Designing a Promotor for a Novel Target Site Identified in Caspases for Initiating Apoptosis in Cancer Cells

Designing a Promotor for a Novel Target Site Identified in Caspases for Initiating Apoptosis in Cancer Cells

Designing a Promotor for a Novel Target Site Identified in Caspases for Initiating Apoptosis in Cancer Cells

... Designing a Promotor for a Novel Target Site Identified in Caspases 63 4, 5), initiator caspases (group II-Caspase-2, 8, 9, 10), and effector caspases (group III-Caspase-3, 6, 7) [2] The active ... active site contains a reactive cysteine and three basic amino acids (2 arginines and a glutamate) that recognize the aspartate in the protein that is cleaved Thes...
Ngày tải lên : 27/08/2017, 13:21
  • 6
  • 100
  • 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCC...
Ngày tải lên : 17/03/2014, 03:20
  • 8
  • 401
  • 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx

... pcDNA3.1-GST -Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CG...
Ngày tải lên : 23/03/2014, 07:20
  • 14
  • 397
  • 0
báo cáo khoa học: "Phase 1-2a multicenter dose-escalation study of ezatiostat hydrochloride liposomes for injection (Telintra®, TLK199), a novel glutathione analog prodrug in patients with myelodysplastic syndrome" doc

báo cáo khoa học: "Phase 1-2a multicenter dose-escalation study of ezatiostat hydrochloride liposomes for injection (Telintra®, TLK199), a novel glutathione analog prodrug in patients with myelodysplastic syndrome" doc

... phase 1- 2a study was the first clinical study of ezatiostat hydrochloride liposomes for injection in patients with all FAB classification types of MDS In phase 1, patients with MDS were administered ... for evaluation of ezatiostat in patients with MDS Pre-clinical data have shown that ezatiostat was well tolerated at single and repeated doses (...
Ngày tải lên : 10/08/2014, 22:20
  • 12
  • 276
  • 0
Identification and characterization of a novel heart  reactive autoantibody in systemic lupus erythematosus possible serological marker for early myocardial dysfunction

Identification and characterization of a novel heart reactive autoantibody in systemic lupus erythematosus possible serological marker for early myocardial dysfunction

... overall incidence was found in Iceland and Japan and highest in USA and France The overall prevalence was the lowest in Northern Ireland, UK and Finland, and the highest in Italy, Spain and Martinique ... IDENTIFICATION AND CHARACTERIZATION OF A NOVEL HEART- REACTIVE AUTOANTIBODY IN SYSTEMIC LUPUS ERYTHEMATOSUS: POSSIBLE SEROLOGICAL MARKER FO...
Ngày tải lên : 14/09/2015, 12:42
  • 183
  • 327
  • 0
Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

... implants (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral ... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate can...
Ngày tải lên : 26/10/2012, 09:48
  • 10
  • 408
  • 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

... with biofuel/biomass production based on microalgae considers wastewater as a kind of resource instead of just waste, and shifts the wastewater treatment process from being a mere treatment process ... reclamation coupled with biofuel/biomass production based on microalgae Novel concepts Several novel concepts for the novel process proposed fo...
Ngày tải lên : 05/09/2013, 10:17
  • 9
  • 762
  • 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... aragonite crystals [4–7] We therefore examined proteins contained in aggregates within the otolith matrix and identified a protein contained in the HMW protein glycosaminoglycan aggregate that also ... digestion of genomic DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCAT...
Ngày tải lên : 18/02/2014, 17:20
  • 12
  • 568
  • 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

... motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in protein–protein interactions Interestingly, this alanine-rich sequence, ... Gld2 Rbm9 interaction (Fig 2B) However, the RRM-containing central domain of hRbm9 (amino acids 48–269) and amino acids 269–350 of hRbm9 are not able to mediate the binding These...
Ngày tải lên : 07/03/2014, 05:20
  • 14
  • 502
  • 0
Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

Báo cáo khoa học: A novel retinol-binding protein in the retina of the swallowtail butterfly, Papilio xuthus docx

... analyses of the protein As the protein is a novel species of the hydrophobicligand-binding protein and solely binds 3-hydroxyretinol as an intrinsic ligand, we termed this protein the Papilio retinol-binding ... Brilliant Blue staining of the gel indicates that the fluorescing protein is one of the major components of soluble proteins in the crude...
Ngày tải lên : 17/03/2014, 03:20
  • 10
  • 596
  • 0
Báo cáo khoa học: Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ion selectivity ppt

Báo cáo khoa học: Identification of the N-terminal region of TjZNT2, a Zrt⁄Irt-like protein family metal transporter, as a novel functional region involved in metal ion selectivity ppt

... affects the ion selectivity of the protein Finally, tagging with HA at the N-terminus of TjZNT1 was found to alter the ion selectivity of the protein, suggesting that modification of the N-terminal ... through the study of transcript regulation as a molecular biological approach and the determination of the N-terminal sequence as a biochemic...
Ngày tải lên : 29/03/2014, 00:20
  • 8
  • 343
  • 0
Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot

Báo cáo hóa học: " Research Article A Novel Secure Localization Approach in Wireless Sensor Networks" pot

... Locator Sensor Attacker S3 L5 L2 Locator Sensor Attacker (a) (b) Figure 1: The attack scenarios in WSN (a) Attacker model in range-based localization; (b) Attacked locators with temporal and spatial ... and Z Wang, A secure localization approach against wormhole attacks using distance consistency,” EURASIP Journal on Wireless Communications and Networking, vol 2010, 11 pages...
Ngày tải lên : 21/06/2014, 11:20
  • 12
  • 397
  • 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... genetic counseling and possibly clinical management Patients and Methods Family The family studied is of Mexican origin The index case was a 23-year-old female diagnosed with breast carcinoma ... carcinoma of the left breast with combined histological features of lobular carcinoma and infiltrating ductal carcinoma The family history suggested LFS: the patient's f...
Ngày tải lên : 09/08/2014, 04:21
  • 7
  • 403
  • 0
Báo cáo y học: " Full genome re-sequencing reveals a novel circadian clock mutation in Arabidopsis" doc

Báo cáo y học: " Full genome re-sequencing reveals a novel circadian clock mutation in Arabidopsis" doc

... Hordeum vulgare subsp vulgare (AAY17586, PRR), Arabidopsis thaliana (AAY62604, PRR3), Triticum aestivum (ABL09464, PRR), Oryza sativa Indica (BAD38858, PRR 37), Oryza sativa Indica (BAD38859, PRR73), ... strong candidate was the non-synonymous SNP in PRR7 Sanger sequencing and a dCAPS marker were used to validate the SNP The gene PRR7 has already been shown to play a key role in the...
Ngày tải lên : 09/08/2014, 22:24
  • 12
  • 264
  • 0
Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

Báo cáo y học: "Pre-clinical development as microbicide of zinc tetra-ascorbo-camphorate, a novel terpenoid derivative: Potent in vitro inhibitory activity against both R5- and X4-tropic HIV-1 strains without significant in vivo mucosal toxicity" docx

... pharmacological activities, such as antimalarial and anti-inflammatory activities[7] BA and its derivatives have demonstrated high anti -HIV-1 activity and cytotoxicity against a variety of tumor cell lines ... surgically excised and parts of the upper (cervicovagina), middle (midvagina), and lower (urovagina) areas of each vagina were fixed with formalin and paraff...
Ngày tải lên : 10/08/2014, 05:21
  • 11
  • 480
  • 0