Nghiên cứu các điều kiện lên men nâng cao hoạt tính sinh học của sữa chua

- Chuyên ngành: - Cá Hịa TS Hồng Anh Hồng P P - - nh phúc MSHV: 12313058 S - Phân l p ch ng vi khu n lactic vi khu n acetic t s n ph m lên men - Tuy n ch nh danh ch ng vi khu n lactic cho ho t tính probiotic cao ch ng vi khu n acetic sinh acid glucuronic cao - Kh o sát y u t n kh trình lên men s a chua - T u t n kh ng ch th c nghi m - ng c a s n ph m s a chua v ho t tính sinh h c: probiotic acid glucuronic, tiêu chu n v sinh an toàn th c ph m ch : 24/06/2013 : 23/05/2014 Tp ng c m quan - - Tôn giáo: không tháng 08/2006 tháng 12/2010 Công - Bách K 9) Q TRÌNH CƠNG TÁC 06/2011 tháng 03/2014: Chí Minh inh 09/ : Tp ngày CBCC tháng n, t t quý báu Xin t khóa 13 tơi i Lactobacillus acidophilus có mã AB911464.1 Gluconacetobacter nataicola NR_041012.1 -Burman rình lên men G nataicola L acidophilus 5.1 log cho giá ii SUMARY Traditional drinking yogurt was studied to enhance the biological activity in terms of probiotic activity and implement glucuronic acid activity The probiotic activities of in yoghurt was improved by the selection of lactic acid bacteria that have high probiotic activity Glucuronic acid activity was added to the traditional yogurt through the identification of acetic acid bacteria that produced high glucuronic acid concentration in dairy; and optimization factors affecting glucuronic acid production in yogurt fermentation to obtain the maximal glucuronic acid concentration Isolation and identification bacterial strains determined the highest probiotic activity was Lactobacillus acidophilus with accession code AB911464.1 on the NCBI and the highest glucuronic acid concentration in milk was found in Gluconacetobacter nataicola with accession code NR_041012.1 on the NCBI The Blackett-Burman screening matrix and response surface methodology with central composite design RSM-CCD for optimization the factors affecting the concentration of glucuronic acid production during the yogurt fermentation with factors that have been identified optimal value after screening with 4.43 log CFU/mL initial density of G nataicola, 5.1 log CFU/mL initial density of L acidophilus, 9.96% sucrose, pH and 32°C for fermentation temperature The maximal glucuronic acid concentration at the optimum point in factual situation was 59.81mg/L Yogurt in this study coincided about the quality standards of nutrition and food hygiene and safety of the Health Ministry The results of preliminary sensory evaluation showed no difference between implemented glucuronic acid yogurt and traditional probiotic yogurt iii khác iv i ii SUMARY iii iv v vii viii ix 1.1.1 1.1 1.2.3 Bacteriocin 1.3.3 Lactobacillus acidophilus 10 13 13 Gluconacetobacter 15 18 1.5.1 Ac 18 19 22 26 26 2.1.1 26 v 4.1.3 S lên Phân tích hàm l áp -uronic 88 [1] Buck B.L., 2009 Role of autoinducer-2 on the adhesion ability of Lactobacillus acidophilus Journal of Applied Microbiology, Volume 107, Number 1, July 2009, pp 269-279 [2] Perdigon G et al., 2002 Interaction of lactic acid bacteria with the gut immune system, European Journal of Clinical Nutrition, vol.56 Suppl [3] Nagendra P S et al., 2000 Survival of Lactobacillus acidophilus and Bifidobacterium bifidum in commercial yoghurt during refrigerated storage, Department of Food Technology, Victoria University of Technology, PO Box 14428, MMC, Melbourne, Victoria 3000, Australia Lactobacillus bulgaricus -122 [5] Taous Khan, Salman Khan, Joong Kon Park 2008 Simple Fed-batch Cultivation Strategy for the Enhanced Production of a Single-sugar Glucuronic Acid-based Oligosaccharides by a Cellulose-producing Gluconacetobacter hansenii Strain Biotechnology and Bioprocess Engineering 2008, 13: 240-247 [6] Nafiseh Yavari, Mahnaz Mazaheri Assadi, Kambiz Larijani, Mohammad Bamani Moghadam 2010 Response Surface Methodology for Optimization of Glucuronic Acid Production Using Kombucha Layer