Đang tải... (xem toàn văn)
Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.Đặc điểm bệnh học của mầm bệnh Vibrio spp. và vi bào tử trùng hiện diện trong đường ruột ở tôm nước lợ.1 MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY DOCTORAL DISSERTATION SUMMARY Major Aquaculture Major code 62 62 03 01 TRUONG MINH UT PATHOLOGICAL CHARACTERISTICS OF THE PATHOGEN Vibrio spp AN.
MINISTRY OF EDUCATION AND TRAINING CAN THO UNIVERSITY DOCTORAL DISSERTATION SUMMARY Major: Aquaculture Major code: 62 62 03 01 TRUONG MINH UT PATHOLOGICAL CHARACTERISTICS OF THE PATHOGEN Vibrio spp AND MICROSPORES DISCOVERED IN THE GASTROINTESTINAL TRACT OF BRACKISH WATER SHRIMP 2022 THE RESEARCH WAS PERFORMED AND CAN THO UNIVERSITY Supervisor: Assoc Prof Tu Thanh Dung The dissertation will be defended at the Doctoral Dissertation Assessment Committee at the University Level At: Dissertation Defense Room (Meeting Room No 3, 2nd Floor, Administration Building), Campus II – Can Tho University Time & Date: August 8, 2022 Reviewer 1: Assoc Prof Nguyen Ngoc Phuoc Reviewer 2: Assoc Prof Tran Thi Tuyet Hoa Confirmation of review by the Chairman of the Board Prof Nguyen Thanh Phuong The dissertation can be found at: - The Learning Resource Center (LRC), Can Tho University - The National Library of Viet Nam (NLV) i THE LIST OF PUBLISHED PAPERS Ut, T M., Uyen D T T., and Dung, T T (2021) Antimicrobial activity of herbal extracts against Vibrio spp bacteria isolated from white feces syndrome on white leg shrimp (Litopenaeus vannamei) in some provinces in the Mekong Delta Can Tho University Journal of Science Vol 13, No 2: 61-68 Ut, T M., Khoi, L M., Nghia, N T, Duyen, L T N Dung, T T (2021) Pathogenicity determination of Vibrio spp causing white feces disease on white leg shrimp (Litopenaeus vannamei) in some provinces of the Mekong Delta Journal of Vietnam Agricultural Science and Technology 08, 125-132 Ut, T M., Khoi, L M., Nghia, and Dung, T T (2022) Study on infection possibility of Enterocytozoon hepatopanaei in white shrimp (Litopennaeus vannamei) Journal of Vietnam Agricultural Science and Technology 02 (135), 126-132 ii CHAPTER INTRODUCTION 1.1 Background The Mekong Delta is an important shrimp farming region in Vietnam In 2020, shrimp farming area accounts for 92% of the country's brackish water shrimp farming area, of which 95% is for raising black tiger shrimp; whiteleg shrimp accounted for 74.4%, and production accounted for 86.9% of the country's brackish water shrimp farming production (Directorate of Fisheries, 2020) As a result, the two major brackish water-cultured shrimp species in Vietnam are black tiger shrimp and vannamei shrimp However, the development and intensification of seawater shrimp farming have resulted in an increasingly complicated disease situation on farmed shrimp, threatening productivity and output as well as the sustainable development of shrimp farming in Vietnam in general and the Mekong Delta in particular Currently, gastrointestinal (digestive tract) diseases affecting farmed shrimp are becoming more prevalent, however, there hasn't been much research and comprehensive information on these diseases White feces syndrome (WFS), growth retardation caused by Enterocytozoon hepatopenaei spores, has had few updates on epidemiological studies, modes of infection, and the accumulative effects of multiple pathogens (multiple infections) on farmed shrimp, particularly in Vietnam The studies have just reached the early stage, detecting pathogens and external disease symptoms With the increasingly complicated status of intestinal infections on brackish shrimp, it is critical and necessary to conduct in-depth studies of pathogens and transmission mechanisms to determine solutions for disease prevention and treatment As a consequence, to supply and complement more thorough scientific