoxygenin dimethylsulphoxide deoxyribonucleic acid deoxyribonucleotide triphosphate detour dithiothreitol dorso-ventral ethylene diaminetetraacetic acid N-Ethyl-N-nitrosourea expressed sequence tag ethanol fetal bovine serum fibroblast growth factor Fused green fluorescent protein guanosine triphosphate Holoprosencephaly hours post fertilization kilo base pair Luria-Bertani medium linkage group Long Interspersed Nuclear Element mid blastula transition midbrain-hindbrain boundary mind bomb motor neuron progenitors VIII List of Common Abbreviations MO MOPS mRNA NBT Ngn1 NTP OD OLP PAP-A PBS PCR PFA PHS PKA PNS PTU R4 RACE RAR RFP RH RNA rpm RT-PCR SDS Shh SINE siRNA SMN smu SSC SSLP Su(fu) syu TEMED TGF TILLING tRNA UTR UV Val WISH yot YSL ZFIN ZLI morpholino oligonucleotide 3-(N-morpholino)propanesulfonic acid messenger ribonucleic acid nitroblue tetrazolium Neurogenin ribonucleotide triphosphate optical density oligodendrocytes progenitors polydactyly type A phosphate-buffered saline polymerase chain reaction paraformaldehyde Pallister-Hall syndrome cyclic AMP dependent protein kinase A Peripheral Nervous System 1-phenyl-2-thiourea rhombomere rapid amplification of cDNA ends Retinoic Acid Receptor red fluorescent protein radiation hybrid ribonucleic acid revolution per minute reverse transcriptase-polymerase chain reaction sodium dodecylsulfate Sonic Hedgehog Short Interspersed Nuclear Element Short interfering RNA secondary motor neuron slow-muscle-omitted sodium chloride-trisodium citrate solution simple sequence length polymorphism Suppressor of fused sonic-you N,N,N’,N’-tetramethylethylene-diamine Transforming Growth Factor Targeting Induced Local Lesions in Genomes transfer ribonucleic acid untranslated region ultraviolet Valentino whole-mount in situ hybridization you-too yolk syncytial layer zebrafish information network zona limitans intrathalamica IX Materials and Methods and 3% formaldehyde until the dye near the end. After electrophoresis, the gel was rinsed in distilled water and a picture was taken with a ruler to show the distance among the bands. 2.2.2 Synthesis of 5’ capped mRNA cDNAs for synthetic RNA were cloned into pCS2+ vector ( Rupp et al., 1994; refer to Fig. 2-4). 5’ capped mRNA was synthesized by mMESSAGE mMACHINE™ Sp6 kit (Ambion, USA). The typical reaction volume is 20 ul, containing μg linearized DNA, μl 10X Reaction Buffer, 10 μl 2X NTP/Cap, μl Enzyme Mix and nucleasefree water. The reaction was incubated at 37 °C for hours. After that, μl RNase-free DNase I was added and mixed well. The tube was incubated for 15 more minutes at 37 °C. The recovery of RNA was performed by LiCl precipitation. First, 30 μl nuclease free water and 25 μl Lithium Chloride Precipitation Solution were added into the reaction mix. Then the reaction was chilled at -20 °C for 30 minutes and centrifuged at 14,000 rpm, °C for 15 minutes. The pellet was washed by 250 μl 70% ethanol and recentrifuged at 14,000 rpm for another minutes. Finally, RNA was resuspended with DEPC treated-water and μl of RNasin® (Promega, USA) was added to prevent degradation. The solution can be stored at -80 °C for year. 2.2.3 Northern blot 2.2.3.1 Hybridization After the agarose gel electrophoresis, RNA samples were transferred to Hybond™-N nylon membrane (Amersham, UK) overnight in 20X SSC. The membrane was then air-dried and cross-linked by UV irradiation on a 312 mm UV box for minutes. The subsequent procedures including probe labeling, pre-hybridization, posthybridization wash and photography were carried out using the same protocols for Southern blot described in section 2.1.5. 72 Materials and Methods 2.2.3.2 Membrane striping The probe hybridized on the membrane was stripped away by washing the membrane in striping solution (0.05X SET; 0.1% SDS) at 80 °C for 30 minutes. The membrane was air-dried and ready for re-probing. 2.3. Protein applications 2.3.1 in vitro coupled transcription and translation To prepare proteins from cDNAs of interest, in vitro translation was performed by a TNT® Lysate Coupled Reticulocyte Lysate Systems (Promega, USA). This system couples in vitro transcription/translation in a single-tube in one step. The typical reaction volume is 50 μl containing 25 μl of TNT® Rabbit Reticulocyte Lysate, μl of TNT® Reaction Buffer, μl of TNT® SP6 polymerase, μl of mM Amino Acid Mixture Minus Methionin, μl of 35S-methionine (1,000Ci/mmol) at 10mCi/ml, μl of Rnasin® Ribonuclease Inhibitor (40 U/ μl) and μg of plasmid DNA template. The reaction was incubated at 30 °C for hours. The labeled proteins were ready for further analysis. 