THÔNG TIN TÀI LIỆU
SỞ KHOA HỌC VÀ CƠNG NGHỆ TP HỒ CHÍ MINH THÀNH ðỒN TP HỒ CHÍ MINH CHƯƠNG TRÌNH VƯỜN ƯƠM SÁNG TẠO KHOA HỌC VÀ CÔNG NGHỆ TRẺ * BÁO CÁO NGHIỆM THU (ðã chỉnh sửa theo góp ý Hội ñồng nghiệm thu ngày 14/07/2010) NGHIÊN CỨU ỨNG DỤNG PHƯƠNG PHÁP NATIVEPAGE VÀ REAL-TIME PCR NHẰM KHẢO SÁT SỰ BIỂU HIỆN ENDOCHITINASE VÀ β-1,3-GLUCANASE Ở Trichoderma sp Chủ nhiệm ñề tài: ThS Thạch Thành Trung CN Nguyễn Thanh Phong Cơ quan chủ trì: TRUNG TÂM PHÁT TRIỂN KHCN TRẺ TP Hồ Chí Minh, tháng 07 năm 2010 Trang Lời cảm ơn Tóm tắt đề tài I Mục lục II Danh mục kí hiệu, chữ viết tắt III Danh mục bảng IV Danh mục hình, đồ thị V ðặt vấn ñề MỞ ðẦU Chương 1-TỔNG QUAN TÀI LIỆU 1.1 Vi nấm Trichoderma 1.1.1 Phân loại 1.1.2 ðặc điểm hình thái, sinh lí, sinh hóa 1.2 Hệ enzyme phân giải vách tế bào nấm 1.2.1 Chitinase 1.2.1.1 ðịnh nghĩa 1.2.1.2 Phân loại 1.2.1.3 Ảnh hưởng nguồn chất ñến sinh tổng hợp chitinase 1.2.1.4 Các gene mã hóa trọng lượng phân tử chitinase 1.2.2 β-glucanase 1.2.2.1 ðịnh nghĩa 1.2.2.2 Phân loại 1.2.2.3 Ảnh hưởng nguồn chất ñến sinh tổng hợp β-glucanase 1.2.2.4 Gene mã hóa trọng lượng phân tử β-1,3-glucanase 1.3 Khảo sát cảm ứng diện isozyme hệ chitinase β-1,3-glucanase Trichoderma phương pháp native-PAGE 11 1.3.1 Phương pháp PAGE 11 1.3.2 Phương pháp SDS-PAGE 12 1.3.3 Phương pháp native-PAGE 13 1.3.3.1 Ưu, nhược ñiểm phương pháp native-PAGAE 13 II 1.3.3.2 Các nghiên cứu ứng dụng phương pháp native-PAGE nhằm khảo sát cảm ứng diện isozyme chitinase β-1,3glucanase 14 1.4 Khảo sát cảm ứng biểu gene mã hóa chitinase β-1,3glucanase Trichoderma phương pháp real-time RT-PCR 15 1.4.1 Phương pháp PCR 15 1.4.1.1 Nguyên tắc 15 1.4.1.2 Các thành phần phản ứng PCR 16 1.4.1.3 Ưu, nhược ñiểm phương pháp PCR 17 1.4.2 Real-time PCR 17 1.4.2.1 Mẫu dò TaqMan 17 1.4.2.2 Chu kì ngưỡng 19 1.4.2.3 Ưu ñiểm ứng dụng phương pháp real-time PCR 20 1.4.2.4 Khảo sát biểu gene dựa vào mRNA 22 1.4.2.5 Phương pháp 2-∆∆Ct 23 1.4.2.6 Chứng nội 25 1.4.2.7 Chọn chứng nội mẫu chuẩn 26 1.4.2.8 Các nghiên cứu ứng dụng phương pháp real-time RT-PCR nhằm khảo sát cảm ứng biểu gene mã hóa chitinase β-1,3glucanase .27 Chương 2- NỘI DUNG NGHIÊN CỨU 2.1 Nguyên vật liệu thiết bị 30 2.1.1 Chủng vi nấm dùng thực nghiệm 30 2.1.2 Cơ chất 30 2.1.3 Môi trường nuôi cấy 30 2.1.4 Thiết bị 31 2.2 Nội dung 32 2.2.1 Phương pháp ñiều chế chitin huyền phù 1% 32 2.2.2 Phương pháp đo vịng phân giải 32 2.2.3 Qui trình ni cảm ứng 33 II 2.2.4 Phương pháp xác định hoạt tính chung chitinase 33 2.2.5 Phương pháp xác ñịnh hoạt tính chung β-glucanase 35 2.3 Nội dung 37 2.3.1 Phương pháp ñiều chế CM-chitin 37 2.3.2 Phương pháp thu nhận vách tế bào sợi nấm 38 2.3.3 Phương pháp xác ñịnh hoạt tính chung endochitinase 39 2.3.4 Phương pháp xác định hoạt tính chung β-1,3-glucanase 39 2.3.5 Thu nhận mẫu tủa protein 40 2.3.6 Xác ñịnh hàm lượng protein 40 2.3.7 Phương pháp SDS-PAGE 42 2.3.8 Xác ñịnh trọng lượng phân tử protein sau ñiện di SDS-PAGE 43 2.3.9 Phương pháp native-PAGE 44 2.4 Nội dung 45 2.4.1 Phương pháp tách chiết RNA tổng số 45 2.4.2 Thiết lập phản ứng RT-PCR 46 2.4.3 Thiết lập phản ứng PCR 46 2.4.4 ðiện di gel agarose 47 2.4.5 Thiết lập phản ứng real-time PCR 48 2.4.6 Phương pháp 2-∆∆Ct 48 2.4.7 Xử lí thống kê 49 Chương 3- KẾT QUẢ VÀ BIỆN LUẬN 3.1 Chọn lọc sơ chủng Trichoderma có khả sinh tổng hợp ñồng thời chitinase β-glucanase ngoại bào hoạt tính cao 51 3.1.1 Khả phân giải chitin β-glucan Trichoderma 51 3.1.2 Hoạt tính chung chitinase β-glucanase