knowledge, particularly in determining disease management strategies for farmed shrimp, the study “Pathological characteristics of the pathogen Vibrio spp and microspores discovered in the gastrointestinal tract of brackish water shrimp” was implemented to control the disease effectively, and suggested disease management in farmed shrimp effectively and sustainably 1.2 Objectives 1.2.1 General Objectives Determination of pathogenicity of the pathogen Vibrio spp and intestinal microspores in brackish water-cultured vannamei as a scientific basis for recommending strategies to control intestinal diseases in brackish water-cultured white effectively and sustainably 1.2.2 Specific Objectives - Objective 1: Determine the presence of the pathogen Vibrio spp and microspores causing intestinal disease in white leg shrimp cultured in Ca Mau, Soc Trang, and Ben Tre provinces - Objective 2: Isolation, identification, and pathogenicity of Vibrio spp and microspores in brackish water-cultured white leg shrimp intestinal diseases - Objective 3: Determination of susceptibility to antimicrobial agents of the pathogen Vibrio spp in the intestinal systems of white leg shrimp 1.3 Study contents This study focuses on three specific subjects, which are as follows: a) Investigation of the presence of pathogens Vibrio spp and microspores in brackish water cultured vannamei shrimp demonstrating intestinal disease b) Isolation, identification, and pathogenicity of Vibrio spp and microspores of intestinal disease in brackish water-farmed white leg shrimp c) Study on the effects of anti-Vibrio spp intestinal disease in white leg shrimp 1.4 Scientific significance of the dissertation This study contributes to the scientific and practical knowledge of Vibrio spp pathogenicity, microspore transmission capacity, and impacts on the digestive system of white shrimp cultured in brackish water This study determined the effect of combining Vibrio spp causing white feces disease on white leg shrimp and the relationship with virulence genes lays the foundation for future epidemiological investigations on bacterial species in shrimp in particular and aquaculture in general Proposing some solutions to prevent and treat diseases on white leg shrimp with a mixture of herbs with similar medicinal properties to limit damage and risks that may occur due to disease outbreaks causing damage to shrimp farmers CHAPTER METHODOLOGY 2.1 Content 1: Investigation of the presence of pathogens Vibrio spp and microspores in brackish water cultured vannamei shrimp showing intestinal disease Samples of white leg shrimp with the intestinal disease were collected from intensive farming ponds in Dam Doi, Cai Nuoc, and Phu Tan districts in Ca Mau province, Thanh Phu district in Ben Tre province, and My Thanh, Vinh Chau district in Soc Trang province The collected samples were carried out using biopsy specimens to detect vermiform, Gregarine, and microsporidia EHP, and isolated bacteria on TCBS medium from hepatopancreas and intestinal tract, with preservation in Ethanol and Davison's for molecular biology and histopathological analysis 2.2 Content 2: Isolation, identification, and determination of pathogenicity of Vibrio spp bacteria and intestinal pathogenic microspores in white leg shrimp cultured in brackish water 2.2.1 Bacterial identification Bacterial strains isolated from intestinal diseased shrimp were identified through some basic morphological parameters including Gram, shape, motility, catalase, oxidase, fermentability, and glucose oxidation (O/F) and using the API 20E test kit (BioMerieux, France), as well as sequencing the bacterial 16s rRNA gene fragment Table 2.1 16S rRNA primer sequence for PCR Name 27-F 1492-R Target gene 16S rRNA Sequence (5’→ 3’) AGAGTTTGATCCTGGCTCAG GGTTACCTTGTTACGACTT Size (bp) 1500 Reference (Lane, 1991) 2.2.2 