2.3.2 SDS-polyacrylamide gel electrophoresis (PAGE) SDS-polyacrylamide gels were cast using the Bio-Rad protein mini-gel system. 10 ml of 10% w/v resolving gel and 10 ml of 4% w/v stacking gel were prepared as follows: Table 2-1 Ingredients of SDS-polyacrylamide gel Stocking solution 10% resolving gel 4% stacking gel 30% Acrylamine/Bis (30:0.8) 3.33ml 1.3ml 1M Tris-HCl pH8.8 3.75ml 1M Tris-HCl pH6.8 H2O 1.25ml 2.92ml 7.35ml 73 Materials and Methods 10% (w/v) SDS 0.1ml 0.1ml 25% (w/v) APS 20 μl 20 μl TEMED 10 μl 10 μl APS (ammonium persulphate) and TEMED (N, N, N, N-tetramethylethylene diamine) were added after the gel mixture was degassed. The resolving gel was poured into the space between the two plates to a height such that it was about mm from the bottom of the comb. The gel was layered with n-butanol to allow the polymerizaiton of polyacrylamide. After the resolving gel set, the butanol was decanted and the excess was removed by washing with water. The stacking gel was poured above the resolving gel and the comb was inserted. The gel was allowed to polymerize for 30 minutes. Protein samples were mixed with an equal volume of 2X sample buffer [50 mM TrisHCl, pH6.8; 6% (w/v) SDS; 15% (v/v) -mercaptoethanol; 0.1% (w/v) bromophenol blue and 50% (v/v) glycerol] and boiled for minutes before loading onto the wells. Electrophoresis was carried out in 1X protein gel running buffer [25 mM Tris-HCl, pH8.3; 192 mM glycine and 0.1% (w/v) SDS) at a constant voltage of 140 volts. After electrophoresis, the gel was stained in 50 ml of staining solution [0.1% (w/v) coomassie brilliant Blue; 45% (v/v) methanol; 10% (v/v) acetic acid] for 30 minutes. The gel was then destained in destaining solution [10% (v/v) methanol; 10% (v/v) acetic acid) for several hours to overnight. For storage, the gel can be dried by a Model 583 Gel Drier (Bio-Rad, USA) at 80 °C for hours. 2.4 Expression Analysis 2.4.1 Zebrafish 2.4.1.1 Fish maintenance Wild-type zebrafish (Danio rerio) were purchased from a local pet store, while 74 Materials and Methods different mutants of zebrafish were obtained from multiple resources (such as labs of collaboration). The fish were maintained basically according to the method described by Westerfield (1994). Normally, fish were fed twice per day with flakes (Aquori, USA). During the spawning period, the fish were fed with brine shrimps (World Aquafeeds, USA) and were kept under the photoperiod cycle set at 14 hours of day (light) and 10 hours for night (dark). In the day before embryo collection, the bottom of fish tank was covered with clean marbles. Embryos were collected by siphoning with a plastic pipe in the next morning. 2.4.1.2 Mutant lines of zebrafish Embryos from mutant fish lines were obtained from fishes maintained and established at the Institute of Molecular and Cell Biology, Singapore. The embryos from the mutant lines of fishes were collected in the same way as that of the wild type. The required developmental stages were presented as hours post-fertilization (hpf). The mutants used in this study are shh, sonic-you (syut4); gli2, you-too (yotty17a); smoothened, slow muscle omit (smob641); mindbomb(mibta52b); fgf8, acerebellar (aceti282a). 2.4.2 Microinjection The samples for injection were prepared to different concentrations in respective buffers. Morpholino antisense RNAs were prepared in 1X Danieau solution (58 mM NaCl; 0.7 mM KCl; 0.4 mM MgSO4; 0.6 mM Ca(NO3)2; 5.0 mM pH 7.6 HEPES). Sense RNAs were prepared in sterile filtered water to required concentrations. The needles used for the microinjection were prepared using optimized conditions of heat and pull time for different purposes using the Sutter Micropipette puller P-97 (Sutter Instruments Co, USA). The conditions for normal injections into 1-2 cell embryos used were Pressure-500, heat-500/550, pull-150/150, velocity-100/100 and time-150/150. RNAs and antisense oligos were injected into the cytoplasm of 1-2 cell stage zebrafish 75 Materials and Methods embryos using Picoinjector PLI-100 (Medical Systems Corp, Greenvale, NY, USA) by placing the embryos under a dissection microscope (Olympus SZX12). Each embryo received the specific volume of the samples depending on the concentration of the sample. The injected embryos were reared in egg water (1ml of egg water contains 10% NaCl, 0.3% KCl, 0.4% CaCl2, 1.63% MgSO4.7H2O, 0.01% methylene blue, and 95 ml ddH2O). 