Trichoderma 52 3.2 Nghiên cứu ứng dụng phương pháp native-PAGE khảo sát diện isozyme endochitinase β-1,3-glucanase 53 3.2.1 Khảo sát thời gian ni cấy nồng độ chất thích hợp cho việc thu nhận enzyme 53 3.2.2 Khảo sát diện isozyme endochitinase β-1,3glucanase 59 II 3.2.2.1 Khảo sát diện isozyme endochitinase 60 3.2.2.2 Khảo sát diện isozyme β-1,3-glucanase 62 3.3 Nghiên cứu ứng dụng phương pháp real-time RT-PCR nhằm ñịnh lượng biểu gene mã hóa endochitinase β-1,3-glucanase 64 3.3.1 Khảo sát điều kiện ni cấy mơi trường SM 65 3.3.2 ðịnh lượng tương ñối biểu gene ech42 67 3.3.2.1 Thiết kế cặp mồi ñặc hiệu cho ech42 từ T longibrachiatum TD16 68 3.3.2.2 Thiết kế mẫu dò 72 3.3.2.3 Kiểm tra hệ thống real-time PCR 73 3.3.2.4 Khảo sát khả ứng dụng phương pháp 2-∆∆Ct 75 3.3.2.5 ðịnh lượng tương ñối biểu ech42 76 3.3.3 ðịnh lượng tương ñối biểu gene glu83 80 Chương – KẾT LUẬN VÀ KIẾN NGHỊ TÀI LIỆU THAM KHẢO PHỤ LỤC II DANH MỤC HÌNH SỐ TÊN HÌNH ẢNH TRANG 1.1 Khuẩn ty (a) quan sinh bào tử (b) Trichoderma harzianum 1.2 Vị trí cắt ba nhóm enzyme thuộc hệ chitinase 1.3 ðiện di gel polyacrylamide 11 1.4 Cấu trúc phân tử polyacrylamide 12 1.5 Các bước hoạt động mẫu dị TaqMan 19 1.6 Kết real-time PCR 20 1.7 Tính lặp lại cao phản ứng real-time PCR 21 1.8 Sự khác biệt khơng rõ ràng hai sản phẩm nhân có 21 số ban ñầu 10 50 gel agarose 1.13 Sự cảm ứng chitinase môi trường MM chứa 28 chitin glucose T harzianum 3.1 Các băng protein gel polyacrylamide sau chạy 61 native-PAGE nhuộm comassive brilliant blue nhuộm chất ñặc hiệu endochitinase gel agarose 3.2 Kết SDS-PAGE isozyme endochitinase 62 3.3 Các băng protein gel polyacrylamide sau chạy 63 native-PAGE nhuộm comassive brilliant blue nhuộm chất ñặc hiệu β-1,3-glucanase gel agarose v 3.4 Kết SDS-PAGE isozyme β-1,3-glucanase 64 3.5 Kết ñiện di sản phẩm nhân hai cặp mồi cho gene 69 18S rRNA ech42 gel agarose 3% 3.6 Kết ñiện di sản phẩm nhân hai cặp mồi cho gene 70 18S rRNA (S) ech42 (C) gel agarose 3% với mẫu RNA tổng số 3.7 Kết BLAST trình tự sản phẩm PCR gene ech42 71 3.8 Kết BLAST trình tự sản phẩm PCR gene 18S rRNA 71 3.9 Kết kiểm tra hệ thống real-time PCR cho gene 18S 74 rRNA 3.10 Kết kiểm tra hệ thống real-time PCR cho gene ech42 74 3.11 Kết ñiện di sản phẩm nhân ba cặp mồi cho gene 82 tag83 gel agarose 3% 3.12 Kết BLAST trình tự sản phẩm PCR gene tag83 83 3.13 Kết so sánh giống cột trình tự sản phẩm trình tự dự 83 kiến v DANH MỤC BIỂU ðỒ VÀ ðỒ THỊ SỐ TÊN BIỂU ðỒ TRANG 3.1 ðường kính VPG chitin β-glucan 10 chủng 52 Trichoderma 3.2 HTC chitinase β-glucanase 10 chủng Trichoderm 52 TÊN ðỐ THỊ 3.1 HTC endochitinase dịch canh trường TSM bổ sung 54 Deleted: , nồng ñộ chitin (0,5; 1,0; 1,5 2,0%) theo thời gian nuôi cấy 3.2 HTC β-1,3-glucanase dịch canh trường TSM bổ sung Deleted: , 56 Deleted: , nồng ñộ pachyman (0,5; 1,0 1,5%) theo thời gian nuôi cấy 3.3 HTC endochitinase dịch canh trường TSM bổ sung 57 nồng ñộ vách tế bào nấm S.R (0,5; 1,0 1,5%) P.C (0,5; 1,0 1,5%) theo thời gian nuôi cấy 3.4 HTC β-1,3-glucanase dịch canh trường TSM bổ sung 58 Deleted: , nồng ñộ vách tế bào nấm S.R P.C (0,5; 1,0 1,5%) theo thời gian nuôi cấy 3.5 HTC endochitinase dịch canh trường SM bổ sung 66 Deleted: , nồng ñộ chitin (0,5; 1,0 1,5%) hay vách tế bào nấm S rolfsii Deleted: , (0,25; 0,5 1,0%) theo thời gian nuôi cấy 3.6 HTC β-1,3-glucanase dịch canh trường SM bổ sung nồng ñộ vách tế bào nấm P capsici (0,25; 0,5 0,75%) theo v 66 Deleted: , thời gian nuôi cấy 3.7 Mối tương