on Sour Cherry Juice Australian Journal of Basic and Applied Sciences, 4(8): 3250-3256, ISSN 1991-8178 [7] Nafiseh Yavari, Mahnaz Mazaheri Assadi, Mohammad Bamani Moghadam, Kambiz Larijani 2011 Optimizing Glucuronic Acid Production Using Tea Fungus on Grape Juice by Response Surface Methodology Australian Journal of Basic and Applied Sciences, 5(11): 1788-1794, ISSN 1991-8178 Glucuronic acid containing fermented functional beverages produced by natural yeasts and bacteria associations IJRRAS 14 (1), pp 17-25 Glucuronic acid from fermented beverages: biochemical functions in humans and its role in health protection IJRRAS 14 (2), pp 217-230 [10] Võ Th i h c Nông Lâm TP HCM [11] Zhiwei Yang, Feng Zhou, Baoping Ji, Bo Li, Yangchao Luo, Li Yang, Tao Li 2010 Symbiosis between Microorganisms from Kombucha and Kefir: Potential Significance to the Enhancement of Kombucha Function Appl Biochem Biotechnol DOI 10.1007/s12010-008-8361-6 [12] Nguyen K Nguyen, Ngan T.N Dong, Phu H Le, Huong T Nguyen 2014 Evaluation of the Glucuronic Acid Production and Other Biological Activities of Fermented Sweeten-Black Tea by KBC Layer and the Co-Culture with Different Lactobacillus Sp Strains International Journal Of Modern Engineering Research (IJMER), vol.4, iss.5, ISSN: 2249 6645 [13] Abee, Tjakko, G Beldman, B Broek, J Houben, R Nout., F Rombouts, S Schoustra, F Voragen, J outers, A Noomen, P Walstra 1999 Food fermentation part 1, Department of Food Technology and Nutritional Sciences, Wageningen Agriculture University [14] Bhupinder Singh Sekhon Prebiotics, probiotics and synbiotics: an overview Institute of pharmacy, derparment of biotechnology, 2010 [15] Gert N Moll, Wil N Konings & Arnold J.M Driesse 1999 Bacteriocins: mechanism of membrane insertion and pore formation Antonie van Leeuwenhoek, 76: 185 198 [16] Juodeikiene, G 2012 Fermentation Processes Using Lactic Acid Bacteria Producing Bacteriocins for Preservation and Improving Functional Properties of Food Products Advances in Applied Biotechnology, ISBN 978-953-307-820-5, pp 63-100 [17] Steiner T (2006), Managing Gut Health, First published 2006 Nottingham University Press, Nottingham, UK, pp 45-56 [18] Anukam, C K et al., 2007, Probiotics: 100 years (1907-2007) after Elie cating Current Research and Educational Topics and Trends in Applied Microbiology, A Méndez-Vilas (Ed.) [19] Ventura M (2004), Insight into the taxonomy, genetics and physiology of bifidobacteria Antonie Leuwenhoek [20] Abee, Tjakko., G Beldman, B Broek, J Houben, R Nout., F Rombouts, S Schoustra, F Voragen, J Wouters, A Noomen, P Walstra 1999 Food fermentation part 1, Department of Food Technology and Nutritional Sciences, Wageningen Agriculture University [21] Axelsson, Lars 2004 Acid lactic Bacteria: Classification and Physiology Acid lactic Bacteria microbiological and Functional Aspects Third Edition, Revised and Expanded MATFORSK, Norwegian Food Research Institute, Norway, pp.19-67 [22] Jafarei, P 2011 Review: Lactobacillus acidophilus cell structure and application African Journal of Microbiology Research Vol 5(24), pp 4033-4042 [23] Wheater, M D 1955 The Characteristics of Lactobacillus acidophilus and Lactobacillus bulgaricus J gen Microbiol 12, 123-132 [24] Ganesh, S 2006 MSc Thesis: A novel yogurt product with Lactobacillus acidophilus The Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College [25] Pederson C S., 1995 Microbiology of food fermentation AVI Publishers, USA [26] Frateur 1950 Taxonomy of acetic acid bacteria [27] Jonas R R., Luiz 1998 Production and application of microbial cellulose Polymer degradation and stability, 59: 101-106 [28] Hestrin S., Schramm M 1954 Factor affecting production of cellulose at the air liquid interface of a culture of Acetobacter xylinum Journal of General Microbiology, 11: 123-129 [29] Aly Savadogo, C A T Ouattara, H N Bassole Imael, S Alfred Traore 2006 Bacteriocins