2.4.3 Anti-sense morpholino design Anti-sense oligos or morpholinos have become an attractive method to specifically block gene function (Nasevicius and Ekker, 2000; Summerton and Weller, 1997). Morpholino oligos are short chains of Morpholino subunits comprised of a nucleic acid base, a morpholine ring and a non-ionic phosphorodiamidate intersubunit linkage (Fig. 2-6). Morpholinos act via a steric block mechanism (RNAse Hindependent) and with their high mRNA binding affinity and exquisite specificity they yield reliable and predictable results. Design of an efficient antisense Morpholino required the careful consideration of certain criterias. The 25 bp antisense oligonucleotide sequences were designed to bind to the 5’UTR or flanking sequences including the initiation methionine (gli2bATG) or sequence between exon-intron junctions (gli2bSPL). To test the specificity of MOs, we also designed 4-base pair mismatched control MO (gli2bMMA and gli2bMMS). Gli2 MO was synthesized as reported (GAGGTGGGACTTGTGGTCTCCATGA, Wolff et al., 2003). Sequences of the designed MOs are: gli2bATG: CGGGAGCTGGAACACCGGCCTCCAT gli2bMMA: CGGGAGCTCGAACAGCGGCGTCCTT gli2bSPL: GCACTGTTTTACCTTGGTCTCCGTG gli2bMMS: GCTCTGTTTTAGCTTGCTCTCCCTG 76 Materials and Methods Fig. 2-6 Structures of DNA and morpholino oligonucleotides. R and R’ denote continuation of the oligomer chain in the 5’ or 3’ direction, respectively. (Reproduced from Corey et al., 2001) MOs were resuspended from lyophilized powder, and then diluted to 1mM stock in 1X Danieau’s solution. The MOs were diluted to the appropriate concentration and these were injected into the yolk stream of one to two cell stage embryos using a nanoinjecter (World Precision Instruments, Sarasota, Florida, USA). The general conditions for designing Morpholinos are as follows: 1) Select a target sequence in the post-spliced mRNA in the region from the 5'cap to about 25 bases 3' to the AUG translational start site. 2) It is important to ensure that the selected sequence has little or no selfcomplementarity. Preferably the selected Morpholino oligo should form no more than contiguous intrastrand base pairs. In some cases contiguous base-pairs can be detrimental to achieving good antisense results if the resulting pairing is between all G and C residues. 77 Materials and Methods 3) The antisense oligonucleotide may show reduced water solubility if it contains more than total guanines or more than contiguous guanines in a 25-mer oligo. 4) 25-Mers (the longest commercially available) are recommended for most applications. This is because efficacy increases substantially with increasing length and because long oligos best assure access to a single-stranded region in the target RNA, as is required for nucleation of pairing by the oligo. 5) In terms of composition and sequence motifs, an optimal splice-blocking oligo has the same properties described above for a translation-blocking oligo. However, splice-blocking oligos have additional target-specific requirements, the most important of which is a defined pre-mRNA sequence with a minimum of exons and explicitly known exon-intron and intron-exon boundaries. 6) For control Morpholinos, 4-5 base changes in the experimental design Morpholino is sufficient to eliminate specific binding activity. 