a novel target in autoimmunity
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc
Ngày tải lên :
07/03/2014, 16:20
... LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa Euroscarf [16] ATCC [15] This study ... been investigated Intracellular synthesis of CCK-22 was decreased in a cym1D0 strain accompanied by an increased concentration of proCCK In contrast, the fraction of extracellular CCK-22 was increased ... peroxidase and a dinamin-like GTPase, and is required for maintenance of mitochondrial morphology and DNA [45,46] Whether disruption of CYM1 in uences the ability to maintain mitochondrial DNA has...
- 10
- 631
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
Ngày tải lên :
23/03/2014, 07:20
... pcDNA3.1-GST-Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... CGCAGCTCATTGTAGAAGG-3¢ Another primer pair used for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCC ACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAA TACATCA-3¢ Western blot assay The cells were homogenized in lysis ... SerpinA3 was ACT5-ACT3: 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢...
- 14
- 397
- 0
Báo cáo khoa học: Light regulation of CaS, a novel phosphoprotein in the thylakoid membrane of Arabidopsis thaliana doc
Ngày tải lên :
30/03/2014, 04:20
... for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was ... (AY341888) was amplified by PCR using PfuTurbo CX Hotstart DNA polymerase (Strategene, La Jolla, CA, USA) and the uracil-containing primers nt114 (forward: GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and ... suggest a potential role of CaS protein in a signal transduction cascade sensing light or redox changes in chloroplasts and propagating the signal via direct protein–protein interactions Experimental...
- 11
- 446
- 0
Báo cáo y học: "Familial Polycythemia Caused by a Novel Mutation in the Beta Globin Gene: Essential Role of P50 in Evaluation of Familial Polycythemi" potx
Ngày tải lên :
08/08/2014, 16:23
... Hemoglobin 2005, 29:91-106 Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP HbVar database of human hemoglobin variants ... these Hb variants are inherited in an autosomal dominant manner High affinity Hb variants release oxygen in the tissue relatively slowly and create relative tissue hypoxia This leads to increased ... easily available in routine and even reference laboratories Lichtman and colleagues have reported a mathematical formula which can be used to calculate P50 reliably [5] Calculating P50 using this...
- 5
- 418
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
Ngày tải lên :
09/08/2014, 01:21
... the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a direct ... non-Hodgkin’s lymphoma as a single agent as well as in combination therapy, emphasizing its high B-cell-depleting potency [8] In patients with lymphoma, rituximab infusion is frequently associated ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most...
- 5
- 410
- 0
báo cáo khoa học: "Bilateral adrenocortical carcinoma in a patient with multiple endocrine neoplasia type 1 (MEN1) and a novel mutation in the MEN1 gene" potx
Ngày tải lên :
09/08/2014, 01:24
... 89:143-150 11 Carrasco CA, González AA, Carvajal CA, Campusano C, Oestreicher E, Arteaga E, Wohllk N, Fardella CE: Novel intronic mutation of MEN1 gene causing familial isolated primary hyperparathyroidism ... Novotny EA, Garrett-Beal L, Ward JM, Libutti SK, Richard Alexander H, Cerrato A, Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology ... prolactine producing pituitary adenoma, the hyperplasia of the parathyroid glands and the well-differentiated non functioning pancreatic endocrine carcinoma, functioning bilateral adrenocortical...
- 7
- 412
- 0
Báo cáo y học: "Interleukin-18: a therapeutic target in rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 06:22
... Interleukin-18 (interferon-gamma-inducing factor) is produced by osteoblasts and acts via granulocyte/macrophage colonystimulating factor and not via interferon-gamma to inhibit osteoclast formation J ... foregoing offer likely therapeutic advantage However, whether the IL-18R signalling pathway is sufficiently distinct from that of IL-1, which in turn has proven disappointing as a target in clinical ... in part via P2X7 dependent pathways In the extra cellular domain IL-18 is antagonised by IL-18 binding protein and in part by soluble IL-18Rα, although lower affinity binding of the latter suggests...
- 4
- 308
- 0
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
Ngày tải lên :
09/08/2014, 06:23
... expression and contributed in the interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS ... G, Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen associated with carotid atherosclerosis ... actin-based structures such as the contractile ring and stress fibers [22,23] The septins are a family of cytoskeletal GTPases that play an essential role in cytokinesis in yeast and mammalian...
