Characterization of gli2 2b genes in zebrafish hindbrain development 2

Results Chapter III RESULTS 88 Results III. RESULTS 3.1 Characterization of zebrafish gli2b gene 3.1.1. Isolation of full length zebrafish gli2b cDNA Using a pair of degenerate primers against the conserved zinc finger region of the mouse Gli genes (Hui et al, 1994), the PCR fragment of about 400 bp was previously amplified using the zebrafish embryonic cDNA as a template. Sequencing analysis of the PCR fragment revealed three distinct sequences which were identified to be zebrafish homologs of gli genes. Another pair of degenerate primers, GliF and GliR, was designed based on the sequences of these three gli sequences (Fig. 3-1,I). PCR was carried out using an aliquot of 24 hpf embryonic cDNA library as a template. In this round of amplification, several distinct zebrafish gli-like sequences were isolated and one fragment was then used to screen a zebrafish embryonic cDNA library and a cDNA clone (~2Kb) containing incomplete ORF corresponding to a novel gli gene of zebrafish was obtained (Lim, 2000). However, further attempts to acquire the full length cDNA clone were not successful at that time, probably due to the poor quality of cDNA library. To acquire a full-length cDNA clone, a fresh double stranded cDNA library using SMART TM RACE cDNA Amplification kit (Clontech) was constructed. Both 5’ and 3’ rapid amplification of cDNA ends (RACE) PCR were conducted using the two gene-specific primers based on the partial clone and the universal primers from the kit and both 5’ and 3’ ends of the novel gli cDNA were obtained using this method (Fig. 3-1,II). Finally, the complete novel gli cDNA sequence was amplified by RT-PCR using a new pair of primers (Gli2bF/Gli2bR) based on the each end of deduced sequence and cloned into pGEMT easy vector (Promega) (Fig. 3-1,II). 89 Results (I) Gli#6 Gli#5 Gli#4 100 100 100 Gli#6 Gli#5 Gli#4 AAGGACTGTTCCCGAGAGCAGCGTCCGTTTAAAGCGCAGTACATGCTGGT gt---g--c--t-----a---aag--t--c--g--c-----------t-g-c--g--c--a--c------aag--c--c-------------------5’- CCBTTYAARGCSCAGTACATGC GliF GGTGCACATGCGCAGACACACCGGAGAAAAACCACACAAGTGCACTTTTG -t-c-------ttc-------t--g--g--g--c--t--------a------c---------------------------------------------- Gli#6 Gli#5 Gli#4 AAGGCTGTAATAAAGCGTACTCGCGGCTGGAGAACCTGAAGACGCATCTG ----t--ctcg--g--t--t--t--a-----a--t--c--a--t---t--------------------------------------------------- 200 200 200 Gli#6 Gli#5 Gli#4 CGCTCACACACCGGAGAGAAACCCTACGTTTGTGAACACGAGGGCTGTAA 250 a-g--c-----a--g--------t-----a--c--g-------------250 -------------------------------------------------250 5’- GTGCTCCCGACATTGTTCCSRAA GliR CAAGGCTTTCTCTAATGCTTCAGATCGAGCAAAGCACCAGAACAGAACAC 300 -----gc--t--c--c--------c--g--c---------cc-c-c--g300 -------------------------------------------------300 Gli#6 Gli#5 Gli#4 150 150 150 (II) ~2.0k (Lim 2000) ~1.2k Gli2bF 5’ RACE 3’ RACE ~4.7k gli2b cDNA ~1.7k Gli2bR Fig. 3-1 Isolation and cloning of full length zebrafish gli2b cDNA clone. (I). A pair of degenerate primers used for screening the cDNA library (modified from Lim, 2000). (II). Schematic representation of 5’ RACE and 3’ RACE PCR amplification of both ends of the gli2b cDNA and the isolation of full length gli2b cDNA. 90 Results 3.1.2. The novel gli cDNA encodes a second Gli2 of zebrafish The complete novel gli clone is 4,730 bp long (GenBank access number AY928397) and encodes a polypeptide of 1363 amino acids (Fig. 3-2). It shares 95.1-96.9% identity in zinc-finger domains and 50.5-62.5% identity for overall amino acid sequence with Gli2. The deduced amino acid sequence shares the highest identity with zebrafish Gli2 (96.9% in zinc-finger domain and 62.5% for overall amino acid sequence). In comparison, it has only 44% identity with Gli3 proteins and 35% identity with Gli1 