2.4.4 Whole mount in situ hybridization on zebrafish embryos 2.4.4.1 Synthesis of labeled RNA probe 2.4.4.1.1 Linearization of plasmid DNA 5μg of plasmid DNA was linearized at the 5’ end of the cDNA insert by a proper restriction enzyme at 37°C for 45 minutes (section 2.1.2). Completion of linearization was confirmed by running the digestion product on 1% agarose gel. After confirming, the linearized fragment was purified by phenol:chloroform precipitation. The total volume of digestion mix was made up to 100 μl and equal volume of 1:1 phenol:chloroform was added (the lower strata containing the phenol was used). This was followed by centrifugation at 14,000 rpm for minutes at room temperature. The top layer was removed to a fresh tube and 1/10th 1M Sodium acetate and 2X volume of 78 Materials and Methods cold absolute ethanol was added. This mix was incubated on ice for 30-45 minutes and centrifuged for 30-45 minutes. The supernatant was carefully discarded without disturbing the pellet. The pellet was washed with 75% ethanol for minutes at 14,000 rpm. The pellet was then resuspended in 50-100 μl of sterile water or TE buffer for further use. The linearized DNA can be further visualized by running on a 1% agarose gel and quantitated by spectrophotometry. 2.4.4.1.2 Probe incubation and precipitation 1μg of linearized DNA was used to synthesize the DIG/Fluorescein probe. The reaction was performed at 37°C for hours in a total volume of 20μl containing 4μl of 5X transcription buffer (Stratagene, USA), 2μl of DIG/Fluorescein-NTP mix [10mM ATP, 10mM CTP, 10mM GTP, 6.5mM UTP and 3.5mM DIG/Fluorescein-UTP (Boehringer Mannheim, Germany)], 1μl of RNase inhibitor (40U/μl) (Promega, USA) and 1μl of T7 RNA polymerase (50U/μl) (Promega, USA). Following the reaction, 2μl of RNase-free DNase I was used to digest the DNA template at 37°C for 15 minutes. μl of 0.5M EDTA (pH 8.0) was used to stop the restriction digestion. Subsequently, 2.5μl of 4M LiCl and 75μl of cold pure ethanol were added to precipitate the RNA. After washing with 75% ethanol, the RNA probe was resuspended in 60μl of DEPC treated water and cleaned using a Chroma Spin-100 DEPC H2O Column (Clontech, USA) by centrifuging at 700g for minutes to remove the impurity and small RNA fragments. 2.4.4.1.3 Quantification of labeled probe The labeled probe was quantified visually by Gel Electrophoresis and quantitated using spectrophotometric analysis at OD260/280 nm. 2.4.4.2 Preparation of zebrafish embryos 2.4.4.2.1 Embryo collection and fixation 79 Materials and Methods All zebrafish embryos used in this study were staged according to the Zebrafish Book (Westerfield, 1989) and indicated as hours post fertilization (hpf) at 28.5°C. Staged embryos were fixed in 4% paraformaldehyde (PFA)/PBS (0.8% NaCl, 0.02% KCl, 0.0144% Na2HPO4. 0.024% KH2PO4, pH 7.4) for 12 to 24 hours at room temperature or 4°C. Embryos younger than 16 hpf were fixed before dechorionization and the chorion was removed afterwards. Embryos older than 16 hpf were dechorionated before fixation. Older embryos with tails were hibernated on ice before fixation to prevent the curling of tails. After fixation, the embryos were washed in PBST (0.1% Tween.20 in PBS) twice for minute each, followed by four times for 20 minutes each on a nutator (ClAY ADAMS® Brand, Becton Dockinson, USA) at room temperature. After changing PBST to methanol, the embryos were kept at -20°C for several months. Before they were used for in situ hybridization, the embryos were rehydrated in PBS in two or three times by changing half volume of solution each time. 2.4.4.2.2 Proteinase K treatment This step is especially necessary for embryos older than 14 somites (>16hpf). Embryos were treated with 10μg/ml of proteinase K in PBST at room temperature. The time of exposure depended upon embryos age and the specific activity of proteinase K, which varied from batch to batch. For most cases, the conditions used are as given. 16-24 hpf 3-4 minutes 24-32 hpf 5-6 minutes 32-50 hpf 10-20 minutes To stop the reaction, the proteinase K solution was removed completely, and the embryos were fixed again in 4% PFA/PBS for 20 minutes at room temperature. Embryos were first washed in PBST twice for minute and then 4-5 times for 15-20 minutes each. 80 Materials and Methods 2.4.4.2.3 Prehybridization Prehybridization was performed by changing half the volume of washing solution with hybridization buffer [50% formamide, 5X SSC, 50 μg/ml Heparine, 500 μg/ml tRNA, 0.1% 0.1% Tween.20, pH6.0 (adjusted bycitric acid)] and incubated at room temperature for hour. This solution was removed and replaced with hybridization buffer; embryos were incubated at 68°C for 5-10 hours. 