Virulence gene determination Bacterial strains V alginolyticus, V cholerae, V vulnificus, and V parahaemolyticus were determined ed the virulence genes toxR, tdh, pirB, toxRS by primer pairs presented in Table 2.2, the thermal cycles of each primer pair presented in Table 2.3 Table 2.2 The primer sequences utilized in virulence gene analysis Sequence (5’→ 3’) Primers VpPirB-392-F PirBVP VpPirB-392-R tlh-F Size (bp) TGATGAAGTGATGGGTGCTC Reference 392 Han et al (2015) 450 Mahmud et al (2006) 367 Kim et al (1999) 1347 Matsumoto et al., (2000) TGTAAGCGCCGTTTAACTCA tlh tlh-R AAAGCGGATTATGCAGAAGCACTG GCTACTTTCTAGCATTTTCTCTGC toxR-F toxR toxR-R GTCTTCTGACGCAATCGTTG ATACGAGTGGTTGCTGTCATG toxRS-F toxRS toxRS-R TATCTCCCATGCGCAACCGTA ACAGTACCGTAGAACCGT GA Table 2.3 Thermal cycling used in virulence gene analysis PCR reactions Amplification Primers Initial denaturation VpPirB-392 (35 cycles) 94°C-3 94°C-1 57°C-1 30 sec 72°C-1 72°C-10 tlh (30 cycles) 94°C-3 94°C-1 48°C-1 30 sec 72°C-1 72°C-10 toxR (35 cycles) 94°C-3 94°C-1 48°C-1 30 sec 72°C-1 72°C-10 toxRS (35 cycles) 94°C-3 94°C-1 54°C-1 30 sec 72°C-1 72°C-10 Denaturation Annealing Extension Final extension 2.2.3 Determination of lethal dose of Vibrio sp cause disease The virulence potential of Vibrio spp bacteria isolated from intestinal diseased shrimp was performed with typical species V cholerae, V alginolyticus, V vulnificus V parahaemolyticus, respectively infected with a single species according to each strain (Table 2.4), and a combination of 3-4 bacterial strains (Table 2.5) on diseasedfree white shrimp weighing 10-12g Each experimental treatment was repeated times Shrimp were arranged with a density of 40 shrimp/80 L tank All infection experiments were performed by intracardiachepatopancreatic sinus injection and monitored mortality, clinical signs, and water quality measures were tracked for 14 days As a result, the lethal dose of 50% and pathogen of bacterial strains on white leg shrimp was determined The LD50 value is calculated by the formula: LD50 = 10n-PD (CFU/mL) Which: n is the lowest exponent of the bacteria causing death in over 50% of the experimental shrimp Proportionate distance (PD) between two concentrations with mortality greater than 50% and less than 50% is calculated by the following formula: PD = (the mortality > 50%)-50%/(the mortality > 50%)-(the mortality < 50%) Table 2.4 Arrangement of single challenge treatment Bacterial strains Shrimps Concentration (CFU/mL) Control 240 - V alginolyticus CM3IC1 240 0,78×103; 104; 105; 106 V cholerae CM3HPTB1 240 0,97×103; 104; 105; 106 V vulnificus CM2HPA4 240 0,7×103; 104; 105; 106 V parahaemolyticus BTIA1 240 0,39×103; 104; 105; 106 Table 2.5 Combination of Vibrio spp challenge treatments Bacterial strain combination Shrimps Concentration (CFU/mL) Control (None bacteria) 300 - V alginolyticus CM3IC1 V cholerae CM3HPTB1 V vulnificus CM2HPA4 240 103; 104 105; 106 V alginolyticus CM3IC1 V cholerae CM3HPTB1 V parahaemolyticus BTIA1 240 103; 104 105; 106 V alginolyticus CM3IC1 V vulnificus CM2HPA4 V parahaemolyticus BTIA1 240 103; 104 105; 106 V cholerae CM3HPTB1 V vulnificus CM2HPA4 V parahaemolyticus BTIA1 240 103; 104 105; 106 V alginolyticus CM3IC1 V vulnificus CM2HPA4 V cholerae CM3HPTB1 V parahaemolyticus BTIA1 240 103; 104 105; 106 2.2.4 Determination of pathogenicity of EHP microspores in white leg shrimp EHP infectivity in white leg shrimp (10-12 grams) was carried out through microspore experiments with various methods, including (1) negative control (not challenge with EHP spores); (2) caged with infected shrimp according to the ratio of diseased: healthy shrimp (1:10); (3) supplemented water with EHP density of 3.25×105 spores/L, and (4) feed mix EHP at a density of 0.5×105 spores/gram Each experimental treatment was repeated times Shrimp were arranged with a density