proteins. Thus, this novel gli gene was named as gli2b. As shown in Fig. 3-3, the sequence alignment of mouse Gli2 proteins indicated that the sequence similarity is high in the N-terminal, including the five zinc-finger domains and six putative Protein Kinase A binding domains. However, the proposed cyclic-AMP response element binding protein (CBP) binding site (Hughes et al, 1997) and the herpes simplex viral protein 16 (VP-16) -like activator binding domain (Yoon et al,1998) of Gli2b are relatively divergent comparing to Gli2 suggesting divergence of functions of these two proteins. 3.1.3 Phylogenetic analysis of gli2b To determine the phylogenetic relationship among members of the Gli family, the amino acid sequences of the zinc finger domain and its surrounding regions were analyzed by the software for phylogenetic analysis, PAUP 3.1. As shown in Fig. 3-4, there are three subfamilies of Gli proteins (Gli1, Gli2 and Gli3) in vertebrates. A phylogenetic analysis of selected vertebrate Gli protein sequences indicated that zebrafish Gli2b was clustered with all other vertebrate Gli2 proteins and was the closest to zebrafish Gli2. In parallel, it seems that Gli2 and Gli3 subfamilies are more closed related comparing to Gli1 subfamily. 91 Results /Gli2bF 5’ RACE 92 Results R1 93 Results 3’ RACE 94 Results Gli2bR Fig. 3-2 The complete nucleotide sequence of the zebrafish gli2b cDNA and deduced amino acid sequence. The position of nucleotides and amino acid residues is indicated on the left. The primers (MAF/MAR) used for gene mapping are indicated by arrows. The black box indicates the sequence of gli2b MO used to block Gli2b translation. The five zinc finger domain is boxed. R1 is 3’ primer used for examining efficiency of the gli2b splicing MO (see section 3.4.1). Gli2bF/Gli2bR and 5’RACE and 3’RACE represent primers indicated in Fig.3-1. 95 Results 96 Results Fig. 3-3 Alignment of the zebrafish Gli2b with zebrafish (z) and mouse (m) Gli2 proteins. Identical amino acid residues are highlighted either in black (identical in all three sequences) or in grey (identical in two sequences). Dots represent gaps inserted for maximal alignment, and numbers of amino acid residues in each sequence are indicated on the right. The specific domains and motifs are indicated by lines or boxes: solid line with Roman numbers, five zinc-finger domains; dashed line, phosphorylation site of protein kinase A; solid box, potential CBP (cyclic AMP response element binding protein) binding site; and dashed box, VP-16 activator-like domain. 97 Results 3.2 Expression analysis of gli2b in zebrafish 3.2.1 Temporal expression of gli2b in zebrafish embryos Temporal expression of gli2b was first compared with that of gli2 and sonic hedgehog (shh) by unsaturated reverse transcriptase-polymerase chain reaction (RT-PCR) analyses (25 cycles; Fig. 3-7). Both gli2b and gli2 transcripts are present as maternal mRNAs, but the level of gli2b mRNA at the one-cell stage appeared to be relatively higher than that of gli2. After this initial phase, both gli2b and gli2 mRNAs decreased during the late gastrulation, followed by a major increase around 10 hpf at the beginning of neurulation. As the expression of shh and tiggy-winkle hedgehog (twhh) starts at around 50–60% epiboly (Ekker et al, 1995), the early gli2b expression is unlikely to be required within a context of the Hh signaling; thus, Gli2b may have an early Hh-independent role at the blastula stage. Given the fact that Gli2 acts as a repressor in absence of Hh signal, it is possible that during early development Gli2b acts to keep targets of Hh signaling suppressed. Whether this is a case is unclear and further analysis is needed for this idea to be proved. Alternatively, it could be stored in preparation for Hh activation at 5-6 hpf. Also, the increase of gli2b expression at the beginning of neurulation indicated a requirement for gli2b in early neurogenesis. Fig. 3-7 Temporal expression of gli2b as defined by RT-PCR. A comparison of temporal expression of gli2b, gli2, and shh. Total RNA was prepared from embryos at selected embryonic stages from one-cell stage to 48 hours postfertilization stage. The one-step reverse transcriptase-polymerase chain reaction was performed to 25 cycles to avoid amplification saturation. 