quan độ pha lỗng giá trị ∆Ct v 76 DANH MỤC BẢNG SỐ 1.1 TÊN BẢNG SỐ LIỆU Một số gen mã hóa enzyme tương ứng hệ chitinase TRANG Trichoderma sp 1.2 Một số gen mã hóa β-1,3-glucanase tương ứng 10 Trichoderma sp 3.1 Các thơng số lí thuyết cặp mồi ech42 18S 68 3.2 Các Thông số lí thuyết hai mẫu dị ech42 18S ñược 73 thiết kế 3.3 Giá trị ∆Ct hai gene nồng độ pha lỗng khác 75 3.4 Mức biểu tương ñối ech42 chủng T 77 longibrachiatum TD16 ni cảm ứng mơi trường SM chứa chitin 1,0% 3.5 Mức biểu tương ñối ech42 chủng T 77 longibrachiatum TD16 ñược nuôi cảm ứng môi trường SM chứa vách tế bào nấm S rolfsii 0,5% 3.6 Mức biểu mRNA ech42 HTR endochitinase theo 78 thời gian nuôi cấy dịch canh trường SM 3.7 Các thơng số lí thuyết ba cặp mồi tag83 IV 81 KẾT QUẢ VÀ BIỆN LUẬN - ðối với vách tế bào nấm, chất thô, thành phần vách tế bào nấm ña dạng Do vậy, biểu ech42 ñược ñiều hòa chế phức tạp nhiều, khơng đơn có mặt hay thiếu hụt chất cảm ứng, mà tác ñộng ña chiều lên cảm ứng biểu mức ñộ mRNA protein enzyme - Bên cạnh ñó biểu tăng hay giảm ñột ngột ñối với chất tế bào nấm S rolfsii ñược giải thích kích hoạt cộng hưởng ảnh hưởng ña hướng biểu mRNA protein khác Tuy HTR endochitinase ñược khảo sát thí nghiệm khơng phải riêng endochitnase 42 kDa qua kết cho thấy biểu mức mRNA ech42 hoạt tính endochitinase có mối tương quan Mức biểu ech42 chất vách tế bào nấm S rolfsii dù khơng ổn định chất chitin thời điểm thích hợp (48 giờ), biểu mRNA hoạt tính endochitinase cao nhiều ðiều giúp giải thích phần chế kháng nấm hiệu Trichoderma số lồi nấm bệnh thực vật, điển hình Sclerotium rolfsii 3.3.3 ðịnh lượng tương ñối biểu gene tag83 Từ liệu thu ñược GenBank (NCBI) kết mục 3.2, 3.3.1, cho thấy khơng có gene mang tính đại diện mã hóa β-1,3-glucanase Trichoderma spp gene ech42 Tuy nhiên có cơng bố uy tín trình tự gene tag83 từ Trichoderma spp Do chúng tơi tiến hành định lượng tương đối biểu gene từ T longibrachiatum TD16 Khi chủng ni cảm ứng mơi trường SM chứa 0,5% vách tế bào nấm P capsici Tương tự trường hợp ech42, chúng tơi thiết kế cặp mồi ñặc hiệu cho việc nhân tag83 từ cDNA 80 KẾT QUẢ VÀ BIỆN LUẬN Thiết kế cặp mồi ñặc hiệu cho glu83 từ T longibrachiatum TD16 Ba cặp mồi tag83 thiết kế dựa vào trình tự bảo tồn sau so sánh gióng cột (aglin) ba trình tự gen mã hóa cho exo-β-1,3-glucanase tag83 Trichoderma Genbank mà chúng tơi tìm (EU314718.1, AJ002397, AY269826.1) (phụ lục 3) Cặp Tag1F: 5’-CAACTTTGCCACCTCCTGTT-3’ Tag1R: 5’-CCGGCAGCATAAATGAGAAT-3’ Cặp Tag2F: 5’-CGACCTCTTCTTCCAACGTC-3’ Tag2R: 5’-GCTTTGGTGGTGCTAGAAGG-3’ Cặp Tag3F: 5’-CACGGCAGCAATTAACAATG-3’ Tag3R: 5’-TCCAGCCGGAAAGTATACCA-3’ Sau thiết kế, cặp mồi ñược kiểm tra thông số lý thuyết phần mềm Oligo Analyser (idtdna) (bảng 3.2) Bảng 3.7 Các thông số lí thuyết ba cặp mồi glu83 Các thơng số mồi Chiều dài (nucleotide) Tm (oC) %GC Tag1F Tag1R Tag2F Tag2R Tag3F Tag3F 20 20 20 20 20 20 64,7 62,5 63,7 64,6 62,1 64,5 50 45 55 55 45 50 1,27 1,35 2,27 2,47 1,91 0,87 Giá trị ∆G nhỏ cấu trúc "kẹp tóc"(kcal/mol) 81 KẾT QUẢ VÀ BIỆN LUẬN Giá trị ∆G nhỏ cấu trúc self-dimer -3,9 -9,75 -6,3 -4,16 -5,36 -9,75 (kcal/mol) Giá trị ∆G nhỏ cấu trúc heterodimer -8,16 -6,97 -9,82 (kcal/mol) Nhân gene đích Chúng tơi tiến hành nhân ñoạn tag83 từ cDNA phản ứng PCR với ba cặp mồi ñược thiết kế Kết trình bày hình 3.11 Hình 3.11 Kết điện di sản phẩm nhân ba cặp mồi cho gene glu83 gel agarose 3% với 18S: mồi 18S, tag1: cặp mồi tag1, tag2: cặp mồi tag2, tag3: cặp mồi tag3 Từ kết hình 3.11, chúng tơi