2.4.4.3 Hybridization 1-2μl of DIG-labeled probe was diluted in 200μl of hybridization buffer. The probe was denatured by heating at 80°C for minutes followed by minutes of ice bath. Embryos of different stages or treatments were selected and placed in one tube or separate tubes depending on the experimental conditions. The original buffer was replaced with the denatured probe dissolved in hybridization buffer. Hybridization was performed at 68°C in a circulating water bath overnight with shaking. 2.4.4.4 Post-Hybridization washes The next day, the probe was removed and replaced with prewarmed 100% hybridization wash solution (hybridization buffer without tRNA and heparine) for 15 minutes. The embryos were then washed in the following order of wash solutions 75% hybridization wash solution: 25% 2X SSCT (SSC with 0.1% Tween.20), 50% hybridization wash solution:50% 2X SSCT, 25% hybridization wash solution:75% 2X SSCT for 15-20 minutes each. This was followed by 2X SSCT wash twice for 30-45 minutes each and 0.2X SSCT wash twice for 30-45 minutes each. Subsequently, the embryos were washed twice with PBST (PBS with 0.1% Tween.20) at room temperature for minutes each. 2.4.4.5 Antibody incubation 2.4.4.5.1 Preparation of preabsorbed DIG 81 Materials and Methods Commercial DIG-AP antibodies (Boehringer) should be preincubated with biological tissues, preferably of the same origin as the sample used for hybridization, in order to decrease the staining background and increase signal-to-noise ratio. Anti-DIG and Fluorescein-AP was diluted to 1:500 and 1:50 in Maleic Acid buffer (0.15M Maleic acid, 0.1M Nacl; pH 7.5)/10% FCS (Fetal calf serum, Gibco BRL) respectively and incubated with 50 zebrafish embryos of any stages on a nutator at 4°C overnight. After that, the antibodies solution was transferred to a new tube and diluted to 1:5000 and 1:500 with Maleic Acid buffer/10% FCS. 10μl of 0.5M EDTA (pH8.0) and 5μl of 10% sodium azide were added to prevent bacterial growth. The preabsorbed antibody was stored at 4°C and can be used for many times. 2.4.4.5.2 Incubation with preabsorbed antibodies The embryos after hybridization and post hybridization washes were incubated in Maleic Acid buffer/10% FCS for hours at room temperature to block non-specific binding sites for antibody. After removing the blocking solution, the embryos were incubated with preabsorbed anti-DIG-AP antibody at 4°C overnight. 2.4.4.6 Color development Embryos were washed in PBST twice for minute each, and times for 15-20 minutes each on a nutator at room temperature followed by washing in buffer 9.5 (0.1M Tris-HCl, pH9.5, 50mM MgCl2, 10mM NaCl and 0.1% Tween.20) once for 30 seconds and twice for 10 minutes each. 4.5μl of NBT (Nitroblue tetrazolium, Boehringer Mannheim, 50mg/ml in 70% dimethyl formamide) and 3.5μl of BCIP (5-bromo, 4chloro, 3-indodyl phosphate salt, Boehringer Mannheim, Germany; 50mg/ml in H2O) was added into 1ml of buffer 9.5 with embryos and mixed thoroughly. Embryos were kept in dark at room temperature for few minutes to several hours, and the progress of staining was monitored from time to time under a Leica MZ12 microscope (Leica, 82 Materials and Methods Germany). To stop the reaction, staining solution was removed and the embryos were washed in 1X PBST twice for 10 minutes each. Embryos can be preserved in 4% PFA/PBS at 4°C. 2.4.4.7 Mounting and photography Selected embryos were washed with PBST twice for 10 minutes each and transferred to 50% glycerol/PBS, equilibrated at room temperature for several hours. For whole mounts, a single chamber was made by placing stacks of 3-5 small cover glasses on both side of a 25.4X76.2 mm microscope slide. Small cover glasses in the stacks will be perfectly solid hour after placing a drop of Permount between them. Selected embryo was transferred to the chamber in a small drop of 50% glycerol/PBS and oriented by a needle. A 22X44 mm cover glass with a small drop of the same buffer was superimposed onto the embryo. The orientation of the embryo can be adjusted by gently moving the cover glass. For flat specimen, the yolk of selected embryo was removed completely by needles. The embryo without yolk was then placed onto a slide with a small drop of 50% glycerol/PBS and adjusted to a proper orientation by removing excess of liquid and with