FULL ĐỀ THI OLYMPIC SINH HỌC QUỐC TẾ 2014 PART A

FULL ĐỀ THI OLYMPIC SINH HỌC QUỐC TẾ 2014 PART A Khi có mặt estrogen, protein thụ thể α của estrogen (kí hiệu ERα) điều hòa biểu hiện của khoảng 10.000 gen ở người. Để nghiên cứu khả năng tương tác giữa protein X với ERα, em phải tạo ra những tế bào thiếu gen x (dòng tế bào này gọi là KO). Em xử lý các dòng KO và kiểu dại (WT) với estrogen (+E) hoặc không (-E). Rồi sau đó, em tiến hành phản ứng kết tủa miễn dịch chất nhiễm sắc (phương pháp này gọi là ChIP, như minh họa ở hình dưới); theo đó, trước tiên các protein ERα liên kết vào các vị trí gắn kết trong hệ gen của chúng (kiểu liên kết này có thể nghịch đảo). Hệ gen sau đó được phân mảnh rồi các phân đoạn chất nhiễm sắc chứa ERα được chiết tách nhờ các kháng thể đa dòng kháng ERα.

IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 25th INTERNATIONAL BIOLOGY OLYMPIAD – 13 July, 2014 INDONESIA THEORETICAL TEST PART A ĐỀ THI LÝ THUYẾT PHẦN A Total points (Tổng điểm): 50 Duration (Thời gian): 180 minutes (phút) COUNTRY: NƯỚC STUDENT ID: SỐ BÁO DANH 7/10/14 10:19 AM VIETNAM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A INSTRUCTIONS: Fill in your STUDENT ID and your country in the Answer Sheet Each question contains four statements which you must indicate as True or False  If you answer correctly to all four statements, you will receive point  If you answer correctly to only three statements, you will receive 0.6 point  If you answer correctly to only two statements, you will receive 0.2 point  If there is only one statement with the correct answer, you will not receive any points (0)  There is no minus system Tick (√) the correct answer in your Answer Sheet using a pen (in ink) If you need to change an answer, you should strikethrough the wrong answer and write in the new one (see the example below) In the table, T=True, F=False No Statement T A B √ C √ D √ You may use a calculator in your exam GOOD LUCK F √ √ √ HƯỚNG DẪN: Nhớ ghi SỐ BÁO DANH vào trang bìa PHIẾU TRẢ LỜI Mỗi câu hỏi gồm lựa chọn, phải rõ lựa chọn ĐÚNG hay SAI  Nếu lựa chọn đúng, điểm  Nếu lựa chọn đúng, 0,6 điểm  Nếu lựa chọn đúng, 0,2 điểm  Nếu có lựa chọn đúng, Không điểm (0)  Không trừ điểm lựa chọn sai Đánh dấu (√) vào phương án lựa chọn Phiếu trả lời rõ ràng bút mực (hoặc bút bi) Nếu muốn thay đổi phương án lựa chọn trước đó, gạch ngang câu trả lời sai, viết lại câu trả lời (lựa chọn) rõ ràng (xem ví dụ đây) Trong tất bảng, T = True (ĐÚNG), F=False (SAI) No Phát biểu A T F √ B √ C √ D √ √ √ Có thể sử dụng máy tính tay làm CHÚC EM MAY MẮN 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A CELL AND MOLECULAR BIOLOGY / SINH HỌC PHÂN TỬ VÀ TẾ BÀO In the presence of estrogen, the estrogen receptor α (ERα) regulates around 10,000 genes in humans To study the interaction of protein X with ERα, you have generated cells that lack gene x (KO) You treat KO and wild type (WT) cells with estrogen (+E) or not (-E) You next perform Chromatin Immunoprecipitation (ChIP, see figure below) , in which ERα proteins are first temporarily cross linked to their current binding location in the genome The genome is fragmented and fragments containing Erα are extracted with polyclonal antibodies against ERα Khi có mặt estrogen, protein thụ thể α estrogen (kí hiệu ERα) điều hịa biểu khoảng 10.000 gen người Để nghiên cứu khả tương tác protein X với ERα, em phải tạo tế bào thiếu gen x (dòng tế bào gọi KO) Em xử lý dòng KO kiểu dại (WT) với estrogen (+E) không (-E) Rồi sau đó, em tiến hành phản ứng kết tủa miễn dịch chất nhiễm sắc (phương pháp gọi ChIP, minh họa hình dưới); theo đó, trước tiên protein ERα liên kết vào vị trí gắn kết hệ gen chúng (kiểu liên kết nghịch đảo) Hệ gen sau phân mảnh