nhận thấy hai cặp mồi tag1F/R tag3F/R khơng có khả nhân cDNA RNA ñược tách chiết từ T longibrachiatum TD16 Trong ñó, sản phẩm nhân từ cặp mồi tag2R/F băng nhất, rõ gel diện di agarose Cặp mồi sử dụng cho mục đích nhân gene mong muốn 82 KẾT QUẢ VÀ BIỆN LUẬN Khảo sát tính đặc hiệu mồi ðể khẳng định xác sản phẩm nhân trình tự gene mong muốn, sản phẩm PCR ñược gửi giải trình tự hai chiều Cơng ty TNHH thương mại dịch vụ Nam Khoa Trình tự sản phẩm PCR gồm 153bp 5’CGACCTCTTCTTCCAACGTCAATCACCTGTAAATTATGTATGTATGTCGGAAGA ACTCACCAAAACGGCAAGACGTGTCGAAAATCACACTTCTCGCCGTCATATTT TCATAGGGCAGAAGATAGAATCCAGTCCTTCTAGCACCACCAAAGC-3’ Sau có kết giải trình tự, chúng tơi sử dụng phần mềm BLAST (NCBI) để so sánh trình tự vừa giải với tồn trình tự GenBank Hình 3.12 Kết BLAST trình tự sản phẩm PCR tag83 Hình 3.13 Kết so sánh giống cột trình tự sản phẩm trình tự dự kiến 83 TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt Hồ Huỳnh Thùy Dương (1997), Sinh học phân tử Nxb Giáo dục, tr122-204 Dương Minh, Lê Phước Thạnh, Hồ Văn Việt, Lê Bảo Ti, Võ Thị Gương (2006), Tác ñộng chủng nấm ñối kháng Trichoderma nội ñịa việc phòng trị bệnh Phytophthora palmivora gây hại sầu riêng Cần Thơ Bến Tre Tạp chí nghiên cứu khoa học, tr 154-161 Phạm Thị Ánh Hồng (2003), Kĩ thuật sinh hoá Nxb ðHQG, HCM, tr 73-76 Lê Duy Thắng, Phạm Phú Phùng, Hồ Bảo Thùy Uyên, Phạm Nguyễn ðức Hồng, Ơng Thị Anh Phương, ðồn Thị Vân (2006), Thực tập vi sinh sở Nxb ðHQG, HCM Nguyễn Thị Hồng Thương, ðinh Minh Hiệp, ðồng Thị Thanh Thu (2003), Khảo sát số yếu tố tác ñộng trình sinh tổng hợp hệ chitinase chủng nấm mốc Trichoderma spp Hội nghị toàn quốc lần thứ II nghiên cứu sinh học, nông nghiệp y học Huế, Nxb Khoa học Kỹ thuật, Hà Nội, p.1040-1043 Thạch Thành Trung, ðặng Hoàng Quyên, ðinh Minh Hiệp (2009), Sự tổng hợp chitinase chất chitin vách tế bào nấm Sclerotium rolfsii từ Trichoderma sp Hội nghị khoa học công nghệ lần thứ XI, ðH Bách Khoa, Tp HCM, Nxb ðHQG, HCM, tr 83-88 Thạch Thành Trung, ðinh Minh Hiệp, Hồ Thị Thu Linh, Lê Huyền Ái Thúy (2009), Nghiên cứu cảm ứng isozyme endochitinase Trichoderma longibrachiatum Tạp chí Khoa học phát triển cơng nghệ, 17(12), tr 34-41 Tài liệu tiếng Anh Ana S.P.M., Antonio de L.R., Lisa J.H., Alfredo H.E., Ana P.B de la R., (2007), Overexpression, purification and characteration of the Trichoderma atroviride endochitinase, ech42, in Pichia pastoris Protein expression and putification, 55, p 183-188 Ada V., Ramot O., Chernin L., Chet I (2002), Significance of lytic enzyms from Trichoderma spp In the biocontrol of fungal plant pathogens Antonie van Leeuwenhoek, 81, pp.549-556 10 Baek M.J., Howell R.C., Kenerly M.C (1998), The role of an extralcellular chitinase from Trichoderma virens Gv29-8 in the biocontrol of Rhizoctonia solani Curr Genet 35, pp 41-50 11 Beníte T., Limón C., Delgado-Jarana, Rey M (1998), Glucanolytic and other enzymes and their genes In: Harman G.E and Kubicek C.P Trichoderma and Gliocladium Vol.2 Enzymes, biological control and commercial applications Taylor and Francis Ltd London, UK, pp.73-142 12 Bradford M.M (1976), A rapid and sensitive for the quantitation of microgram quantities of protein utilizing the principle of protein dye biding Analytical Biochemistry 72, pp 248-254 13 Bustin S.A (2000), Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays J Mol Endocrinol 25(2), pp 169-193 14 Carsolio C., Benhamou N., Haran S., Cortés C., Gutiérrez A., et al (1998), Role of the Trichoderma