- 8
- 375
- 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
Ngày tải lên :
09/08/2014, 08:22
... protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA splicing ... human antibodies (0.1 µg/µl) in PBS containing 1% bovine serum albumin Fluorescein isothiocyanate-conjugated anti-human IgG (Sigma) was added and fluorescence was analysed with an Available online ... Margutti P, Delunardo F, Sorice M, Valesini G, Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Riganò R, Ortona E: Screening of a HUAEC cDNA library identifies actin as a candidate...
- 8
- 550
- 0
Báo cáo y học: " The RNA interference pathway: a new target for autoimmunity" pot
Ngày tải lên :
09/08/2014, 08:22
... targeting of the RNAi machinery is that RNAi was initially recognized as an antiviral mechanism in plants and certain invertebrates [14] The evolutionary conservation of RNAi suggests a similar ... generation of anti-Su autoantibodies is initiated, whether a viral factor is involved in this process, and whether testing for these autoantibodies is clinically relevant Available online http://arthritis-research.com/content/8/4/110 ... protein and RNA-protein complexes that are involved in the synthesis, processing and degradation of various classes of RNA targeted by the immune system in systemic autoimmune diseases? One explanation...
- 3
- 311
- 0
báo cáo khoa học: " A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric " doc
Ngày tải lên :
11/08/2014, 02:22
... Identification and functional characterization of a novel mutation in the calcium-sensing receptor gene in familial hypocalciuric hypercalcaemia: modulation of clinical severity by vitamin D status ... contributions WFE analyzed the data and prepared the manuscript OdB managed the patients, made the diagnosis, and reviewed the manuscript All authors read and approved the final manuscript Competing interests ... phosphate, fraction of excreted calcium (calcium clearance/creatinine clearance ratio), creatinine clearance, PTH, and the presence or absence of the mutation Figure Heterozygosity for a C > A transversion...
- 5
- 385
- 0
Báo cáo y học: "A novel mutation in the ADA gene causing severe combined immunodeficiency in an Arab patient: a case report" ppt
Ngày tải lên :
11/08/2014, 17:21
... F-50-TGCCTGCTTCCCAGGGTGTCGAAGAGATTT-30 F-50-AGGATCAAAGGCGGGTGAAC-30 R-50-TCCCTCTCTCCAAAGATTCCAG-30 F-50-AGGATCAAAGGCGGGTGAAC-30 R-50-TCCCTCTCTCCAAAGATTCCAG-30 F-50-TCTGAAGCCCAGTCCCAAAG-30 R-50-AAATGTTGCTCAGCCCCAC-30 55 692 55 ... F-50-CCCAAAGCCTCCTCTTCCTCCT-3' F-50-AGGTCTCCAGTTGTTTCATG-30 F-50-TAGGCTGGGAGGTCTCTC-30 R-50-ACCCAACAAAGACACACTC-30 F-50-ATGCTGTTGAAGCAGGCAGCATGACTAGGA-3' F-50-TGCCTGCTTCCCAGGGTGTCGAAGAGATTT-30 F-50-AGGATCAAAGGCGGGTGAAC-30 ... R-50-TGTCCCTGATTAGCCCGCAA-30 F-50-GCAGCCAGCCAGTAAAATG-30 R-50-TGTCCTCACAGTCCCACTTC-30 F-50-GTCCACCACTCACTGTTTTG-30 R-50-AGTCCATCACACCCACATC-3 F-50-TGTTCCCAACCCCTTTCTTCC-30 R-50-AAATGGGCCAGACTCACTTCAG-30...
- 5
- 342
- 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
Ngày tải lên :
12/08/2014, 03:20
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant Biology 2009, 9:30 μg protein was incubated in presence...
- 13
- 650
- 0
Báo cáo y học: " Identification of a novel betaherpesvirus in Mus musculus" docx
Ngày tải lên :
12/08/2014, 04:21
... cells, as well as on L929 and BHK21 cells About two weeks later, supernatants were taken, DNA was extracted, and another PCR analysis was performed using the same primers as in the initial analysis ... (LD) PCR using the TaKaRa-Ex PCR system (Takara Bio inc., Otsu, Japan) according to the manufacturer's instructions An amplification product of approximately 3,3 kb size was obtained and sequenced ... contributions BE, AT, DR, FRM and SV designed research; AT performed research; BE, AT and SV analysed data; and BE and SV wrote the manuscript All authors read and approved the final manuscript References...