102 Results 3.2.2. Comparison of expression patterns of the two gli2s of zebrafish during early development The spatial expression of gli2b during zebrafish embryogenesis was examined and compared with that of gli2 by whole-mount in situ hybridization (WISH) (Fig. 3-8). At hours post fertilization (hpf), most of gli2b mRNA was detected in cell nuclei (Fig. 3-8A) and later in the cytoplasm (6 hpf, Fig. 3-8B), indicating a temporal regulation of gli2b mRNA nuclear export, which could be important for initiation of the Gli2b early developmental function. By the end of gastrulation, gli2b transcripts were mostly found in the anterior neural keel (Fig. 3-8C), excluding the region corresponding to the zona limitans intrathalamica (ZLI). This finding is in a sharp contrast to expression pattern of gli2, which transcripts were detected mostly in the lateral mesoderm with only a single patch in the neural keel corresponding to the midbrain (Fig. 3-8E). By 18 hpf, expression of gli2b was intense in the anterior neural tube except for the ZLI and the midbrain–hindbrain boundary (MHB; Fig. 3-8D). At 24 hpf, expression patterns of gli2b and gli2 still differ substantially. gli2b transcripts were present in the ventricular zone of telencephalon, posterior thalamus, optic tectum (Fig. 3-8F), and hindbrain, including the cerebellum (Fig. 3-8G). Cross-sections at the hindbrain level showed that gli2b mRNAs were missing from the most ventral neural tube but expressed evenly in its dorsal aspect (Fig. 3-8H), similar to that of Gli2 expression in the dorsal neural tube in mice. In contrast, gli2 transcripts were found in the anterior diencephalon, throughout the midbrain and the MHB, but reduced in the hindbrain (Fig. 3-8I, J). At the MHB, expression of gli2b was also different from that of gli2. gli2b expression was detected in the rhombomere (Fig. 3-8G), whereas gli2 transcripts were present in the entire MHB (Fig. 3-8J). In the ventral diencephalon, differential expression of gli2 and gli2b transcripts was also observed: gli2b 103 Results transcripts were found in the posterior hypothalamus (Fig. 3-8K), whereas gli2 transcripts were found in the infundibulum (neurohypophysis; Fig. 3-8L). Fig. 3-8 The spatial pattern of gli2b expression during zebrafish embryogenesis. WISH was performed as described in the Experimental Procedures section. The stages and views of embryos as well as probes used for in situ hybridization are indicated in each panel. (A) A hours postfertilization (hpf) embryo. Note that gli2b mRNA is present mainly in the nuclei. (B) A hpf embryo. gli2b transcripts are found in the cytoplasm. (C, E) Flat mounted three-somite stage embryos hybridized with the gli2b (C) and gli2 (E) probes, respectively. (D) Dorsal view of the anterior portion of an 18 hpf embryo hybridized with the gli2b probe. (F, G) Lateral (F) and dorsal (G) views of 24 hpf embryos hybridized with the gli2b probe. (H) Cross-section of the 24 hpf embryo in (G) at the otic vesicle level (dashed line in G). (I, J) Expression of gli2 provided for comparison (F, G). (K, L) Expression of gli2b (K) and gli2 (L) mRNA in the ventral diencephalon of 48 hpf embryos. Anterior/posterior (A-P) axis and adenohypophysis (broken line) of embryo are marked. ahp, adenohypophysis; di, diencephalon; FMB, forebrain-midbrain boundary; hb, hindbrain; hp, hypothalamus; mb, midbrain; MHB, midbrain-hindbrain boundary; ot, optic tectum; ov, otic vesicle; pt, posterior thalamus; te, telencephalon; ZLI, zona limitans intrathalamica. 