harzianum endochitinase gene, ech42, in mycoparasitism Appl Environ Microbiol., 65(3), pp 929-935 15 Chet I., Benhamou N., Haran S (1998), Mycoparasitism and lytic enzymes in Trichoderma & Gliocladium Enzymes,biological control and commercial applications (Harman, G E & Kubicek, C P., eds) Taylor & Francis Ltd, UK, pp 153-172 16 de la Cruz J., Antonio H.G., Jose M.L , Tahia Be., Jose A P (1992), Purification and characterization of three chitinase from Trichoderma harzianum Biochem 206, pp 859-867 17 de la Cruz J., Pintor-Toro J.A., Benitez T., Llobell A., Romero L.C (1995), A novel endo-beta-1,3-glucanase, BGN13.1, involved in the mycoparatism of Trichoderma harzianum J Bacteriol 177, pp 6937-6945 18 de la Cruz J., Lobell A., 1999 Purification and properties of basic endo-beta1,6-glucanase (BGN16.1) from the antagonistic fungus Trichoderma harzianum Eu J Biochem 265, pp.145-151 19 Dao Quang Chung, Thach Thanh Trung, Dinh Minh Hiep, Ho Huynh Thuy Duong (2010), Relative quantification of the ech42 gene expression from Trichoderma atroviride P1 using real-time RT PCR Vietnam J science and technol 48 (2A), pp 629-635 20 Dong-Jin K., Jong-Min B., Pedro U., Charles M.K., Cook D.R (2002) Cloning and characterization of multiple glycosyl hydrolase genes from Trichoderma virens Curr Genet., 40, pp 374-384 21 Donzelli B.G., Siebert K.J., Harman G.E (2005), Response surface modeling of factors influencing the production of chitinolytic and β-1,3-glucanolytic enzym in Trichoderma atroviride strain P1 Enzyme & Microb Technol, 37 (1), pp 82-92 22 Druzhinina S.I., Kopchinskiy G.A., Kubicek P.C (2006), The first 100 Trichoderma species characterized by molecular data Mycoscience, 47, pp 5564 23 Elad Y., Kapat A (1999), The role of Trichoderma harzianum protease in the biocontrol of Botrytis cinerea Eur J Plant Pathol., 105, pp.177-189 24 El-Katatny M.H., Gudelj M., Robra K.H., Elnaghy M.A., Guxbitz G.M (2001), Characterization of a chitinase and an endo β-1,3-glucanase from Trichoderma harzianum Rifai T24 involed in control of the phytopathogen Sclerotium rolfsii Appl Microbiol Biotechnol., 56, pp.137-143 25 Esposito E., Silva M.D (1998), Syntematics and environmental Application of the genus Trichoderma Critical Reviews in Microbiol., 24 (2), pp.89 – 98 26 Estrella A H., Chet I (1993), Biocontrol of Bacteria and Phytopathogenic fungi, Agricultural Biotechnol., 269, pp.263-282 27 Federica S., Claudia M.O.L., Ilaria P., Cesare G (2008), Real-time PCR for detection and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil J of Microbiol Methods, 73, pp 185-194 28 Flach J., Pilet P.E., Jolles P (1992), What’s new in chitinase research? Experiential 48, pp 701-716 29 Francois C., Letarte J., Grenier J., Trudel J., Asselin A (1989), Detection of β-1,3- glucanase activity after native polyacrylamide gel electrophoresis : Application to tobacco pathogenesis- related proteins Electrophoresis 10, pp 527-529 30 Garcia I., Lora M.J., Cruz de la J., Benftez T., Liobell A., Pintor-Toro A.J (1994), Cloning and characterization of a chitinase (CHIT42) cDNA from the mycoparasitic fungus Trichoderma harzianum Curr Gnett, 27, pp 8389 31 Giuliano B., Donzelli G., Harman E.G (2001), Interaction of amonium, glucose, and chitin regulates the expression of cell wall-degrading enzymes in Trichoderma atroviride Strain P1 Environmental Microbiol., pp 5643– 5647 32 Gohel V., Vyas P., Chatpar S.H (2004), Activity staining