- 4
- 281
- 0
Báo cáo y học: "The complete genome of klassevirus – a novel picornavirus in pediatric stool" pdf
Ngày tải lên :
12/08/2014, 04:21
... Sequence analysis of Genome Sequencer FLX data was filtered against human and bacterial sequences using BLAT before unbiased BLASTn and tBLASTx (W3) searches against the BLAST nr database RNAse protection ... Naeem A, Shaukat S, Sharif S, Alam MM, Angez M, Wang C, Shafer RW, Zaidi S, Delwart E: A highly prevalent and genetically diversified Picornaviridae genus in South Asian children Proc Natl Acad ... the study and participated in its design and helped to draft the manuscript All authors read and approved the final manuscript Additional material Additional file RT-PCR Primers for Klassevirus...
- 9
- 373
- 0
Báo cáo khoa học: "The complete genome of klassevirus – a novel picornavirus in pediatric stool" doc
Ngày tải lên :
12/08/2014, 04:22
... Sequence analysis of Genome Sequencer FLX data was filtered against human and bacterial sequences using BLAT before unbiased BLASTn and tBLASTx (W3) searches against the BLAST nr database RNAse protection ... Naeem A, Shaukat S, Sharif S, Alam MM, Angez M, Wang C, Shafer RW, Zaidi S, Delwart E: A highly prevalent and genetically diversified Picornaviridae genus in South Asian children Proc Natl Acad ... the study and participated in its design and helped to draft the manuscript All authors read and approved the final manuscript Additional material Additional file RT-PCR Primers for Klassevirus...
- 9
- 320
- 0
STARCH-BINDING DOMAIN-CONTAINING PROTEIN 1: A NOVEL PARTICIPANT IN GLYCOGEN METABOLISM
Ngày tải lên :
24/08/2014, 13:16
... Glucose-6-phosphate translocase GA Glucoamylase GAA Lysosomal acid-α-glucosidase GABA γ-Aminobutyric acid GAGARAP (GABA) A receptor-associated protein GABARAPL1 GABARAP-like xvi GABARAPL2 GABARAP-like GABRG2 ... Amylo-1,6-glucosidase, 4-α-glucanotransferase AIM Atg8 family interacting motif Ams α-mannosidase AMP Adenosine monophosphate AMPK AMP activated protein kinase Ape1 aminopeptidase ATG Autophagy-related genes ATP ... Chloroform CHC Clathrin heavy chain CK-1 Casein kinase-1 CK-2 Casein kinase-2 CRT Calreticulin Cvt cytoplasm-to-vacuole targeting pathway D/Asp Aspartic acid Da Dalton DAB 3,3'-diaminobenzidine xv DBE...
- 152
- 132
- 0
Endofin is a novel component in EGR EGFR oncogenic signaling
Ngày tải lên :
11/09/2015, 10:00
... glycosylated, extracellular N-terminal region (621 amino acids), a transmembrane segment (amino acids 622-644), followed by an intracellular domain that contains a juxtamembrane region, a tyrosine kinase ... as actin-driven macropinocytosis and phagocytosis, dynamin-dependent caveolin-1 associated caveolar endocytosis, a CIE pathway that involves CDC42, ADP-ribosylation factor (ARF1), actin and another ... domain-containing 27 B protein FYVE domain have been solved and have a close resemblance to the zinc-binding domains of rabphilin 3A and PKC family proteins (Kutateladze and Overduin, 2001; Mao et al.,...
- 135
- 225
- 0
Development of a novel method in electroless copper plating
Ngày tải lên :
04/10/2015, 15:52
... retard the plating rate, accelerators which are generally anions, such as cynide, are added to increase the plating rate to an acceptable level without causing plating bath instability The plating ... similar chelating agents: sodium potassium tartrate, trisodium citrate and potassium sodium salt of malic acid were used separately in each of the plating solution as the main chelating agent A fine ... Bindra and Roldan (1985) It was expected as the plating solution only contains additional chelating agents The voltammograms revealed that EDTA plays an important role in chelating, while TEA...
- 140
- 275
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
Ngày tải lên :
18/06/2014, 16:20
... T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type diabetes in the Japanese population ... polymorphisms in the IL2RA gene are associated with age at diagnosis in late-onset Finnish type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama ... Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient with growth hormone insensitivity...
- 12
- 573
- 0
Xem thêm