phân đoạn chất nhiễm sắc chứa ERα chiết tách nhờ kháng thể đa dịng kháng ERα [Ghi hình: Antibody = Kháng thể; Chromatin = Chất nhiễm sắc; DNA ladder = Thang chuẩn kích thước ADN] 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A After releasing Erα, the DNA fragments are isolated and amplified with primers for the promoter region of a gene a, known to be upregulated by estrogen Electrophoresis results are shown below Sau xử lý giải phóng khỏi ERα protein khác, phân đoạn ADN phân lập khuếch đại (theo kiểu định lượng) cặp mồi đặc hiệu với vùng promoter gen a vốn bình thường tăng cường biểu estrogen yếu tố phiên mã Kết điện di sản phẩm khuếch đại thu Indicate if each of the following statements is true or false This experiment suggests that protein X interferes with the binding of ERα to : Mỗi phát biểu hay sai? Thí nghiệm cho thấy protein X ảnh hướng đến liên kết protein ERα tới : A .the promoters of all gene regulated by ERα vùng promoter tất gen hệ gen điều hòa ERα B .the promoter of gene a vùng promoter riêng gen a C .all its possible protein partners tất protein thành phần có D .the protein product of gene a sản phẩm protein gen a 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A An experiment was performed to study the relation between H+ concentration and ATP synthesis in mitochondria Mitochondria were isolated from the cell and placed into a pH media (test tube A), then immediately transferred into a pH media (test tube B) Later, ATP synthesis was verified in test tube B Người ta tiến hành thí nghiệm để tìm hiểu mối quan hệ nồng độ H+ sinh tổng hợp ATP ti thể (mitochondria) Ti thể phân lập từ tế bào đặt vào mơi trường có pH (ống nghiệm A), tức chuyển sang mơi trường có pH (ống nghiệm B) tổng hợp ATP ống nghiệm B ghi nhận [Ghi hình: Outer membrane=Màng ngồi ti thể; Intermembrane space= Khoảng màng màng ti thể; Inner membrane=Màng ti thể; Matrix=Chất nền] Indicate if each of the following statements is true or false Mỗi phát biểu hay sai? A In tube B, ATP was synthesized in the matrix of mitochondria Ở ống B, ATP tổng hợp chất ti thể B In tube B, ATP was synthesized without the help of electron transport system Ở ống B, ATP tổng hợp mà không thiết cần chuỗi chuyền điện tử C If mitochondria in tube A was transferred into a pH media, ATP synthesis will occur in the intermembrane space of mitochondria Nếu ti thể ống A chuyển sang mơi trường có pH 9, tổng hợp ATP xuất vùng hai lớp màng ti thể D If mitochondria remains in tube A but glucose is added, there will be ATP synthesis Nếu tiếp tục giữ ti thể ống A glucôzơ bổ sung ATP tổng hợp 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A You plan to insert the gene PhoQ from Tobibacterium sp into a plasmid vector containing an artificial promotor followed by a restriction site for NcoI (CCATGG) and a restriction site for EcoRI (GAATTC) Em dự kiến cài gen PhoQ phân lập từ loài thuộc chi Tobibacterium vào vectơ plazmit chứa promoter nhân tạo phía sau (xi dịng) có vị trí giới hạn enzym NcoI (CCATGG) vị trí giới hạn EcoRI (GAATTC) Promoter NcoI EcoRI Plasmid vector To conduct this experiment you are required to design forward (the sense strand) and reverse (antisense strand) primers of 20 nucleotides that not affect the reading frame Part of the 561 nucleotide long coding sequnce is shown below Để thực thí nghiệm này, bạn phải thiết kế cặp mồi xi (mạch mã hóa) mồi ngược (mạch đối mã) gồm 20 nucleotit nằm phía ngồi khung đọc mở Một phần đoạn trình tự mã hóa thuộc gen dài 561 nucleotit sau 5’-ATGCGACAGTTCATCACCGA GCGGGACCGGACTGGGGTAA-3’ Indicate if each of the following statements is true or false Mỗi phát biểu hay sai? A The use of two restriction sites avoids wrong orientation of the inserted fragment Hai vị trí giới hạn với trình tự giúp đoạn cài gắn chiều vào vectơ B A possible forward primer for amplification and recombination of PhoQ gene will have the following sequence: 5’ – CCATGGGAATGCGACAGTTC – 3’ Một mồi xuôi để khuếch đại tái tổ hợp gen PhoQ vào vectơ nêu có trình tự sau đây: 5’ – CCATGGGAATGCGACAGTTC – 3’ C A possible reverse primer for amplification and recombination of PhoQ gene will have the following sequence: 5’ – GAATTCAATGGGGTCAGGCC – 3’ Một mồi ngược để khuếch đại tái tổ hợp gen PhoQ vào vectơ nêu có trình tự sau đây: 5’ – GAATTCAATGGGGTCAGGCC – 3’ D The final gene product will consist of at least 189 amino acids Sản phẩm gen biểu vectơ có 189 axit amin 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Indicate if each of the following statements about posttranslational modification of eukaryotic proteins is true or false Mỗi phát biểu hay sai nói biến đổi sau dịch mã protein sinh vật nhân thực? A Disulfide bond formation on a protein occur in the endoplasmic reticulum Sự hình thành cầu đisunphit phân tử protein diễn lưới nội chất B Glycoproteins may be found in viruses that infect human Glycoprotein tìm thấy virut lây nhiễm người C Oligosaccharide group addition to a protein may occur in both Golgi apparatus and endoplasmic reticulum Việc bổ sung nhóm oligosacarit vào protein diễn máy Golgi lưới nội chất D Palmitoylation of a protein can change its intracellular localization Việc gắn thêm nhóm (gốc) palmitoyl vào phân tử protein làm thay đổi vị trí định vị nội bào protein 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A An experiment was performed to create a recombinant DNA between plasmid X and DNA insert Y Plasmid X contains leu2 gene for leucine biosynthesis while DNA fragment Y contains kanamycin-resistance gene KanR The diagram for X and Y are shown below Người ta tiến hành thí nghiệm để tạo ADN tái tổ hợp plazmit X đoạn cài ADN kí hiệu Y Plazmit X mang gen leu2 cần cho sinh tổng hợp Lơxin phân đoạn Y chứa gen kháng kháng sinh kanamycin KanR Hình biểu diễn sơ đồ cấu trúc X Y với vị trí giới hạn DNA insert Y (contains KanR) Plasmid X [Ghi hình: DNA insert Y (contains KanR) = Đoạn cài ADN kí hiệu Y (chứa gen KanR); Ori1 = Trình tự khởi đầu tái bản] Plasmid X and DNA insert Y were added to a reaction mix containing restriction enzymes BglIII (5’A*GATCT-3’), BamHI (5’-G*GATCC-3’), and the resulting fragments then transferred to a new reaction mix containing ligase The resulting DNA was transformed into bacterial culture Z which is sensitive to kanamycin and unable to survive in leucine-deficient medium Selection for transformed Z cells containing the recombinant plasmid (plasmid X with DNA insert Y) was performed by growing the culture on a selective medium containing kanamycin and no leucine The recombinant plasmid was then isolated from the culture Assume that all isolated plasmids are in circular conformation and there is no partial restriction reaction, all (Note: (*) indicates the location of bond hydrolysis) Plazmit X đoạn cài Y bổ sung vào hỗn hợp phản ứng chứa enzym giới hạnBglIII (với trình tự giới hạn 5’-A*GATCT-3’), BamHI (5’-G*GATCC-3’) phân đoạn ADN thu sau chuyển sang hỗn hợp phản ứng chứa ligaza Phân tử ADN tái tổ hợp nhận sau biến nạp vào chủng vi khuẩn Z vốn mẫn cảm với Kanamycin sống môi trường thiếu lowxxin Để chọn tế bào Z chứa plazmit tái tổ (gồm plazmit Z đoạn cài Y), vi khuẩn Z sau biến nạp nuôi môi trường chọn lọc chứa kháng sinh Kanamycin khơng có lơxin Từ vi khuẩn sống sót, plazmit tái tổ hợp phân lập Giả sử tất plazmit phân lập có dạng vịng phản ứng cắt giới hạn xảy hoàn toàn (nghĩa tất plazmit cắt enzym giới hạn) [Lưu ý: dấu (*) trình tự giới hạn vị trí thủy phân enzym giúp xác định khả bổ sung phân đoạn cắt giới hạn) plasmids are cut completely by the restriction enzyme 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Indicate if each of the following statements is true or false Mỗi phát biểu hay sai? A Cutting the recombinant plasmid using EcoRI will result in single 2800 bp DNA fragment on the electrophoresis gel Dùng EcoRI để cắt plazmit tái tổ hợp thu phân đoạn ADN có kích thước 2800 bp gel điện di B If in the reaction mix HindIII (5’-A*AGCTT-3’) was used instead of BglIII, the transformed bacteria are capable of growing on a medium containing Kanamycin Nếu hỗn hợp phản ứng, HindIII (5’-A*AGCTT-3’) dùng thay cho BglIII, vi khuẩn sau biến nạp với vectơ tái tổ hợp có khả sinh trưởng môi trường Kanamycin C The 500 bp insert DNA can be removed from the recombinant plasmid by using restriction enzyme BglIII Có thể tách đoạn cài ADN dài 500 bp khỏi plazmit tái tổ hợp enzym BglIII D The migration pattern of the recombinant plasmid on an electrophoresis gel is different when it is cut with EcoRI or BamHI Kiểu hình điện di plazmit tái tổ hợp khác so với cắt hỗn hợp EcoRI BamHI 7/10/14 10:19 AM IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Consider a protein containing four epitopes: an oligosacharide ( O ) and three peptides (P1, P2, P3) The following figure illustrates the interaction between B and T cells Xem xét protein chứa epitop (vùng định dạng kháng nguyên) gồm gốc oligosacarit (kí hiệu O) peptit (kí hiệu P1, P2, P3) Hình sau minh họa mối tương tác tế bào lympho B T (modified from Edwards & Cambridge, 2006) [Ghi hình: Antigen = Kháng nguyên; Membrane bound antibody = Kháng thể liên kết màng; T cell receptor = Thụ thể tế bào T; MHC class II = Phức hệ tương hợp mô lớp II; T cell = Tế bào T; B cell = Tế bào B] Indicate if each of the following statements is true or false Mỗi phát biểu hay sai? A Antibody production for epitope O by B cells may occur only when the O epitope is presented by B cells to T cells Tế bào B tạo kháng thể kháng epitop O epitop O tế bào B trình diện tới tế bào T B All of the four epitopes could be recognized by the population of B cells Cả loại epitop nhận biết quần thể lớn tế bào B C A single B cell produces antibodies recognizing only one of the four epitopes Một tế bào B riêng lẻ nhận biết loại epitop D Via MHC II proteins, a single B cell can present diverse protein fragments to the T cells Qua phức hệ protein tương hợp mô MHC lớp II, tế bào B riêng lẻ trình diện nhiều phân đoạn protein khác đến tế bào T 7/10/14 10:19 AM 10 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A ECOLOGY SINH THÁI HỌC 41 The spatial dispersion of individuals in a population reflects interactions among individuals and between individuals and the environment Below are three population dispersion patterns Indicate if each of the following statements is true or false Sự phân bố không gian cá thể quần thể phản ánh mối quan hệ cá thể cá thể môi trường Dưới kiểu phân bố cá thể quần thể Hãy câu sai A Pattern I suggests strong interactions among individuals Kiểu phân bố I thể mối quan hệ khăng khít cá thể B Pattern II suggests antagonistic interaction among individuals Kiểu phân bố II thể mối quan hệ cạnh tranh mạnh cá thể C Pattern III suggests symbiotic interaction among individuals Kiểu phân bố III thể mối quan hệ cộng sinh các thể D Pattern I suggests the attraction of individuals to a common resource Kiểu phân bố I thể cá thể có nhu cầu sử dụng nguồn tài nguyên cao 7/10/14 10:19 AM 60 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 42 In the food web below, the population of Predator has been declining sharply due to hunting by humans This is expected to affect the populations of other species Indicate if each of the following statements is true or false: Trong lưới thức ăn đây, quần thể vật ăn thịt (Predator 4) bị giảm số lượng nhanh chóng săn bắt người Điều ảnh hưởng tới quần thể loài khác lưới thức ăn Hãy câu sau sai: A A population decrease in Predator will result in an increase of Herbivore Quần thể Động vật ăn thịt giảm dẫn đến quần thể Động vật ăn cỏ tăng B A population decrease in Predator will result in an increase of Predator Quần thể Động vật ăn thịt giảm đẫn đến quần thể Động vật ăn thịt tăng C A population decrease in Predator will result in a decrease in the Omnivore Quần thể Động vật ăn thịt giảm dẫn đến Động vật ăn tạp giảm theo 7/10/14 10:19 AM 61 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A D There are four tertiary consumers in the food web above Có Sinh vật tiêu thụ bậc lưới thức ăn 7/10/14 10:19 AM 62 IBO 2014 BALI, INDONESIA 43 THEORETICAL TEST PART A The Sumatran elephant (Elephas maximus sumatranus) seen in the Bali Safari Park is a protected herbivore in Indonesia Despite this, elephant populations are threatened by poaching and habitat loss, including the conversion of forests into oil palm plantations and cultivated lands This has led to the fragmentation of forest areas Consequently, elephants often enter human inhabited areas, damaging plantations and increasing human-elephant conflict Elephants tend to strongly avoid areas intensively used by humans Indicate if each of the following statements is true or false Voi Sumatran (Elephas maximus sumatranus) công viên Bali Safari loài động vật ăn cỏ bảo vệ Indonesia Mặc dù bảo vệ, quần thể loài voi gặp nguy hiểm nạn săn trộm nơi ở, có việc lấy đất rừng để trồng cọ dầu làm đất nông nghiệp Điều dẫn đến phân cắt rừng Hậu voi thường vào vực sinh sống người dân, phá hoại trồng làm tăng mâu thuẫn voi người dân Các voi có xu hướng tránh vùng người sử dụng thường xuyên Hãy câu sau hay sai A Elephants often cannot fulfil their dietary needs in the forest and are attracted to cultivated plants Các rừng không cung cấp đủ thức ăn cho voi nên chúng phải sử dụng thức ăn từ trồng B Elephants will enter human settlements because they are part of the elephant’s natural home range Các voi vào khu vực mà người định cư khu vực mà người định cư nằm khu vực sinh sống tự nhiên voi trước C Elephants occupy the top position in the food chain Các voi giữ vị trí cao chuỗi thức ăn D Habitat fragmentation may not lead to the formation of elephant metapopulations because elephents are very adaptive Sự phân cắt nơi khơng dẫn tới hình thành nên quần thể voi siêu lớn voi có khả thích nghi 7/10/14 10:19 AM 63 IBO 2014 BALI, INDONESIA 44 THEORETICAL TEST PART A Paddy (rice) fields in Indonesia are habitats for many aquatic organisms, including mosquito larvae and the phytoplankton they feed on Phytoplankton depend on water and sunlight availability for their growth The figure below shows the relationship between the four-month variation in the amount of phytoplankton (expressed as chlorophyll-a concentration) and the community composition of Anopheles (An.) and Culex (Cx.) mosquitoes Indicate if each of the following statements is true or false Cánh đồng lúa Indonesia nơi sống nhiều sinh vật thủy sinh, có ấu trùng muỗi thực vật phù du mà ấu trùng muỗi ăn Thực vật phù du phụ thuộc vào nguồn nước ánh sáng để sinh trưởng Hình thể mối quan hệ thay đổi số lượng thực vật phù du (thông qua lượng diệp lục chlorophylla) tháng với thành phần quần xã gồm muỗi Anopheles (An.) muỗi Culex (Cx.) A : Nồng độ Hãy câu sai A An sineroides and An koreicus have similar light intensity requirements Muỗi An sineroides muỗi An koreicus nhu cầu ánh sáng B Cx orientalis can avoid interspecific competition due to its relatively high tolerance to heat 7/10/14 10:19 AM 64 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Muỗi Cx orientalis tránh cạnh tranh với lồi khác có khả chịu nóng tương đối cao đối C The lower chlorophyll-a concentration in July is due only to heavy predation of phytoplankton Nồng độ diệp lục a thấp tháng bị ấu trùng muỗi ăn nhiều thực vật phù du D Paddy biomass is positively correlated with richness of mosquito species Sinh khối cánh đồng lúa tỉ lệ thuận với độ phong phú loài muỗi 7/10/14 10:19 AM 65 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 45 A rank-abundance curve portrays the relative abundance and diversity of species within a plant community The rank of each species is plotted along the horizontal axis according to decreasing abundance The vertical axis plots the abundance of each species on a log scale The following graph compares rank abundances in plant Communities A and B Indicate if each of the following statements is true or false: RELATIVE ABUNDANCE (LOG) Đường cong độ giàu loài thể số lượng loài mức độ đa dạng loài quần xã Vị trí lồi đánh dấu dọc theo trục hoành, theo số lượng giảm dần Trục tung thể số lượng cá thể loài theo hàm logarit Đồ thị so sánh số lượng loài quần xã thực vật A B Community A Community B ABUNDANCE RANK Chú thích hình: Community A = Quần xã A; Community B = Quần xã B Hãy câu sai A Palnt Community A has a lower species richness than plant Community B Quần xã thực vật A có số lượng lồi Quần xã B B Plant Community A has a lower species evenness than plant Community B Quần xã thực vật A có mức độ cân lồi so với Quần xã thực vật B C Plant Community A has a lower diversity index than plant Community B Quần xã thực vật A có mức độ đa dạng thấp Quần xã thực vật B D Plant Community A is likely to be exposed to more generalist herbivores than plant Community B Quần xã thực vật A dường có nhiều động vật ăn cỏ Quần xã thực vật B 7/10/14 10:19 AM 66 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A ETHOLOGY TẬP TÍNH HỌC 46 Peter Marler’s studies on song learning in white-crowned sparrows showed how innate programs and experience each contribute to the development of singing and behavior Mature male white-crowned sparrows sing a species-specific courtship song during the mating season Marler asked if the song was the result of an innate program, learning, or both The spectograms of two analysed songs are shown below: Indicate if each of the following statements is true or false Các nghiên cứu ông Peter Marler việc học hót chim sẻ trắng cho thấy chương trình bẩm sinh kinh nghiệm góp phần vào phát triển giọng hót tập tính Con sẻ đực có giọng hót đặc trưng thu hút bạn tình lồi mùa sinh sản Ông Marler đặt câu hỏi giọng hót hình thành bẩm sinh hay học tập hay hai (vừa bẩm sinh vừa học tập) Biểu đồ tần số âm thể hai giọng hót khác Chú thích hình: (a) Chim đực nghe tiếng hót chim đực khác lồi (b) Chim đực khơng nghe tiếng hót đực khác Thời gian (giây) Hãy câu sai A When young birds hear their own species’song, they selectively learn songs sharpen their genetic template and thus improve their song output Khi chim non nghe thấy tiếng khác lồi, học bắt chước, rèn luyện đến hót xác giọng mà nghe 7/10/14 10:19 AM 67 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A B Isolated birds’song not contain any elements of adult songs Giọng hót chim bị sống cách li khơng nghe tiếng hót chim lồi khơng có thành tố giọng hót trưởng thành C The males that not learn song from conspecifics may lost their reproductive advantage Con đực khơng học hót từ lồi lợi sinh sản D Auditory feedback from conspecifics affects predominantly the syllable types that appear in a song Sự phản hồi âm từ loài chủ yếu tác động tới kiểu âm tiết xuất giọng hót 7/10/14 10:19 AM 68 IBO 2014 BALI, INDONESIA 47 THEORETICAL TEST PART A Selection experiments based on sexual signals have demonstrated that a male trait and female preference can coevolve An experiment, shown below, was conducted to examine the responses of female swordtail fish Xiphophorus helleri to animated video images of: A Intact swordtail male, B swordless male, C sword only, and D enlarged swordless male The Y axis shows the association of females with the respective images Indicate if each of the following statements is true or false Thí nghiệm chọn lọc dựa tính hiệu giới tính minh chứng tính trạng định đực đồng tiến hóa với ưa thích Một thí nghiệm tiến hành để kiểm tra phản ứng cá kiếm Xiphophorus helleri với hình ảnh động vedio trường hợp: A cá đuôi kiếm đực cịn ngun đi; B đực khơng có đi, C có kiếm, D đực khơng có kiếm phóng to Trục Y thể tụ họp với hình ảnh tương ứng Y : thời gian tụ họp trung bình với hình ảnh (giây) Chú thích hình: Swordtailed = đực có kiếm; Swordless = Con đực khơng có kiếm; Intact swordtail male = đực có ngun vẹn; Sword only = đuôi kiếm; Enlarged swordless male = khơng kiếm phóng đại Hãy câu sai A Females favor the more exaggerated male traits and find them attractive 7/10/14 10:19 AM 69 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Các thích tính trạng đực phóng đại thấy chúng hấp dẫn B Body size is a stronger cue than swordtail for female preference Kích thước thể ảnh hưởng mạnh tới thích thú so với kiếm C An extravagant trait is metabolically expensive to produce and is expected to increase a male’s chances of survival Tính trạng phóng đại mức tốn mặt chuyển hóa để tạo thành làm tăng hội sống sót đực D Swords offer males a more metabolically inexpensive signal to attract females than an enlarged body Các đuôi kiếm cung cấp cho đực tín hiệu rẻ mặt trao đổi chất để thu hút tăng kích thước thể 7/10/14 10:19 AM 70 IBO 2014 BALI, INDONESIA 48 THEORETICAL TEST PART A Shoaling, a group of conspecific, is a common antipredatory adaptation in several fish species The advantages of shoaling include increased vigilance, lower individual risk of capture and confusion of predators However, parasitic infections may alter shoaling behaviour by impairing sensory and motor systems and reducing the net benefit of shoaling The effect of parasitic infection on shoaling behavior was investigated by measuring the number of fish in a shoal, number of shoals, and DNN or Distance to Nearest Neighbour within a shoal * indicate significant value Indicate if each of the following statements is true or false Kết đàn, nhóm cá thể lồi, thích nghi thường gặp số loài cá theo hướng chống lại động vật ăn thịt Lợi ích việc kết đàn tăng tính cảnh giác đề phòng, giảm nguy bị bắt cá thể đánh lừa vật ăn thịt Tuy nhiên, bị nhiễm kí sinh làm thay đổi tập tính kết đàn làm cân cảm giác hệ thống thăng bằngvà làm giảm ưu túy việc kết đàn Ảnh hưởng nhiễm kí sinh với tập tính kết đàn xác định cách đo số lượng cá đàn, số lượng đàn, DNN (khoảng cách gần tới bên cạnh đàn) Chú thích hình: * số liệu có ý nghĩa thống kê; X : Số lượng cá đàn; Y : Số đàn; Z : DNN (cm); Control fish = Cá đối chứng; Infected fish=Cá nhiễm; No predator=Khơng có vật ăn thịt; Predator present=Có vật ăn thịt Hãy câu sai A Infected fish tends to form smaller shoals Cá bị nhiễm có xu hình thành đàn nhỏ B The tendency of fish to aggregate and form fewer shoals , when they encounter predators, is independent of infection Xu hướng tụ hợp thành đàn nhỏ cá gặp vật ăn thịt không phụ thuộc vào việc nhiễm kí sinh C Infected fish are more likely to be detected by a predator because they form larger number of shoals Cá bị nhiễm kí sinh dễ bị vật ăn thịt phát chúng tạo thành nhiều nhóm D The confusion effect of shoaling is less effective with infected fish Tác động đánh lừa vật ăn thịt đàn cá hiệu cá bị nhiễm kí sinh 7/10/14 10:19 AM 71 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A BIOSYSTEMATICS SINH HỌC HỆ THỐNG 49 Assuming that the branches of a phylogenetic tree reflect taxon age, phylogenetic diversity is a measure of biodiversity, which includes information about the phylogeny of taxa It can be estimated as the sum of branch lengths, including that of the group of interest, where the length of the smallest branch is one A phylogenetic tree of eudicots is shown below Based on the phylogeny tree, indicate if each of the following statements is true or false 7/10/14 10:19 AM 72 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A Giả thiết nhánh phát sinh chủng loại phản ánh tuổi taxon (đơn vị phân loại), đa dạng phát sinh chủng loại thước đo đa dạng sinh học bao gồm thơng tin phát sinh chủng lồi taxon Có thể ước tính tổng chiều dài nhánh, bao gồm nhóm quan tâm, chiều dài nhánh nhỏ Một phát sinh chủng lọai mầm thực thụ trình bày Dựa vào phát sinh chủng loài, câu sai A The phylogenetic diversity of malvids is higher than that of fabids Đa dạng phát sinh chủng loài malvids cao fabids B Dilleniaceae and Saxifragales are closer phylogenetically than are Malpighiales and Cucurbitales Họ Dilleniaceae Bộ Saxifragales gần gữi mặt phát sinh chủng loài so với Malpighiales Cucurbitales C The group consisting of Lamiids and Aquifoliales represents an adaptive radiation Nhóm bao gồm Lamiids + Aquifoliales thể lan tỏa thích nghi D Malpighiales species may serve as outgroup to resolve the complete phylogeny of all Fabid species Các lồi Malpighiales dùng làm taxon ngồi nhóm để xây dựng phát sinh chủng loại tất loài Fabid 7/10/14 10:19 AM 73 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 50 Inspired by traditional masks of Indonesia, some imaginary taxa are shown below They differ from each other in head shape, eye colour, mouth shape and the presence of ears, nose and hair The ancestor of these taxa has a round head, black eyes, no mouth, and no nose (add figure of ancestor) Four possible cladograms for these taxa as shown below Using the information above, indicate whether the following cladograms truly explain the phylogenetic relationship between the taxa Indicate if each of the following statements is true or false Dựa vào mặt nạ truyền thống Indonesia, vài taxon tưởng tượng vẽ Các taxon khác hình dạng đầu, màu mắt, hình dạng miệng có hay khơng có tai, mũi tóc Tổ tiên taxon có đầu hình trịn, mắt đen, khơng có miệng, khơng có mũi Sử dụng thông tin trên, câu sai A Trees A and C require the same minimal number of chatacter changes Cây A C đòi hỏi số lượng tối thiểu đặc điểm thay đổi B Of the tree shown, tree B is the least parsimonious Trong số trên, B tiết kiệm C Of the tree shown, tree D is the most P Trong số trên, D tiết kiệm D In general, there are more than seven different rooted topologies for four taxa Nhìn chung, có kiểu kiến hóa có gốc rễ khác cho taxon END OF TEST 7/10/14 10:19 AM 74 ... 2014 BALI, INDONESIA THEORETICAL TEST PART A 18 The effect of gibberellic acid (GA3) and abscisic acid (ABA) on isolated barley aleurons was measured using -amylase activity and transcriptional... ứng với phấn hoa 7/10/14 10:19 AM 43 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 30 Consider four animals A1 , A2 , A3 and A4 Data regarding the ratio of body masses and the ratio of oxygen... 10:19 AM 42 IBO 2014 BALI, INDONESIA THEORETICAL TEST PART A 29 X-linked agammaglobulinemia (AGG) disease occurs mostly in boys X-linked agammaglobulinemia patients have a non-functional bruton