of 40 shrimp/80L tank The experiment was observed for 14 days, with daily monitoring recording mortality, observable clinical signs, and water environmental parameters (temperature, dissolved oxygen, pH, alkalinity-kH, NO2, NH4/NH3+) Collect shrimp samples every days till the end of day 14 to determine EHP infection in shrimp using the Realtime-PCR technique At the end of the experiment, all shrimp samples in the tank were collected for histological analysis and Realtime-PCR 2.3 Content 3: Study on the effect of anti-Vibrio substances on intestinal disease in white leg shrimp 2.3.1 Evaluation of antibacterial activity, minimum inhibitory concentration, (MIC), and minimum bactericidal concentration (MBC) of herbs Antimicrobial activity, MIC, and MBC of herbal extracts from guava (P guajava) and chamber bitter (P urinaria L,) and sea daisy (W biflora (L.) DC) were performed on a representative bacterial strain belonging to bacterial species V cholerae, V alginolyticus, V vulnificus V parahaemolyticus The antibacterial activity of herbal extracts was determined using the agar well diffusion technique at doses of 25, 50, and 100 mg/mL (Magaldi et al., 2004) The MICs and MBCs of the two extracts were determined using the method of Oonmetta-aree et al., (2016) at base dilutions ranging from 25 to 0.024 mg/mL 2.3.2 Applying herbs to prevent intestinal diseases on white leg shrimp Evaluation of herbal effects on survival rate, growth, rate, and several immunological parameters The experiment was arranged in a completely randomized design with four treatments, each with three duplicates: 1% guava leaf extract (O1, O2, O3), 1% chamber bitter supplement (DHC1, DHC2, DHC3), mixed extract of guava leaves 0.5% and chamber bitter 0.5% (HH1, HH2, HH3) and a control treatment (DC1, CC2, CC3) The method of adding herbal extracts to food was carried out according to the study of Huyen et al., (2017) The mixed feed is stored at 4°C and refreshed weekly The experiment shrimp were fed on demand every day with the frequency of feeding times/day (at intervals of 8:00 AM; 12 PM; PM; PM) Assess several water quality parameters such as temperature, dissolved oxygen, pH, alkalinity-kH, NO2, NH4/NH3+; shrimp survival and growth rate evaluation using a variety of indicators including daily weight gain DWG (g/day) = (Wf-Wi)/T; specific Growth Rates SGR (%/day) = {(lnWf-lnWi) / T} ×100; feed conversion ratio (FCR) = [Total feed consumed /(Wf -Wi)], which: Wf is the final mass, Wi is the initial mass and T is the total time of the experiment Survival rate (%) = (number of shrimp at the end of the experiment /number of shrimp at the time of the experiment) ×100 After weeks of the experiment, shrimp were sampled to examine the total population of Vibrio in the hepatopancreas and immunological parameters The immunological parameters analyzed included: total hematopoietic count (THC) (Le Moullac et al., 1997), and phenoloxidase (PO) activity (Hernández-Lospez et al., 1996) Effectiveness of herbs in the prevention of intestinal diseases After weeks of supplementation with guava leaf and chamber bitter extracts, shrimp were challenged with a bacterial complex of V parahaemolyticus; V cholerae; V alginolyticus (ACV) at 1.05×105 CFU/mL Each treatment was monitored and recorded clinical signs, the daily number of shrimp deaths within 14 days of the experiment 2.4 Statistical methods The data are generated using Excel software, and the difference in water quality parameters, survival rate, growth indicators, Vibrio bacteria density, and other immunological characteristics is compared using OneWay ANOVA analysis CHAPTER III RESULTS AND DISCUSSION 3.1 Clinical signs The study sampled 63 white leg shrimp ponds with intestinal disease, 39 of which were gathered in three districts: Dam Doi, Cai Nuoc, Phu Tan, Ca Mau province; 10 