and acid lactic bacteria - a minireview African Journal of Biotechnology Vol (9), pp.678-683 Lactococcus lactic T p chí Khoa h c Cơng ngh , 11: tr 100 109 [31] Corina Ceapa Influence of fermented milk products, prebiotics and probiotics on microbiota composition and health Best Practice & Research Clinical Gastroenterology; Danone Research Centre for Specialized Nutrition, 2010 [32] Chittagong, Bangladesh; Md Mahbubur Rashid Review: probiotic, prebiotic, synbiotics and human healthy a treatise; Bulletin of pharmaceutical research, 2012 [33] Sweta V Chauhan and Mehul R Chorawala Review Article: Probiotics, Prebiotics and Synbiotics 2012 International journal of pharmaceutical sciences and research [34] Dufresne C., Farnworth E., 2000 Tea, Kombucha, and health: a review Food Research International, vol 33, pp409- 421 [35] [36] Plackett RL, Burman JP 1946 The design of optimum multifactorial experiments Biometrika 37: 305-325 [37] Castillo E Del 2007 Process Optimization A Statistical Approach Springer Science New York, USA: 118-122 [38] Ogunbanwo, S.T., A.I Sanni and A.A Onilude 2003 Influence of cultural conditions on the production of bacteriocin by Lactobacillus brevis OG1 African Journal of Biotechnology Vol (7), pp 179-184 [39] Sarika, A R., A P Lipton and M S Aishwarya 2010 Bacteriocin production by a new isolate of Lactobacillus rhamnosus GP1 under different culture conditions Advance Journal of Food Science and Technology, 2: pp 291 297 [40] Ouwehand, Arthur Satu Vesterlund 2004 Antimicrobial Components from Acid lactic Bacteria University of Turku, Finland pp 375-397 [41] Tomas M S et al., 2003 Growth and lactic acid production by vaginal Lactobacillus acidophilus CRL 1259, and inhibition of uropathogenic Escherichia coli CERELA-CONICET (Centro de Referencia para Lactobacilos), Chacabuco 145, 4000, Tucumán, Argentina Institute of Biometrics, University Hospital, Hannover, Germany [42] Heath P B et al., 2012 Personal cleansing compositions comprising a bacterial cellulose netwoek and cationic polymer US 8097574B2, USA Patent [43] Trachoo, N 2002 Yogurt: The fermented milk Songklanakarin J Sci Technol, Vol 24, No Oct [44] Hwang, J.W., Hwang, J.K., Pvun, Y R., Kim, Y.s (1999) Effects of pH and dissolved oxygen on cellulose production by Acetobacter xylinum BRC5 in agitated culture J Ferment Bioeng, 88: 183-188 [45] Arie B B et al., 1992 Reticulated cellulose and methods and microorganisim for production thereof US 5144021, USA Patent Lactobacillus sp có cá tra T p chí Khoa h c 2012:23a 224-234 ih cC MRS Peptone 10g Glucose 20g 5g 5g Natri acetate 2g Diamonicitrate 2g Tween 80 lml MgS04.7H20 0.2g MnS04.4H20 0.2g KH2PO4 2g Agar 20g 1000ml pH = 6.2 - 6.5 Glucose HS 20g Yeast extract 5g Pepton 3g Na2HPO4 5g Acid citric 1.15g Agar 1.8g 1000ml pH = -5.5 PHÒNG XÉT NGHIỆM NK-BIOTEK 793/58 TRẦN XUÂN SỌAN, P TÂN HƯNG, Q.7, TP HCM ĐT: (08) 37715818, (08) 37752252 Fax: (08) 37750583, ( 08) 37752250 Email: phhvan.nkbiotek@gmail.com, namkhoa.biotek@gmail.com GP soá: 41G8005341 Theo định hướng ISO 15189 331/2014/DVVS TR1 S rR BLAST SEARCH Gram S TGGCTCAGAGCGAACGCTGGCGGCATGCTTAACACATGCAAGTCGCACGAACCTTTCGGGGTTAGTGGC TGTCCACGGGTGGGGGATAACTTTGGGAAACTGAAGCTAATACCGCATGACACCTGAGGGTCAAAG TCGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGATGATCGATAGCTGGTCTGAGAGGAT CAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAAT AAAGCACTTTCAGCGGGGACGATGATGACGGTACCCGCAGAAGAAGCCCCGGCTAACTTCGTGC Gluconacetobacter nataicola strain LMG 1536 16S ribosomal RNA gene, partial sequence Sequence ID: ref|NR_041012.1|Length: 1452Number of Matches: See more title(s) Related Information Range 1: 14 to 457GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 821 bits(444) 0.0 444/444(100%) 0/444(0%) Plus/Plus Query TGGCTCAGAGCGAACGCTGGCGGCATGCTTAACACATGCAAGTCGCACGAACCTTTCGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14 TGGCTCAGAGCGAACGCTGGCGGCATGCTTAACACATGCAAGTCGCACGAACCTTTCGGG 