the help of needles. A small fragment of cover glass (a bit larger than the specimen) was covered onto the embryo. Care was taken to avoid bubbles and a drop of 50% glycerol/PBS was added to fill the space under the cover glass. This specimen was sealed with nail polish along the edge of the cover glass to prevent it from drying. Photographs were taken using a camera mounted to an Olympus AX-70 microscope (Olympus, Japan). The films used were Kodak Gold 200 and 400 ASA. 2.4.5 Two-color whole mount in situ hybridization In two-color whole mount in situ hybridization, two distinct RNA probes labeled with DIG and Fluorescein, respectively, were applied to the same embryos. Fluorescein 83 Materials and Methods labeling was performed following the same procedure as in DIG labeling, however, by using Fluorescein-UTP instead of DIG-UTP. For hybridization, two probes were added to the same tube in a ratio of 2:1 Fluorescein to DIG (for that Fluorescein is less sensitive to be detected than DIG). After incubation at 68ºC for overnight, the extra probes were removed by washing in 2XSSCT (2XSSC+0.1% Tween®20) at 68ºC for hours, followed by another wash in 0.2XSSCT (0.2XSSC+0.1% Tween®20) at 68ºC for hours. The DIG detection was first carried out as described in the previous sections (see 2.4.4). Following the DIG staining with NBT/BCIP, the embryos were washed with MA buffer (0.15 M Maleic acid; 0.1 M NaCl; pH7.5) twice for 10 minutes each. To remove the phosphatase ability of first antibody, the embryos were incubated with 0.1 M glycine, pH 2.2 for 30 minutes at room temperature. After that, the embryos were washed in PBST four times for 10 minutes each and then incubated in blocking buffer (5% Blocking Reagent in MA buffer, Boehringer Mannheim, Germany) for hours at room temperature. Subsequently, embryos were incubated with Anti-Fluorescein-AP antibody at 4ºC for overnight. To detect the fluorescein signal, the embryos were first washed with MA buffer times for hour each, followed by wash with Buffer 8.2 (0.1 M Tris-HCl, pH8.2; 50 mM MgCl2 ; 10 mM NaCl and 0.1% Tween®20) three times for minutes each at room temperature. Embryos were then stained in staining buffer, a 1:1 mixture of Fast Red solution [by dissolving ½ Fast Red tablet (Boehringer Mannheim, Germany) in ml Buffer 8.2, spin down undissolved particles and transfer the supernatant to a new tube] and NAMP solution [a 1:100 dilution of NAMP stock (50 mg/ml Naphthol As-MX, Sigma, USA) in Buffer 8.2], for 1-3 hours. The stained embryos were washed in PBST twice for 10 minutes each and can be stored in 4% PFA/PBS for several months. 2.4.6 Immunohistochemical staining 84 Materials and Methods 2.4.6.1 Primary antibody incubation To improve the penetration of antibodies, 4% PFA/PBS fixed embryos were treated with cold acetone (-20ºC, to remove lipids from cell membrane) for minutes followed by washes with deionised water once and PBS three times for 10 minutes each. To block non-specific sites, embryos were incubated in 10% FCS/PBST for hours at room temperature. The embryos were then incubated with 1:200 dilution of polyclonal rabbit anti-Islet-1 antiserum or mouse anti-acelytated tubulin antiserum, mouse zn-5(i.e. zn-8) and mouse zrf-1 antibodies in 10% FCS/PBST for overnight at ºC. 2.4.6.2 Secondary antibody incubation After removing the primary antibody, embryos were washed in PBST briefly for times and additional times for 30 minutes each. The embryos were then incubated with an appropriate secondary antibody, for example, 1:1000 diluted HRP-conjugated anti- mouse IgM or rabbit IgG antibodies for overnight at 4ºC. After incubation with the secondary antibody, the embryos were washed in PBST briefly times and additional times for 30 minutes each. 2.4.6.3 Staining To detect the signal of secondary HRP conjugated antibodies, Fast DAB(Sigma, USA) tablet was dissolved in H2O or PBS (1tablet in ml). The solution was centrifuged 12,000 rpm for to remove the un-dissolved part. The supernatant was added into the tube containing embryos to be stained. 