farmed ponds in My Xuyen and Vinh Chau districts, Soc Trang province; and 14 harvest ponds in Thanh Phu district, Ben Tre province Clinical symptoms of shrimp intestinal disease are most often shown in the hepatopancreas and intestinal tract, with the hepatopancreas showing two indicators: swollen, pale liver or atrophy and pale liver, with rates of 34.75% and 31.31%, respectively Simultaneously, three types of digestive symptoms were recorded: white feces (14.7%), empty/intermittent intestine (33.65%), and symptoms of loose feces (59.71%) Depending on each pond, the diseased shrimp samples may show one or more different pathological signs with the ratio according to each group of signs In which, atrophy/pale hepatopancreas, liquified feces, and swollen/pale hepatopancreas, liquied feces accounted for the highest rate of 23.16% and 21.85% of shrimp with intestinal disease Next, the sign of liquified feces with 14.47%, swollen/pale hepatopancreas, empty/ discontinuous intestine 12.9%, empty/discontinuous intestine 12.36%; atrophy/pale hepatpancreas, empty gut 8.15%, and lowest in white feces with a rate of 7.2% 3.2 Results of parasite analysis The parasite analysis result showed that the samples of white-leg shrimp with signs of intestinal pathology had 77.78% of the samples recorded vermiform present on the hepatopancreas and intestinal tract of 10 shrimp 14.29% of the total samples infected with Gregarine in the intestinal tract and 41.27% infected with EHP The shrimp samples infected with vermiform and Gregarine in the study frequently did not show obvious signs such as slow growth, stunting, soft shell, muscle opacity, and soft shell; the intestinal tract is discontinuous, the yellow-brown feces, or empty gut, with some changes in color and size on the hepatopancreas Mature spores were identified in biopsy specimens through the characteristic oval shape with a small vacuole at the terminal tip that became purple/blue when stained with Giemsa All shrimp samples tested positive through Realtime-PCR methods 3.3 Histopathology of shrimp intestinal disease The results of sampling at the pond in this study revealed that the shrimp in the pond appeared to be divided into three groups, each with typical indicators of disease, such as: (1) Hepatopancreas swelling, pale color: Significant rise in the distance between hepatopancreatic ducts, reduction in epithelial cells B, R, and F; the hepatopancreas tubule epithelial structure is damaged In certain samples, the hepatopancreatic duct revealed symptoms of atrophy, including the absence of epithelial cells and hemocytes infiltrations, as well as sloughed cells in the lumen (2) Hepatopancreas atrophy, intestines empty: There is no mitotic activity in E cells, atrophy of the hepatopancreas ducts, a decrease in the number of B, R, and F cells; hepatopancreatic epithelial cells degenerate, slough off and fall into the lumen of the hepatopancreatic lumens; enlarged cell nucleus; melanization together with hemocytes infiltrations around the hepatopancreas tubes (3) White feces syndrome: The hepatopancreatic duct loses its stellate structure, the epithelial cells degenerate or are lysed and sloughed into the lumen, and the proximal part of the hepatopancreatic duct exhibits extensive hemocytes infiltrations as well as melanization 11 Several hepatopancreatic ducts atrophy, meaning that the epithelium progressively shrinks and thins, and the lumen enlarges Simultaneously, vermiform was found in the tube's lumen 3.4 Histopathology of shrimp infected with EHP microspores Histopathological analysis of shrimp samples with slow growth shrimps caused by EHP revealed structural changes such as increasing the distance of the hepatopancreatic tubule in the periphery, changing the structure of the hepatopancreatic duct, loss of “star structure,” hepatopancreatic