73 Query 61 GTTAGTGGCGGACGGGTGAGTAACGCGTAGGGATCTGTCCACGGGTGGGGGATAACTTTG 12 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 74 GTTAGTGGCGGACGGGTGAGTAACGCGTAGGGATCTGTCCACGGGTGGGGGATAACTTTG 13 Query 121 GGAAACTGAAGCTAATACCGCATGACACCTGAGGGTCAAAGGCGCAAGTCGCCTGTGGAG 18 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 134 GGAAACTGAAGCTAATACCGCATGACACCTGAGGGTCAAAGGCGCAAGTCGCCTGTGGAG 19 Query 181 GAACCTGCGTTCGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGATGATCGATAG 24 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 194 GAACCTGCGTTCGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGATGATCGATAG 25 Query 241 CTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGA 30 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 254 CTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGA 31 Query 301 GGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGT 36 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 314 GGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGT 37 A.xylinum rung bình log CFU/mL OD GluA OD GluA OD GluA mg/L 0.317 30.72 0.294 28.55 0.312 30.25 29.84 0.346 33.45 0.348 33.64 0.331 32.04 33.04 0.351 33.92 0.355 34.30 0.348 33.64 33.96 0.263 25.62 0.267 26.00 0.268 26.09 25.91 L acidophilus log CFU/mL L OD GluA OD GluA OD GluA mg/L 0.341 32.98 0.343 33.17 0.344 33.26 33.14 0.356 34.40 0.359 34.68 0.351 33.92 34.33 0.294 28.55 0.297 28.83 0.29 28.17 28.52 0.261 25.43 0.263 25.62 0.256 24.96 25.34 n1 Sucrose OD GluA OD GluA OD GluA mg/L 5% 0.231 22.60 0.238 23.26 0.217 21.28 22.38 7.5% 0.338 32.70 0.339 32.79 0.339 32.79 32.76 10% 0.352 34.02 0.361 34.87 0.357 34.49 34.46 12.5% 0.339 32.79 0.338 32.70 0.336 32.51 32.67 15% 0.326 31.57 0.317 30.72 0.331 32.04 31.44 OD GluA OD GluA OD GluA mg/L 25°C 0.317 30.72 0.3 29.11 0.314 30.43 30.09 30°C 0.351 33.92 0.367 35.43 0.353 34.11 34.49 35°C 0.423 40.72 0.428 41.19 0.436 41.94 41.28 40°C 0.178 17.60 0.178 17.60 0.175 17.32 17.51 45°C 0.109 11.09 0.116 11.75 0.101 10.34 11.06 pH OD GluA OD GluA OD GluA mg/L 0.351 33.92 0.349 33.74 0.351 33.92 33.86 4.5 0.364 35.15 0.357 34.49 0.361 34.87 34.84 0.445 42.79 0.471 45.25 0.462 44.40 44.14 5.5 0.427 41.09 0.416 40.06 0.435 41.85 41.00 0.159 15.81 0.228 22.32 0.216 21.19 19.77 OD GluA OD GluA OD GluA mg/L 12h 0.222 21.75 0.222 21.75 0.22 21.57 21.69 24h 0.456 43.83 0.469 45.06 0.448 43.08 43.99 36h 0.467 44.87 0.448 43.08 0.459 44.11 44.02 48h 0.418 40.25 45.15 0.481 46.19 43.86 OD GluA 0.47 OD GluA OD GluA mg/L 60rpm 0.452 43.45 0.458 44.02 0.464 44.58 44.02 90rpm 0.468 44.96 0.424 40.81 0.447 42.98 42.92 120rpm 0.455 43.74 0.452 43.45 0.466 44.77 43.99 150rpm 0.412 39.68 0.449 43.17 0.451 43.36 42.07 180rpm 0.441 42.42 0.439 42.23 0.473 45.43 43.36 c 901 352 186 [1] Huong H.L Ly, Huong T Nguyen 2014 Optimization of Factors Affecting Glucuronic Acid Production in Yogurt Fermentation International Journal of Modern Engineering Research (IJMER), vol.4, iss.6, pp 52-58 ISSN: 2249 6645 [2] Huong H.L Ly, Huong T Ha, Huong T Nguyen 2014 Isolation and Identification High-Biological Activity Bacteria in Yogurt Quality Improvement International Journal of Modern Engineering Research (IJMER), vol.4, iss.8, ID: 44148, ISSN: 2249 6645 [3] Lý Hu d ng ma tr n Plackettng b m t - (RSM-CCD) Lactobacillus acidophilus - ... u m i mang tính ch t có ho t tính sinh h c quan tr i v i s c kh acid glucuronic trình lên men s a chua V i m nghiên c tài c as M c tiêu c i xu t u ki n lên men nâng cao ho t tính sinh h c tài... cao nh m vi khu n acetic nh m vi khu n lactic nh ng b sung T nh nhi lên men nh ng pH nh th i gian lên men nh nh ng c a ch l o ut n ho t tính sinh h c c a s a chua S a chua probiotic có ho t tính. .. c tài k t h p nh c tính có l i c a ch ng vi khu n lactic vi khu n acetic trình lên men s a chua, t o nên m t s n ph m s a chua có ho t tính sinh h c cao t vi c thêm vào ho t tính c a acid glucuronic,