1μl of 30% H2O2 per ml was added to initiate staining and the progress of reaction was monitored under a dissection microscope (about several minutes). To stop the reaction, embryos were washed in H2O or PBS and then mounted in 50% glycerol/PBS. 2.4.7 in situ hybridization and immunohistochemistry on sections 2.4.7.1 Cryostat section 85 Materials and Methods Fixed or stained embryos or tissues were first transferred into molten 1.5% bactoagar –30% sucrose in a detached cap of eppendorf tube at 48 °C. Needles were used to adjust samples in desired orientation in the slowly hardening agar. After the agar block solidified, a small block was cut with razor to mount the sample in proper position. The block was then transferred into 30% sucrose solution and incubated at °C overnight. Subsequently, the block was placed on the frozen surface of a layer of tissue freezing medium cryostat (Reichert-Jung, Germany) on the prechilled tissue holder. The block was then coated with one drop of cryostat and frozen in liquid nitrogen until the block had solidified completely. The frozen block was placed into a cryostat chamber (Reichert-Jung, Germany) for 30 minutes to be equilibrated with chamber temperature of -25 °C. Normally, ten-micron-thick sections were made and placed on Superfrost Plus slides (Fisher, USA). The slides were dried on a 42 °C hot plate for about 30 minutes. The sections were fixed briefly with 4% PFA/PBS for 10 minutes and washed times in PBS for minutes each. Afterwards, the sections can be processed for further procedures and/or embedded in several drops of glycerol and covered with cover slip for observation. 2.4.7.2 Immunohistochemistry on sections After fixation and wash, the cryosections were first incubated with blocking solution [5% bovine serum albumin (BSA), 1% DMSO in PBST) for hours at room temperature. Mouse F59 monoclonal antibody at 1:10 dilution in PBST with 2% BSA and 1% dimethylsulphoxide. After overnight incubation at 4ºC, the sections were washed with PBST times for 15 minutes each. Secondary antimouse antibody labeled with fluorescein was applied at 1:500 dilution for hour at room temperature. The sections were then washed with PBST times for 15 minutes each and mounted in glycerol. 86 Materials and Methods 2.4.8 DAPI staining Some sections were further analyzed by staining with 1.5 ml of diluted 3.5 µM DAPI (4’, 6-diamidine-2-phenylidole-dihydrochloride) and incubated in the dark for 20 mins. The slides were then tilted to remove the staining solution and washed with PBST for 2X 20 mins. Once washing was completed, coverslip was mounted as described. 2.4.9 Confocal microscopy and imaging of living embryos after anesthetizing EGFP expression in live transgenic embryos was monitored under a Leica MZ FLIII stereomicroscope equipped for UV epifluorescence viewing. Living embryos after 18 hpf were anesthetized to facilitate manipulation of embryo position. 400 mg of Tricaine (3-amino benzoic acidethylester) (Sigma, USA) powder was dissolved in 97.9 ml of sterile water and the pH was adjusted to using Tris pH 8.0. Usually, µl of this solution was added in a Petri dish with selected embryos and after a few seconds, the embryos could be transferred for viewing. A viewing chamber was made by cutting a 12.5 mm diameter hole at the bottom of a 35 mm plastic petri dish and placing a coverslip outside to cover the hole. The coverslip was secured to the base of the petri dish using clear adhesive. 0.8% agarose was poured into the chamber and cut glass micro-capillaries of 0.8 cm were placed into the agarose to make lined spaces. Confocal images were acquired using Zeiss LSM510 scanning laser (Carl Zeiss Inc., Germany) using 488 nm excitation and 510-550 nm band-pass filters. Serial optical sections were taken at desired intervals using a 10X Plan-Neofluar 0.3 objective. Raw image collection and processing were performed using the LSM510 Software (Carl Zeiss Inc., Germany). Combined images were made on Adobe Photoshop5.5. 87 [...]