104 Results A comparison of the expression patterns of zebrafish gli2s (gli2b and gli2) with mouse Gli2 (Gli2) is also shown in Table 3-1. Table 3-1 Summary of expression patterns of zebrafish gli2s and mouse Gli2. Expressed region gli2b gli2 Gli2 Early neural plate Somites midbrain hindbrain Widely expressed in most regions Mostly expressed in midbrain regions Widely expressed in most regions No detectable expression. Low level High level High level High level Low level High level High level High level 3.2.3. Specific expression of gli2b during hindbrain development During brain development, gli2b expression became more restricted. In particular, it showed a dynamic expression during hindbrain development. After an early period of relatively uniform expression, expression in the hindbrain acquires a characteristic pattern at 32 hpf in the dorsal hindbrain (Fig.3-9A); it increased in the bilateral domains in the lateral hindbrain at the level of rhombomere 4–6 (r4 –r6; 36 hpf, Fig.3-9B), which became more intense at 40 hpf and consolidated into two loops in position of r5–6 (Fig.3-9C). This pattern is reminiscent of the lateral looped clusters of zath3 expression (Wang et al, 2003) and expression of genes associated with development of the neural crest cells (NCC) (Odenthal and Nusslein-Volhard, 1998). Their emergence was followed at 48 hpf by the appearance of the gli2b-positive midline domains at the same antero-posterior (A-P) level (Fig.3-9D,E). This area corresponds to the region of low level gli2 expression in a more dorsolateral position (Fig.3-9F), indicating a potential distinction of roles that gli2b and gli2 play in the hindbrain. The cross-sections at 48 hpf demonstrated that gli2b expression was present in bilateral medial clusters and clusters above the otic vesicle (Fig.3-9G). To map position of Gli2b expressing clusters, we used double staining by WISH for gli2b expression and anti-zrf1 antibody to label the radial astrocytes (RAs) located close to 105 Results the rhombomeric boundaries (Trevarrow et al, 1990). As shown in Figure 3-9H–J, the medial domains of gli2b expression are associated with the endfeet of RAs. J r5 r6 Fig. 3-9 gli2b expression in the hindbrain during late development. (A–D) Dorsal view of the temporal change of gli2b expression pattern in rhombomeres 4–6 in the hindbrain region at 32–48 hours postfertilization (hpf). (E, F) Lateral view of 48 hpf embryos hybridized with the gli2b (E) and gli2 (F) probes, respectively. (G) Cross-section of the 48 hpf embryo at the level indicated by the dash line in (E). gli2b mRNA is detected in two clusters in the medial part of the neural tube (arrows) and bilaterally immediately above the otic vesicle (arrowheads). (H) Two-color staining of a 48 hpf embryo by using gli2b riboprobe and zrf-1 antibody to demonstrate close association of gli2b-positive domains with the endfeet of radial glia distributed in a checkered manner. (I) Enlargement of the region boxed in (H). (J) Montage of gli2b expression shown in (H, I). Expression domain of gli2b was redrawn in blue for clarity. The lateral clusters of gli2b-positive cells projected in between curtains of the radial glia clusters. ov, otic vesicle; r, rhombomere. 