method of chitinase on chitin agar plate through polyacrylamide gel electrophoresis, African J Biotechnol., (1), pp 87-90 33 Gokul V., Lee J.H., Song K.B., Rhee S.K., Kim S.K., Panda T (2000), Characterization and application of chitinase from Trichoderma harzianum A review, Bioprocess Engineering, 23, pp 691-694 34 Good T.A Beesman S.P (1964), Determination of glucosamine and galactosamine using borate buffers for modification of the Elson-Morgan and Morgan-Elson reactions Anal Biochem 9, pp 253-262 35 Hames B.D., Rickwood D (1981), An introduction to polyacrylamide gel electrophoresis, in gel electrophoresis of protein: A practical approach IRL Press Limited, London, pp 4-14 36 Harman G.E (1992), Purified chitinase and use thereof US Patent 5.173.419 37 Harman G.E., Hayes C.K., Lorito M., Broadway R.M (1992), Chitinolytic enzyme of Trichoderma harzianum: purification of chitobiosidase and endochitinase, Curr Genet., 25, pp 313-318 38 Harman G.E., Howell R.C., Viterbo A., Chet I., Lorito M (2004), Trichoderma species-opportunitic, Avirulent plant symbionts, pp 43-56 39 Haran S., Schickler H., Oppenheim A., Chet I (1996), Differential expression of Trichoderma harzianum chitinase during mycoparasitism Molecular Plant Pathogeny, pp 980-985 40 Hirano S (1988), Water soluble glycol chitin and carboxylmethylchitin Methods in Enzymology, 161, pp.408-410 41 Howell C R (2003), Mechanisms employed by Trichoderma species in the biological control of plant diseases: the history and evolution of current concepts Plant Dis 87, pp 4-10 42 Ike M., Nagamatsu K., Shioya A., Nogawa M., Ogasawara W., Okada H., Morikawa Y (2006), Purification, characterization, and gene cloning of 46 kDa chitinase (Chi46) from Trichoderma reesei PC-3-7 and its expression in Escherichia coli Microbiol Biotechnol, 73, pp.294-303 43 Inbar J., Chet I (1995), the role of recognition in the induction of specific chitinases during mycoparasitism by Trichoderma harzianum Microbiol 141 (11), pp 2823-2829 44 Jolles P., Muzzarelli R.A.A (1999), Chitin and Chitinase Birhäuser-Verlag, Basel, Switzerland, pp 125-133 45 Kenneth J.L., Thomas D.S (2001), Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆Ct method Methods 21, pp 402408 46 Kubicek C.P., Mach R.L., Peterbauer C.K., Lorito M (2001), Trichoderma: From genes to biocontrol J Plant Pathology, 83, pp.11-23 47 Kullnig C., Mach R., Lorito M, Kubicek C (2000), Enzyme diffusion from Trichoderma atrovidride (T harzianum P1) to Rhizoctonia solani is a prerequisite for triggering of Trichoderma ech42 gene expression before mycoparasitic contact Appl Environ Microbiol 66, pp 2232–2234 48 Lebendiker M (2002), The protein purification facility, http://wolfson.huji.ac.il/purification/Protocols/Page_SDS.html 49 Lima L.H.C., De Marco J.L., Cirano J.U., Felix C.R (1999), Synthesis of a Trichoderma chitinase which affects the Sclerotium rolfsii and Rhizoctonia solani cell walls Folia Microbiol, 44, pp.45-49 50 Lorito M (1998), Chitinolytic enzymes and their genes In: Harman G.E and Kubicek C.P Trichoderma and Gliocladium Vol.2 Enzymes, biological control and commercial applications Taylor and Francis Ltd London, UK, pp.73-142 51 Lorito M., Hayes C K., Di Pietro A., Woo S L., Harman G E (1994), Purification, characterization and synergistic activity of a glucan 1,3glucosidase from Trichoderma harzianum Phytopathology 84, pp 398– 405 52 Mach R.L., Peterbauer C.K., Payer K., Jaksits S., Woo