epithelial cells are lysed or degenerated, debris falls into the lumen of the duct along with gathering hematopoietic cells Furthermore, EHP-infected shrimp had a significant reduction in the number of epithelial cells B, R, and F; tubular epithelial cells shrink, and some lumens contain necrotic debris EHP has also been seen as acidophilic inclusions in the cytoplasm of hepatopancreatic epithelial cells and as free spores released into the lumen by injured epithelial cells that split or peel off 3.5 Isolation and identification results of Vibrio sp The isolation and identification results showed that a total of 82.54% of the infected shrimp samples were infected with Vibrio spp., with the single infection rate being the highest (47.62%), and multiple infections (2-4 species co-infection) were recorded at high levels (34.92%) A total of 102 Vibrio spp strains from five different species, including V cholerae, V alginoloyticus, V harveyi, V vulnificus, and V parahaemolyticus, are characterized and identified using colony morphology on TCBS and TSA+ medium, basic physiological biochemical parameters, and a combined API 20E test kit with 16S rRNA gene sequencing Table 3.1 Isolation results of Vibrio spp on vannamei shrimp Species V V V V V parahaemolyticus harveyi vulnificus cholerae alginolyticus 12 Percentage (%) 10.7 5.9 15.7 17.7 50 3.6 Vibrio spp virulence determination 3.6.1 Determination of the LD50 value of monotypic Vibrio spp strains Bacterial strains V cholerae CM3HPTB1 chủng V alginolyticus CM3IC1 isolated from shrimp with white feces syndrome could not kill vannamei shrimp when injected at 103 - 106 CFU/mL After 10 days and days of infection with each bacterial strain, all susceptible cases experienced comparable classic symptoms such as enlarged and pale hepatopancreas and empty/discontinous intestine Bacterial strain V vulnificus CM2HPA4 showed high lethality in white shrimp whin thetelectedted by injection method The lethal dose 50% (LD50) in the experiment was 1.5×104 CFU/mL In infected shrimp, V vulnificus CM2HPA4 exhibited several signs of intestinal disease, often an empty/ discontinuous intestine accompanied by pale hepatopancreas, the liver is enlarged, painful, and in this study, the LD50 value of whiteleg shrimp infected with V parahaemolyticus BTIA1 isolated from shrimp with white feces syndrome s study was determined to be 2.7×105 CFU/mL In shrimp infected with V parahaemolyticus BTIA1 strain showed signs of swelling, pale color of hepatopancreas; some shrimp showed signs and atrophy and an empty gut 3.6.2 The LD50 value of Vibrio strains in combination with multispecies In all treatments with bacterial combinations, different mortality rates were recorded for each different combination, with some typical signs for each infection combination (Table 3.2) Table 3.2 White leg shrimp mortality rate with Vibrio spp mixtures Bacteria combination Concentration Percentage (CFU/mL) (%) 13 Clinical signs Control V alginolyticus, V cholerae, V vulnificus (ACV) V alginolyticus, V cholerae, V parahemolyticus (ACP) V alginolyticus, V vulnificus, V parahemolyticus (AVP) V cholerae, V vulnificus, V parahemolyticus (CVP) V alginolyticus, V cholerae, V vulnificus, V parahemolyticus (ACVP) 0 103 13.3 13.3 26.7 33.3 10 10 104 23.3 23.3 26.7 10 104 13.3 23.3 105 33.3 43.3 33.3 10 105 43.3 50 106 83.3 10 10 10 10 10 10 10 6.7 10 105 6.7 10 106 10.3 10 Normal pale – swollen hepatopancreas, discontinuous gut, liquified or white feces pale – swollen hepatopancreas, discontinuous gut, liquified or white feces pale – swollen hepatopancreas, intermittent or empty gut pale – swollen hepatopancreas, discontinuous or empty gut pale – swollen hepatopancreas, discontinuous gut or liquified feces Similar to the single-species infection experiment on whiteleg shrimp infected with a mix of