106 Results 3.3 The regulation of gli2b expression 3.3.1 gli2b expression and Shh signaling Being a member of the gli gene family, gli2b is likely to play a role in regulating Hh signaling. Therefore, we examined gli2b expression in the hindbrain of three zebrafish mutants affecting the Hh signaling: sonic you (syu-/-), smoothened (smu-/-), and you too (yot-/-). In yot-/- mutants where the Gli2 dominant repressor appears (Karlstrom et al, 2003), gli2b expression was not much affected (Fig. 3-10B). Thus expression of gli2b does not mainly depend on other members of the family and could not be suppressed by dominant negative Gli2. In syu-/- mutants where the function of Shh is reduced (Schauerte et al, 1998), the late gli2b expression was largely reduced in the midline clusters but expression in dorsal clusters was unaffected (Fig.3-10C). Similarly during early development at 11 hpf, gli2b expression in syu-/- was almost identical to that in control (data not shown but similar to Fig.3-8C). Since in zebrafish there is one more shh ortholog, twiggy winkle hedgehog (twhh), the early expression of gli2b in syu-/- could be due to maintenance by Twhh. Therefore, we examined gli2b expression in smu-/- mutant, where a common receptor of all Hh proteins is affected resulting in much more severe phenotype than that of syu-/- (Chen et al, 2001). In smu-/- mutants, gli2b expression in midline clusters completely disappeared at 48 hpf. However, the gli2b-positive lateral clusters were almost unaffected (Fig. 3-10D). The embryos treated with a pan-Hh inhibitor cyclopamine (Incardona et al, 1998) showed gli2b expression similar to that of smu-/- (Fig.3-10E). To further demonstrate the relationship between Hh and gli2b, zebrafish embryos were injected with synthetic shh mRNA. As shown in Figure 3-10F, overexpression of shh enhanced gli2b expression in the midline clusters, but eliminated gli2b 107 Results expression in the lateral clusters in 48 hpf embryos. Since there is no shh expression in the lateral part of hindbrain, the expression of gli2b in the lateral domains could be similar to the early expression independent of Hh and is more likely to be dependent on other signaling such as BMP or FGF. Thus, it is apparent that expression of gli2b in the ventral neural tube is dependent on Hh signaling, while in the lateral domains expression of Gli2b is inhibited by ectopic expression of Hh. 108 Results gli2b dorsal WT/48 hpf A dorsal yot-/-/48 hpf gli2b dorsal smu-/-/48 hpf B gli2b dorsal syu-/-/48 hpf C gli2b dorsal cyclopamine/48 hpf E gli2b D gli2b dorsal shh mRNA/48 hpf F Fig. 3-10 gli2b expression in the 48 hpf hindbrain is Hh dependent. Expression of gli2b in the hindbrain of (A) control embryo; (B) gli2 mutant: yot; (C) shh mutant: syu; (D) smoothened mutant: smu; (E) embryo treated with cyclopamine from hpf; (F) embryo injected with shh mRNA. Arrows indicate lateral gli2b-positive clusters, arrowheads indicate medial gli2b-positive clusters. 109 Results 3.3.2. gli2b expression is altered in embryos deficient in components of Notch signaling It is well documented that Notch signaling is necessary in determination of the neural precursor fate by lateral inhibition (Wang and Barres, 2000; Schweisguth, 2004). While this pathway functions upstream of Hh signaling during neurodifferentiation a feedback loop could exist between these two pathways, since Hh was implicated in regulating cell proliferation (Chen et al, 2001). In addition, Notch has been implicated in the neuron-glia fate choice (Chapter 1.3.5). The disruption of Notch signaling might affect gli2b expression. In mind bomb (mib-/-) mutant, which loses the function of the E3 ubiquitin ligase required for effective Delta function (Itoh et al, 2003), the abnormal Notch signaling caused precautious differentiation of neural precursors causing a strong phenotype in the CNS (Schier et al, 1996; Jiang et al, 1996; van Eeden et al, 1996). In mib mutants, there is an excessive production of early neurons and a concomitant reduction in the number of later-born (secondary) neurons (Park and Appel, 2003). Interestingly, by 24 hpf gli2b expression in the hindbrain was strongly affected in mib-/- mutants (Fig. 3-11C, D), where it became patchy in contrast to controls (Fig.3-11A, B). At 48 hpf, gli2b expression in the hindbrain almost disappeared in mib-/- but in controls it continued. The lack of gli2b expression in the mutant hindbrain most probably reflects the absence of gli2b-expressing cells in mib-/- mutant because of the premature differentiation of early neural precursors (Schier et al, 1996; Jiang et al, 1996; van Eeden et al, 1996). Therefore, gli2b expression in mib-/- might be eliminated very early already at the level of neural precursor cells. 