S.L (1999), Expression of two major chitinase genes of Trichoderma atroviride (T harzianum P1) is triggered by different regulatory signals Appl Environ Microbiol 65 (5), pp 1858-1863 53 Maoa W., Lewisa J.A., Lumsdena R.D., Hebbara K.P (2000), Biocontrol of selected soilborne diseases of tomato and pepper plants Crop Protect 17, pp 535–542 54 Mora A., Earle E.D (2001), Combination of Trichoderma harzianum endochitinase and a membrane-affecting fungicide on control of Alternaria leaf spot in transgenic broccoil plants Microbiol Biotechnol 55, pp 306-310 55 Marcello C M., Steindorff A S., da Silva S P., Silva R N., Bataus L A M., Ulhoa C J., 2010 Expression analysis of the exo-β-1,3-glucanase from the mycoparasitic fungus Trichoderma asperellum Microbiological Research 165 (1), pp 75-81 56 Marco de la J., Felix C.R (2007), Purification and characterization of a βglucanase produced by Trichoderma harzianum showing biocontrol potential Brazilian archives of Biology and technol 50, pp 21-29 57 Miller G.L (1959), Use of dinitrosalicylic acid reagent for the determination of reducing sugar Anal Chem 31, pp 426-428 58 Moreno C.A., Castillo F., Gonza´ lez A., Bernal D., Jaimes Y (2009), Biological and molecular characterization of the response of tomato plants treated with Trichoderma koningiopsis, Physiological and Molecular Plant Pathology, pp.1–10 59 Nguyen Thanh Phong, Le Thi Thuy Hang, Thach Thanh Trung, Dinh Minh Hiep (2010), Study on induction and expression of Trichoderma longibrachiatum TD16 β-1,3-glucanase Vietnam J Science and Technol., 48 (2A), pp 713-719 60 Nobe R., Sakakibara Y., Ogawa K., Suiko M (2004), Cloning and expression of a Novel Trichoderma viride laminarinase AI gene (lamAI) Biosci Biotechnol Biochem., Vol 68, 2111-2119 61 Noronha E.F., Kipnis A., Junqueira-Kipnis A.P., Ulhoa C.J (2000), Regulation of 36-kDa L-1,3-glucanase synthesis in Trichoderma harzianum FEMS Microbiology Letters 188, pp 19-22 62 Pan S.Q., Ye S.X., Kue J (1991), A technique for detection of chitinase, β1,3-Glucanase, and protein patterns after a single separation using polyacrylamide gel electrophoresis or isoelectrofocusing Phytopathology, pp 43-50 63 Papavizas G.C (1985), Trichoderma and Gliocladium: biology, ecology and potential for biocontrol Annu Rev Phytopathol 23, pp 23-54 64 Patil R.S., Ghormade V., Deshpande M.V (2000), Chitinolytic enzymes: an exploration Enzyme and Microbial Technology, 26, pp 473-483 65 Perez-leblic M.I., Reyes F., Laboz R., Archer S.A (1982), Autolysis of Penicillium oxalicum with special reference to its cell walls Canadian J.Microbiol., 28, pp 1289-1295 66 Philippovich Y.B., Egorova T.A., Sevastyanova, G.A (1975), Practical work on common biochemistry Prosveschenie Press, Moscow, Russia 67 Ramot O., Cohen-Kupiec R., Chet I (2000), Regulation of β-1,3-glucanase by carbon starvation in the mycoparasite Trichoderma harzianum Mycol Res 104, pp 415-20 68 Ridout C., coley-Smith J., Lynch J (1986), Enzyme activity and electrophoretic profile of extracellular protein induced in Trichoderma spp by cell wall of Rhizoctonia solani J Gene Microbiol 132, pp 2345-2352 69 Rosenberger R.F (1976), The cell wall in filamentous fungi, ed BDR Smith J.E Edward Arnold, London, UK, pp 328-344 70 Samuels G.J (2006), Trichoderma: systematic, the sexual state, and ecology Phytopathology 96, pp.195-206 71 Samuels G.J., Suarez C., Solis K., Holmes K.A., Thomas S.E., Ismaiel A., Evans H.C (2006), Trichoderma theobromicola and T paucisporum: two new species isolated from cacao in South America Mycologial Research 110, p 381-392 72 Schomczynski P., Sacchi N (1990), Single-step RNA isolation from cultured cells or tissues In: Ausubel F.M Brent R., Kingston R.E., Moore D.D., Seidman J.G., Smith J.A & Struhl K eds Current protocols in molecular biology Greene and Wiley-Interscience, New York, pp 424-428 73 Shubakov A.A., Kucheryavykh P.S (2004), Chitinolytic activity of filamentous fungi Appl Biochem Microbiol., 40(5), pp 445-447 74 Sonija S.K, Jihong L.C., Ingunn A.H., Vincent G.H.E., May-Bente B (2006), Molecular cloning, characterization, and expression studies of a novel chitinase gene (ech30) from the mycoparasite Trichoderma atroviride strain P1 FEMS Microbiol let, 256, pp 282-289 75 Sridevi G., Parameswari C , Sabapathi N., Raghupathy V., Veluthambi K, (2006), Combined expression of chitinase and β-1,3-glucanase genes in indica rice (Oryza sativa L.) enhances resistance against Rhizoctonia solani Plant Science 175, pp 283-290 76 Sunsana M.E.S (2006) , Isolation and characterization of two chitinase and one novel glucanase genes for engineering plant defence against fungal pathogens Docteral thesis, Murdoch University, Australia 77 Tevfik M.D (2006), real-time PCR, Taylor and Francis Ltd London, UK 78 Tharanathan R.N., Kittur F.S (2003) Chitin- The Undisputed Biomolecule of Great Potential Critical Reviews in Food Science and Nutrition, 43(1), pp 61-87 79 Trudel J., Asselin A (1988), Detection of Chitinase acitivity after polyacrylamide gel electrophoresis Biochemistry, 178, pp 362-368 80 Ulhoa C.J., Peberdy J.F (1991), Regulation of chitinase synthesis in Trichoderma harzianum J Gene Microbiol 137, pp 2163-2169 81 Verena S (2008), Chitinases of filamentous fungi: a large group of diverse proteins with multiple physiological functions Fungal biology reviews, 22, pp 36-42 82 Vinale F., Sivasithamparam K., Ghisalberti L.E., Marra R., Woo L.S., Lorito M., (2008), Trichoderma–plant–pathogen interactions Soil Biology & Biochem., 40, pp.1-10 83 Zaldívar M., Velquez C.J., Contreras I., Pérez M.L (2001), Trichoderma aureoviride 7-121, a mutant with enhanced production of lytic enzymes: its potential use in waste cellulose degradation and/or biocontrol, Electronic J Biotechnol, 4(3), pp 160-168 84 Wantanabe T., Yahata N., Nakamura Y., Muramoto Y., Suzuki K., Kamimiya S and Tanaka H., (1989), Expression in Escherichia coli of the Bacillus circulans WL-12 structural gene for β-1,3-glucanase A Agric Biol Chem 53 (7) 85 Wessels J.G.H., Kreger D.R., Marchant R., Regenesburg B.A., De Vrie O.M.H (1972), Chemical and morphological charaterisation of the hyphal wall surface of the Basidiomycete Schizophullum commune Biochemical et Biophysical Acta.273, pp.364-358 86 Wittig I., Schãgger H (2005), Advantages and limitations of clear-native PAGE Proteomics (17), pp 4338-4346 KẾT QUẢ VÀ BIỆN LUẬN Dựa bảng kết BLAST (hình 3.12), chúng tơi nhận thấy trình tự sản phẩm PCR chúng tơi khơng có độ tương đồng với trình tự GenBank khơng tương đồng với sản phẩm dự kiến (hình 3.13) Do chúng tơi khơng thể tiếp tục thiết kế mẫu dị chương trình real-time PCR Vì vậy, theo chúng tơi, trình tự acid amin isozyme β-1,3-glucanase cần phải ñược giải ñể so sánh lại với trình tự nucleotide vào trình tự acid amin ñể thiết kế lại cặp mồi ñặc hiệu cho gene mã hóa isozyme 84
Ngày đăng: 05/10/2023, 20:01
Xem thêm: