Nghiên cứu này thiết lập và ứng dụng phản ứng PCR trực tiếp (direct PCR) để xác định tần suất có mặt của một số vi khuẩn thường gặp ở gà mắc bệnh hô hấp phức hợp. Kết quả chỉ ra rằng mức độ đồng thuận của phương pháp PCR trực tiếp so với PCR thường quy là rất cao.
Vietnam J Agri Sci 2022, Vol 20, No 2: 156-165 Tạp chí Khoa học Nơng nghiệp Việt Nam 2022, 20(2): 156-165 www.vnua.edu.vn Cao Thị Bích Phượng*, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ Khoa Thú y, Học viện Nông nghiệp Việt Nam * Tác giả liên hệ: ctbphuong@vnua.edu.vn Ngày nhận bài: 18.10.2021 Ngày chấp nhận đăng: 10.01.2022 TĨM TẮT Bệnh hơ hấp phức hợp lên thách thức kinh tế lớn ngành chăn nuôi gia cầm Cùng với đó, cơng cụ chẩn đốn quy trình xét nghiệm ni cấy phân lập vi khuẩn, huyết học hay PCR thường quy tốn nhiều thời gian & sử dụng nhiều công lao động Chính vậy, nghiên cứu thiết lập ứng dụng phản ứng PCR trực tiếp (direct PCR) để xác định tần suất có mặt số vi khuẩn thường gặp gà mắc bệnh hô hấp phức hợp Kết mức độ đồng thuận phương pháp PCR trực tiếp so với PCR thường quy cao Khi kiểm tra 173 gà mắc hội chứng sưng phù đầu nghi mầm bệnh Mycoplasma gallisepticum (MG), Avibacterium paragallinarum (APG), Ornithobacterium rhinotracheale (ORT) avian pathogenic Escherichia coli (APEC) phản ứng PCR trực tiếp, 68% trường hợp dương tính với mầm bệnh khảo sát, 23% gà bị nhiễm đồng thời 2-3 mầm bệnh Như vậy, phương pháp PCR trực tiếp sử dụng cơng cụ hiệu để phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận Từ khóa: PCR trực tiếp, bệnh hô hấp phức hợp, vi khuẩn, gia cầm, Hà Nội Application of Direct PCR for Detection of Several Bacteria in Chicken with Respiratory Disease Complex in Hanoi and Neighbour Vicinity ABSTRACT The respiratory disease complex has emerged as a major economic problem for the poultry industry In addition, the current diagnostic tools, such as bacteria isolation, serological tests, and conventional PCR are time-consuming and labor-intensive Therefore, this study was carried out to develop the direct PCR and to apply it to investigate the presence of some common bacteria in the swollen head syndrome Compared with the conventional PCR results, the Kappa value for direct PCR was almost in perfect agreement Among 173 samples screening by direct PCR, 68% of cases revealed infection by at least one investigated pathogen, while 23% had concurrent infections by two to three bacteria in a single case As a result, direct PCR is recommended to be an effective tool for detecting the concurrent infections by Mycoplasma gallisepticum (MG), Avibacterium paragallinarum (APG), Ornithobacterium rhinotracheale (ORT) and avian pathogenic Escherichia coli (APEC) of the swollen head syndrome in chickens in the vicinity of Hanoi Keywords: Direct PCR, complex respiratory disease, bacteria, co-infection, poultry, Hanoi 156 Cao Thị Bích Phượng, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ Ⅱ 157 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận µ µ µ µ µ µ µ µ º µ µ µ Mồi xi /mồi ngược Trình tự (5’-3’) MG.732F GGATCCCATCTCGACCACGAGAAAA vòng (94C - phút) /MG.732R CTTTCAATCAGTGAGTAACTGATGA 40 vòng (94C - 20 giây, 55C - 40 giây, 72C - 60 giây) Chu trình nhiệt phản ứng PCR thường quy vòng (72C - phút) APG.500F CAATGTCGATCCTGGTACAATGAG vòng (94C - phút) /APG.500R CAAGGTATCGATCGTCTCTCTACT 40 vòng (94C - 20 giây, 60C - 30 giây, 72C - 40 giây) vòng (72C - phút) ORT.784F GAGAATTAATTTACGGATTAAG /ORT.784R TTCGCTTGGTCTCCGAAGAT vòng (94C - phút) 40 vòng (94C - 20 giây, 52C - 30 giây, 72C - 60 giây) vòng (72C - phút) APEC.553F AATCCGGCAAAGAGACGAACCGCCT vòng (94C - phút) /APEC.553R GTTCGGGCAACCCCTGCTTTGACTTT 40 vòng (94C - 20 giây, 60C - 40 giây, 72C - 40 giây) APEC.496F TCATCCCGGAAGCCTCCCTCACTACTAT /APEC.496R TAGCGTTTGCTGCACTGGCTTCTGATAC APEC.450F GGCCACAGTCGTTTAGGGTGCTTACC /APEC.450R GGCGGTTTAGGCATTCCGATACTCAG APEC.323F CAGCAACCCGAACCACTTGATG /APEC.323R AGCATTGCCAGAGCGGCAGAA APEC.302F GGCTGGACATCATGGGAACTGG /APEC.302R CGTCGGGAACGGGTAGAATCG 158 vòng (72C - phút) Cao Thị Bích Phượng, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ µ µ µ µ µ µ µ µ µ ≤ 159 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận µ µ µ (A) 160 (B) (C) Cao Thị Bích Phượng, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ PCR thường quy PCR trực tiếp ORT Kappa = Mẫu dương Dương tính Âm tính Tổng số 8 Mẫu âm 51 51 Tổng số 51 59 PCR trực tiếp APG Mẫu dương 8 Kappa = Mẫu âm 51 51 Tổng số 51 59 PCR trực tiếp APEC Mẫu dương 18 18 Kappa = Mẫu âm 41 41 Tổng số 18 41 59 PCR trực tiếp MG Mẫu dương 4 Kappa = 0,88 Mẫu âm 54 55 Tổng số 54 59 161 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận TT STT Số mẫu Tỉ lệ (%) ORT 16 9,0a APG 59 34,0b MG 40 23,0c APEC 2,0d Tổng 118 68,0 Mầm bệnh Số mẫu dương tính Tỉ lệ dương tính 5,0 ORT, APG ORT, MG 1,0 ORT, APEC 1,0 APG, MG 12 10,0 APG, APEC 1,0 162 Mầm bệnh ORT, APG, MG 5,0 Tổng 27 23,0 Cao Thị Bích Phượng, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ Altman D.G & Bland J.M (1994) Statistics Notes: Diagnostic tests 1: sensitivity and specificity BMJ 308(6943): 1552 Aung Y.H., Liman M., Neumann U & Rautenschlein,S (2008) Reproducibility of swollen sinuses in broilers by experimental infection with avian metapneumovirus subtypes A and B of turkey origin and their comparative pathogenesis, Avian Pathol 37(1): 65-74 Alshahni M.M., Makimura K., Yamada T., Satoh K., Ishihara Y., Takatori K & Sawada T (2009) Direct colony PCR of several medically important fungi using Ampdirect plus, Jpn J Infect Dis 62(2): 164-7 Andreopoulou M., Franzo G., Tucciarone C.M., Prentza Z., Koutoulis K.C., Cecchinato M & Chaligianni I (2019) Molecular epidemiology of infectious bronchitis virus and avian metapneumovirus in Greece, Poult Sci 98(11): 5374-5384 Ben-Amar A., Oueslati S & Mliki A (2017) Universal direct PCR amplification system: a time- and costeffective tool for high-throughput applications Biotech 7(4): 246-246 Chen X., Miflin J.K., Zhang P & Blackall P.J (1996) Development and application of DNA probes and PCR tests for Haemophilus paragallinarum, Avian Dis 40(2): 398-407 Cascella R., Strafella C., Ragazzo M., Zampatti S., Borgiani P., Gambardella S., Pirazzoli A., Novelli G & Giardina E (2015) Direct PCR: a new pharmacogenetic approach for the inexpensive testing of HLA-B*57:01 Pharmacogenomics J 15(2): 196-200 Cao Thị Bích Phượng, Lê Bá Hiệp, Huỳnh Thị Mỹ Lệ & Nguyễn Văn Giáp (2020) Nghiên cứu lưu 163 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận hành avian metapneumovirus (aMPV) gà nuôi số tỉnh miền Bắc Việt Nam, Tạp chí Khoa học Nơng nghiệp Việt Nam 18(7): 520-528 David E Swayne, Martine Boulianne, Catherine M Logue, Larry R McDougald, Venugopal Nair, David L Suarez, Sjaak de Wit, Tom Grimes, Deirdre Johnson, Michelle Kromm, Teguh Yodiantara Prajitno, Ian Rubinoff & Guillermo Zavala (2020) Diseases of poultry (14th) John Wiley & Sons, Inc., Hoboken, NJ 07030, USA De Boeck C., Kalmar I., Dumont A & Vanrompay D (2015) Longitudinal monitoring for respiratory pathogens in broiler chickens reveals co-infection of Chlamydia psittaci and Ornithobacterium rhinotracheale J Med Microbiol 64(Pt 5): 565-574 De Oliveira A.L., Rocha D.A., Finkler F., De Moraes L.B., Barbieri N.L., Pavanelo D.B., Winkler C., Grassotti T.T., De Brito K.C., De Brito B.G & Horn F (2015) Prevalence of ColV plasmidlinked genes and in vivo pathogenicity of avian strains of Escherichia coli, Foodborne Pathog Dis 12(8): 679-85 Đào Thị Hảo (2008) Phân lập, xác định số đặc tính sinh học Mycoplasma gallisepticum & chế kháng nguyên, huyết chẩn đoán Luận án Tiến sĩ Nông nghiệp Viện Thú y Eszik I., Lantos I., Önder K., Somogyvári F., Burián K., Endrész V & Virok D.P (2016) High dynamic range detection of Chlamydia trachomatis growth by direct quantitative PCR of the infected cells, J Microbiol Methods 120: 15-22 Feuerman M & Miller A.R (2008) Relationships between statistical measures of agreement: sensitivity, specificity and kappa, J Eval Clin Pract 14(5): 930-3 Goodwin M.A & Waltman W.D (1994) Clinical and pathological findings in young Georgia broiler chickens with oculofacial respiratory disease ("socalled swollen heads"), Avian Dis 38(2): 376-8 García M., Ikuta N., Levisohn S & Kleven S.H (2005) Evaluation and comparison of various PCR methods for detection of Mycoplasma gallisepticum infection in chickens Avian Diseases 49(1): 125-132 Gharaibeh S.M & Algharaibeh G.R (2007) Serological and molecular detection of avian pneumovirus in chickens with respiratory disease in Jordan, Poult Sci 86(8): 1677-81 Johnson T.J., Wannemuehler Y., Doetkott C., Johnson S.J., Rosenberger S.C & Nolan L.K (2008) Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool J Clin Microbiol 46(12): 3987-96 Jones R & S.R (2013) Diseases of poultry In: Avian metapneumovirus: David E Swayne, J.R.G., 164 Larry R Mcdougald, Lisa K Nolan, David L Suarez, Venugopal L Nair (ed.) 13 ed John Wiley & Sons Inc Iowa, USA: Iowa State Press Katcher H.L & Schwartz I (1994) A distinctive property of Tth DNA polymerase: enzymatic amplification in the presence of phenol Biotechniques 16(1): 84-92 Kwon J.S., Lee H.J., Jeong S.H., Park J.Y., Hong Y.H., Lee Y.J., Youn H.S., Lee D.W., Do S.H., Park S.Y., Choi I.S., Lee J.B & Song C.S (2010) Isolation and characterization of avian metapneumovirus from chickens in Korea J Vet Sci 11(1): 59-66 Kaore M., Singh K., Palanivelu M., Asok Kumar M., Reddy M & Kurkure N.V (2018) Pathoepidemiology of respiratory disease complex pathogens (RDPs) in commercial chicken Indian J Vet Pathol 42(4): 231-238 Lorenz T.C (2012) Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies Journal of visualized experiments: JoVE (63): e3998-e3998 Lê Văn Hùng, Nguyễn Thị Giang & Trần Danh Sơn (2019) Phân lập, xác định đặc điểm vi khuẩn gây bệnh sổ mũi truyền nhiễm gà số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nơng nghiệp Việt Nam 17(8): 622-629 Mcdougall J.S & Cook J.K (1986) Turkey rhinotracheitis: preliminary investigations Vet Rec 118(8): 206-7 Mohamed M Shawki Lebdah M.A., Shahin A.M & Nassif S A (2017) Some studies on swollen head syndrome in broiler chickens in Egypt, Zagazig Veterinary Journal 45(S1): 132-141 Nakamura K., Mase M., Tanimura N., Yamaguchi S & Yuasa N (1998) Attempts to reproduce swollen head syndrome in specific pathogen-free chickens by inoculating with Escherichia coli and/or turkey rhinotracheitis virus Avian Pathol 27(1): 21-7 Nguyễn Thị Lan, Chu Đức Thắng, Nguyễn Bá Hiên, Phạm Hồng Ngân, Lê Văn Hùng & Nguyễn Thị Yến (2016) Đặc điểm vi khuẩn Ornithobacterium rhinotracheale (ORT) phân lập từ đàn gà ni số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nơng nghiệp Việt Nam 14(11): 1734-1740 Nguyễn Thị Loan, Lê Đình Quyền, Dương Hồng Quân, Lê Huỳnh Thanh Phương, Nguyễn Bá Hiên & Lê Văn Phan (2016) Ứng dụng kỹ thuật RT-PCR để chẩn đoán bệnh viêm phế quản truyền nhiễm (Infectious bronchitis) gà đẻ trứng số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nơng nghiệp Việt Nam 14(9): 1387-1394 Paudel S., Hess M & Hess C (2017) Coinfection of Avibacterium paragallinarum and Gallibacterium anatis in Specific-Pathogen-Free Chickens Cao Thị Bích Phượng, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ Complicates Clinical Signs of Infectious Coryza, Which Can Be Prevented by Vaccination Avian Dis 61(1): 55-63 Roussan D.A., Haddad R & Khawaldeh G (2008) Molecular survey of avian respiratory pathogens in commercial broiler chicken flocks with respiratory diseases in Jordan Poult Sci 87(3): 444-8 Samy A & Naguib M.M (2018) Avian respiratory coinfection and impact on avian influenza pathogenicity in domestic poultry: field and experimental findings Vet Sci 5(1): 23 Tanaka M., Takuma H., Kokumai N., Oishi E., Obi T., Hiramatsu K & Shimizu Y (1995) Turkey Rhinotracheitis Virus Isolated from Broiler Chicken with Swollen Head Syndrome in Japan Journal of Veterinary Medical Science 57(5): 939-941 Trương Hà Thái, Nguyễn Ngọc Đức, Nguyễn Văn Giáp & Chu Thị Thanh Hương (2009) Xác định tỉ lệ nhiễm Mycoplasma gallisepticum giống gà hướng thịt Ross 308 & ISA màu nuôi công nghiệp số tỉnh miền Bắc Việt Nam Tạp chí Khoa học & Phát triển 7(3): 306-313 Van Empel P.C & Hafez H.M (1999) Ornithobacterium rhinotracheale: A review Avian Pathol 28(3): 217-27 Võ Thị Trà An, Nguyễn Thị Bích Liên, Trần Thị Ngọc Hân, Hồ Quang Dũng & Chansiripornchai, N (2014) Nhận dạng, phân lập & xác định mước độ mẫn cảm kháng sinh vi khuẩn Orninobacterium rhinotracheale gà Tạp chí Khoa học Kỹ thuật Thú y 21(7): 23-27 Wilfinger W.W., Mackey K & Chomczynski P (1997) Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity Biotechniques 22(3): 474-6, 478-81 Yu M., Xing L., Chang F., Bao Y., Wang S., He X., Wang J., Wang S., Liu Y., Farooque M., Pan Q., Wang Y., Gao L., Qi X., Hussain A., Li K., Liu C., Zhang Y., Cui H., Wang X & Gao Y (2019) Genomic sequence and pathogenicity of the first avian metapneumovirus subtype B isolated from chicken in China Vet Microbiol 228: 32-38 Zhong C., Gopinath S., Norona W., Ge J., Lagacé R.E., Wang D.Y., Short M.L & Mulero J.J (2019) Developmental validation of the Huaxia™ Platinum PCR amplification kit: A 6-dye multiplex direct amplification assay designed for Chinese reference samples Forensic Science International: Genetics 42: 190-197 165 ... cứu lưu 163 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận hành avian metapneumovirus (aMPV) gà nuôi số tỉnh miền Bắc Vi? ??t Nam, Tạp... Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ µ µ µ µ µ µ µ µ µ ≤ 159 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận. .. Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ Ⅱ 157 Ứng dụng phản ứng PCR trực tiếp (direct PCR) phát số vi khuẩn gà mắc bệnh hô hấp phức hợp Hà Nội vùng phụ cận µ µ µ