... correlation in reciprocal changes in oligodendrocytes progenitors and motor neuron progenitors along the A-P axis of Gli2b morphants In addition, the roles of Gli2b and Gli2 in regulation of Hh downstream genes in neurogenesis have been further investigated in this study Gli2b plays a role in regulating Hh signaling in ventral hindbrain in a context dependent manner The knockdown of Gli2b combined with... the dominant negative Gli2 resulted in the complete blocking of Hh signaling in hindbrain Also comparison of Gli2b functions in WT and gli2 mutant yot-/- indicates a previously unknown role of Gli2b in rhombomere 4 In summary, this study explored the consequence of the duplication of Gli2 in zebrafish and differences in function of Gli2 between zebrafish and mice Also, it illustrated novel developmental... is also disrupted in the hindbrain of gli2b morphants The study demonstrates that the disruption of RA in Gli2b morphants is due to the change in activity of proneural or neurogenic genes, rather than the disruption of the earlier patterning of hindbrain rhombomeres By analyzing the expression of neuronal and glial markers in Gli2b morphants, this study also revealed a role of Gli2b in cell fate selection... Z 2005 Expression of a novel zebrafish zinc finger gene, gli2b, is affected in Hedgehog and Notch signaling related mutants during embryonic development Dev Dyn 232(2):479-486 Ke, Z., Gong, Z., Korzh, V 2006 Gli2/ 2b roles in zebrafish hindbrain development In preparation Symposia presentation: Ke, Z., Lim, E.s., Korzh, V., Gong, Z Characterization of gli2b gene in zebrafish neurogenesis 8th Biologcial... However, many questions remain regarding the roles of Gli2 in zebrafish despite the intense analysis This study demonstrated that there is a second Gli2 (Gli2b) in zebrafish which plays major roles in neurogenesis in contrast to the previously found Gli2, which will explain the functional differences of Gli2 between zebrafish and mice reported so far In this study, the zebrafish gli2b was cloned and mapped... 10 hpf, the embryo shows a morphogenetic movements involving development of somites, appearance of rudiments of primary organs and elongation of embryo with more prominent tail bud (Fig 1- 1F-H) In parallel, the dramatic change of morphology takes place during neurulation 15 Introduction Fig 1- 1 Camera lucida sketches of the zebrafish embryos at selected stages (reprint from Kimmel et al, 19 95) 16 Introduction... roles of Gli2 in neurogenesis, in particular in the development of r4 and radial astrocytes XII Introduction Chapter I INTRODUCTION 1 Introduction I INTRODUCTION 1. 1 Zebrafish as an emerging model for developmental studies Zebrafish (Danio rerio) emerge as one of the most promising experimental model for developmental biologists due to its several advantages compared with other experimental models Zebrafish. .. markers of neural precursors as well as XI Summary differentiated neurons have been used to trace the disruption of neurogenesis after knockdown of Gli2b Also, same markers have been applied for comparative analysis of the role of Gli2 Gli2b morphants show severe disruption in the hindbrain development, including the reduction of mitotic neural precursors and radial glial cells The segmental pattern of. .. duplicate genes in teleosts By analysis of the expression patterns in different mutants or other genetic modified embryos, this study also demonstrates that Hh and Notch, but not Fgf pathways are involved in regulating gli2b expression in later stages, although the early regulation of gli2b expression still remains unclear The functions Gli2b in neurogenesis were analyzed mainly by loss -of- function... orthologs may lead to a better understanding of developmental relations in cell lineage and tissue patterning in mammals It has been shown that many duplicated genes, instead of acquiring novel functions, redistribute their ancestral subfunctions (Hughes, 19 94, 19 99; Force et al., 19 99; Hughes, 19 99; Stoltzfus, 19 99) For a diversity of studies, polyploidy in zebrafish and other model fish species might . analysis of gli2b 91 3 .1. 4 Genome mapping of gli2b 99 3.2 Expression analysis of gli2b in zebrafish 10 2 3.2 .1 Temporal expression of gli2b in zebrafish embryos 10 2 3.2.2 Comparison of expression. patterns of the two gli2s of zebrafish during early development 10 3 3.2.3 Specific expression of gli2b during hindbrain development 10 5 3.3 The regulation of gli2b expression 10 7 3.3 .1 gli2b expression. segmentation of hindbrain 13 4 3.5 Characterization of gli2/ gli2b function within the Hh pathway 13 6 3.5 .1 gli2b and nkx2.2 expression 13 6 3.5.2 Inhibition of Gli2b caused abnormal development of oligodendrocytes