110 Results gli2b dorsal WT/24 hpf A gli2b dorsal WT/48 hpf B gli2b C dorsal mib-/-/24 hpf gli2b dorsal mib-/-/48 hpf D Fig. 3-11 Late gli2b expression is affected in mib-/- embryos. (A, C) A dorsal view of the gli2b expression pattern in the midbrain and hindbrain in 24 hpf control (A) and mib-/- (C) embryos. (B, D) A dorsal view of the gli2b expression pattern in the midbrain-hindbrain boundary and hindbrain in 48 hpf control (B) and mib-/- (D) embryos. 111 Results 3.3.3 gli2b expression in the lateral domains and MHB is not regulated by Fgf3/8 Since there are some reports that support a possible regulation of gli expression by FGF, we also examined the expression of gli2b in fgf8 mutant, acerebellar (ace) (Reifers et al, 1998). The expression of gli2b in the hindbrain in this mutant is not affected (data not shown). A redundancy of fgf3 and fgf8 functions was proposed. In the zebrafish hindbrain, Fgf3 and Fgf8 mediated a rhombomere signaling activity and together they are required for the development of rhombomeres adjacent to r4, particularly r5 and r6 (Maves et al, 2002). This raised the possibility that both Fgf3 and Fgf8 are required for the later expression of gli2b in r5 and 6. Upon knockdown of both Fgf3 and Fgf8, the gli2b-positive lateral clusters of the hindbrain were much more diffuse and found in more dorsal position (Fig. 3-12C, D). Also, in controls there is a strong expression of gli2b at the MHB (Fig. 3-12A), which is totally lost in fgf3/8 morphants (Fig. 3-12B). While deficiency of the gli2b expression at the MHB was expected and could be due to well-characterized effects of Fgf3/8 in this area, the abnormality of expression of gli2b in the lateral domains could be interpreted in terms of affected cell migration and morphogenesis due to delayed development in this area, while the expression of gli2b is not affected in both medial and lateral domains of the hindbrain. Thus, FGF signaling seems not involved in regulation of gli2b expression in the midbrain and hindbrain. 112 Results A B C D Fig. 3-12 gli2b and Fgf3/8. (A, B) a dorsal view of gli2b expression pattern in the midbrain and MHB in 48 hpf wild type (A) and Fgf3/8 morphants (B). (C, D) lateral view of gli2b expression pattern in the hindbrain in 48 hpf wild type (C) and Fgf3/8 morphants (D). 113 Results 3.4 gli2b and regulation of neural precursors 3.4.1 The anti-sense Gli2b MO effectively inhibits Gli2b function To knockdown Gli2b, we designed the two anti-Gli2b morpholino, one to inhibit Gli2b translation and the second to interfere with gli2b pre-mRNA splicing. The first morpholino (gli2bATG) (5’-CGGGAGCTGGAACACCGGCCTCCAT) was designed to block the proper translation (indicated in Fig.3-2). A egfp-tagged gli2b expressing vector with CMV promoter was made to test the activity of gli2bATG MO (Fig.3-13A). The mRNA of designed fusion protein shared the same 5’UTR and partial coding region as that of endogenous gli2b mRNA. Co-injection of 0.4 ng egfp-tagged gli2b and ≥ 0.3 pmol gli2bATG MO per embryo showed a successful knockdown. In this case the GFP expression in injected embryos was blocked. In contrast, when embryos were co-injected with egfp-tagged gli2b construct and mis-matched control MO (gli2bMMA) (5’- CGGGAGCTcGAACAgCGGCgTCCtT, the mismatched bases are in lower case), GFP expression was unaffected (Fig.3-13B). These results demonstrated the successful blocking of gli2b translation with gli2bATG MO. The second MO, gli2bSPL (5’-GCACTGTTTTACCTTGGTCTCCGTG), was designed to block the pre-mRNA splicing of gli2b. The sequence flanks one of the exon-intron junction regions. Although the zebrafish genome sequence is still fragmented and completed gli2b gene sequence could not be acquired, blasting of gli2b cDNA sequence against the genome database resulted in identification of a genomic sequence of gli2b that spanned several exons and adjacent introns (Fig. 3-14A, red bar). The region of exon-intron junction used to design splicing morpholino was re-sequenced. In addition, a 4bp mis-matched control MO (gli2bMMS) (5’- GCtCTGTTTTAgCTTGcTCTCCcTG, where the mismatched bases 114 Results are in low case) was designed for testing the specificity of gli2bSPL MO. The diagram in Fig. 3-14B shows the expected structure of mRNA after MO injection. In gli2bSPL morphants, the normal gli2b mRNA would not be detected by RT-PCR using one primer that crosses two exons (primer F1 partial A + partial B in Fig. 3-14A) and the other primer complementing with sequence of another exon (primer R1, indicated in Fig. 3-2). Instead the improperly spliced mRNA would be detected by RT-PCR using one primer that targets (F2 in Fig. 3-14A) in an intron and the other primer that is complementary to the following exon (R2 in Fig. 3-14A) or a distant exon (R1). The correctly spliced gli2b mRNA extracted from control morphants would be amplified by RT-PCR using F1/R1 but not by F2/R1. As shown in Fig. 3-14C, all these predictions were confirmed by RT-PCR. The detection of the faint band by F2/R2 could be due to the minor fraction of newly formed pre-mRNA which was not yet processed for splicing. These results indicated the appearance of the additional intron between exon A and exon B in the morphant gli2b mRNA (Fig.3-14C), and thus demonstrated a successful blocking of gli2b splicing with gli2bSPL MO. 115 Results gli2bMMA MO. gli2bATG MO. Fig. 3-13 Validation of gli2b MO for blocking translation of zebrafish gli2b. (A) Diagram shows the construction encoding GFP-tagged fusion protein. The fragment between the two dash lines represents the 5’ UTR plus partial gli2b coding sequence in-frame fused with egfp cDNA. Red bar indicates the designed gli2bATG MO. (B) left: GFP was expressed in most of 48 hpf embryos co-injected with gli2b-egfp-tagged construct and gli2bMMA MO; Right: no GFP expression could be observed in embryos co-injected with gli2b-egfp-tagged construct and gli2bATG MO. Photos were taken under UV light. 116 Results A 1.4k B Exon A 4.5k Exon B gli2b genomic seq. Exon C gli2bSpl MO. Exon B Exon A Exon C Ctrl mRNA F1 R1 F2 Exon A Exon B Exon C Morphant mRNA R1 R2 F2/R2 C F2/R1 EF1α F1/R1 C M C M C M 117 [...]... expression of gli2b in the ventral neural tube is dependent on Hh signaling, while in the lateral domains expression of Gli2b is inhibited by ectopic expression of Hh 108 Results gli2b dorsal A dorsal yot-/-/48 hpf gli2b dorsal smu-/-/48 hpf B gli2b dorsal syu-/-/48 hpf C gli2b dorsal cyclopamine/48 hpf E gli2b WT/48 hpf D gli2b dorsal shh mRNA/48 hpf F Fig 3-10 gli2b expression in the 48 hpf hindbrain is... dorsal WT /24 hpf A gli2b dorsal WT/48 hpf B gli2b C dorsal mib-/- /24 hpf gli2b dorsal mib-/-/48 hpf D Fig 3-11 Late gli2b expression is affected in mib-/- embryos (A, C) A dorsal view of the gli2b expression pattern in the midbrain and hindbrain in 24 hpf control (A) and mib-/- (C) embryos (B, D) A dorsal view of the gli2b expression pattern in the midbrain -hindbrain boundary and hindbrain in 48 hpf control... domains could be interpreted in terms of affected cell migration