bacteria, the symptoms are distinct in each combination Hepatopancreatic symptoms were more prevalent in shrimp infected with the VP-containing combination (AVP and CVP), whereas liquefied feces were showed in shrimp infected with the AC-containing combination (ACV and ACP) The study found symptoms of intestinal disease in shrimp with milky white color and excretion of feces comparable to wild shrimp with white feces syndrome in shrimp infected with ACV and ACP bacteria 14 3.7 The results of identification of Vibrio spp virulence genes The survey results revealed that all strains of Vibrio spp obtained from white feces syndrome shrimp possess virulence genes Wherein the bacterial strain V alginolyticus CM3IC1 only had one virulence gene toxRS, strain V vulnificus CM2HPA4 carried two genes toxR and toxRS, strain V cholerae CM3HPB1 carries two genes PirBVP and tlh, and strain BTIA1 possessed three genes PirBVP, toxR, and toxRS 3.8 Pathogenicity and transmission of EHP in white leg shrimp After 14 days of infection, EHP has been demonstrated to be transmissible by co-habitat, sporulated water, and the gastrointestinal system (feeding), with co-habitat being faster In comparison to the control treatment, the infected shrimp tended to swim less slowly, respond to noises more slowly, and lessen or cease feeding Shrimp not eat, a soft shell, stunted, dark color, and many black on the shell Shrimp hepatopancreas becomes light brown, mushy, mossy green, milky white, or atrophy, intestines are empty, contain little food, or are interrupted, shrimp feces are twisted springs, air bubbles form, containing pale to yellow-brown and red-brown fluid Histopathology of shrimp hepatopancreas in EHP infection treatments revealed structural changes as well as cellular effects, with some typical indications including loss of astrological structure and a reduction in the number of hepatopancreas tubules B and R cells descend into the lumen, as sloughing epithelial cells and the concentration of blood cells around the hepatopancreatic ducts After 14 days of infection, numerous EHP-infected inclusions in the form of cysts were seen in the late G2 and early G3 phases Furthermore, dense clusters of EHP spores were seen on the hepatopancreas of shrimp 3.9 The effects of applying certain herbs to prevent Vibrio spp disease on white leg shrimp 3.9.1 Antibacterial activity of certain plants against isolated Vibrio spp strains 15 The chamber bitter (P urinaria L) showed the highest antibacterial activity against all ten isolates, with antibacterial zone diameters ranging from 12.7 to 24.85 mm, followed by guava leaves (P guajava) at 09 to 22.95 mm, and sea daisy (W biflora L) extracts at to 16.45 mm 3.9.2 Determination of minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) The guava leaves and the chamber bitter, two herbal extracts with strong antibacterial properties, were selected for MIC and MBC analysis The results revealed that on V parahaemolyticus BTIA1, V harveyi CM3HPA2, V alginolyticus, CM3IC1, and V alginolyticus CM3HPC1, the chamber bitter extract had a maximum MIC value of 0.2 mg/mL and an MBC value of 0.78, 0.39, 0.39, and 1.56 mg/mL, respectively In particular, the maximum MBC/MIC ratio of the chamber bitter extract was on V alginolyticus CM3IC1, while the scale value is on V parahaemolyticus BTIA1, V cholerae CM3HPTB1, V cholerae CM1HPB1, V alginolyticus STIC1, V alginolyticus CM2IC1, and the values on the other strains are 3.9.3 Result of experimental arrangement of herbal medicine to prevent Vibrio disease isolated on white leg shrimp After weeks, there was no difference in growth and weight increase between the herbal feeding treatments and the control, and the difference was not statistically significant (p > 0.05) However, there was a statistically significant difference between the treatments (p