and morphogenesis due to delayed development in this area, while the expression of gli2b is not affected in both medial and lateral domains of the hindbrain Thus, FGF signaling seems not involved in regulation of gli2b expression in the midbrain and hindbrain 1 12 Results A B C D Fig 3- 12 gli2b and Fgf3/8 (A, B) a dorsal view of gli2b expression... splicing These results indicated the appearance of the additional intron between exon A and exon B in the morphant gli2b mRNA (Fig.3-14C), and thus demonstrated a successful blocking of gli2b splicing with gli2bSPL MO 115 Results gli2bMMA MO gli2bATG MO Fig 3-13 Validation of gli2b MO for blocking translation of zebrafish gli2b (A) Diagram shows the construction encoding GFP-tagged fusion protein The... pattern in the midbrain and MHB in 48 hpf wild type (A) and Fgf3/8 morphants (B) (C, D) lateral view of gli2b expression pattern in the hindbrain in 48 hpf wild type (C) and Fgf3/8 morphants (D) 113 Results 3.4 gli2b and regulation of neural precursors 3.4.1 The anti-sense Gli2b MO effectively inhibits Gli2b function To knockdown Gli2b, we designed the two anti-Gli2b morpholino, one to inhibit Gli2b translation... shown in Figure 3-9H–J, the medial domains of gli2b expression are associated with the endfeet of RAs J r5 r6 Fig 3-9 gli2b expression in the hindbrain during late development (A–D) Dorsal view of the temporal change of gli2b expression pattern in rhombomeres 4–6 in the hindbrain region at 32 48 hours postfertilization (hpf) (E, F) Lateral view of 48 hpf embryos hybridized with the gli2b (E) and gli2 (F)... zebrafish gli2s and mouse Gli2 Expressed region gli2b gli2 Gli2 Early neural plate Somites midbrain hindbrain Widely expressed in most regions Mostly expressed in midbrain regions Widely expressed in most regions No detectable expression Low level High level High level High level Low level High level High level High level 3 .2. 3 Specific expression of gli2b during hindbrain development During brain development, ... 3 .2 Expression analysis of gli2b in zebrafish 3 .2. 1 Temporal expression of gli2b in zebrafish embryos Temporal expression of gli2b was first compared with that of gli2 and sonic hedgehog (shh) by unsaturated reverse transcriptase-polymerase chain reaction (RT-PCR) analyses (25 cycles; Fig 3-7) Both gli2b and gli2 transcripts are present as maternal mRNAs, but the level of gli2b mRNA at the one-cell... shown in red Arrows indicate the primers (MBF and MBR) designed for genome mapping 100 Results A B LG11 gli2b myog LG9 gli2 en1 ihha dermo1 Mmu1 gli2 en1 ihh twist2 nme7 myog ndpk6 Fig 3-6 Mapping of zebrafish gli2b and synteny analysis (A) Mapping of zebrafish gli2b and comparison with the mouse chromosome region containing Gli2 The distances between markers in zebrafish linkage group 11 (LG11) are indicated... region of low level gli2 expression in a more dorsolateral position (Fig.3-9F), indicating a potential distinction of roles that gli2b and gli2 play in the hindbrain The cross-sections at 48 hpf demonstrated that gli2b expression was present in bilateral medial clusters and clusters above the otic vesicle (Fig.3-9G) To map position of Gli2b expressing clusters, we used double staining by WISH for gli2b . regulation of gli2b expression 3.3.1 gli2b expression and Shh signaling Being a member of the gli gene family, gli2b is likely to play a role in regulating Hh signaling. Therefore, we examined gli2b. used to block Gli2b translation. The five zinc finger domain is boxed. R1 is 3’ primer used for examining efficiency of the gli2b splicing MO (see section 3.4.1). Gli2bF/Gli2bR and 5’RACE. 3 - 6 Mapping of zebrafish gli2b and synteny analysis. (A) Mapping of zebrafish gli2b and comparison with the mouse chromosome region containing Gli2. The distances between markers in zebrafish