Womens Perspective as a Radical Critique of Sociology

... in disability pension risk with increase in absence days/yr A 10-day increase in absence days per annum (scale score ranging from 0-220 days/yr) yielded an increase in disability pension risk of ... sickness absence as a marker of future disability pensioning Conclusion The findings of in the present study indicate that the number of self-repor...

Ngày tải lên: 26/10/2012, 10:03

... Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units Yehuda Ginosar1*,† * Corresponding author ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked inc...

Ngày tải lên: 05/03/2014, 15:20

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindII...

Ngày tải lên: 06/03/2014, 01:20

... hospital stay was 111 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause of ARF ... Identification of the primary cause of respiratory distress is vital for the initiation of appropriate therapy Active pulmonary TB is a rare primary cause...

Ngày tải lên: 06/03/2014, 04:20

... involving active caspase-8 Discussion FADD is an essential adaptor protein in the CD95mediated apoptotic signaling cascade that couples activated receptors with the activation of initiator caspase-8 ... triggering induces membrane proximal signals to induce nuclear export of FADD that are independent of CD95 internalization and ‘classic’ apoptotic signaling events, such as D...

Ngày tải lên: 07/03/2014, 02:20

... NF-jB, namely the ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localization of NF-jB [7] The canonical pathway of NF-jB ... Nishimura M, Morishita R, Kaneda Y, Kohmura E, Yoshimine T & Matsuda H (2001) Nuclear factor-kappa B decoy attenuates neuronal damage after global brain ischemia: a future st...

Ngày tải lên: 07/03/2014, 03:20

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protec...

Ngày tải lên: 07/03/2014, 15:20

... syntactic category aspect of each meaning of a phonetic word is also a part of the grammatical representation where i t makes associations with other syntactic categories The associations ... meanings, grammar, and pragmatic or local context, receive support as separately definable knowledge within studies of aphasia There is a vast l i t e r a t u r e concerning what aspe...

Ngày tải lên: 08/03/2014, 18:20

... statistic indicates the extent to which each surprisal estimate accounts for RT, and can thus serve as a measure of the psychological accuracy of each model However, this kind of analysis assumes ... probabilistic language model Journal of Machine Learning Research, 3:1137–1155 Marisa Ferrara Boston, John Hale, Reinhold Kliegl, Umesh Patil, and Shravan Vasishth 2008 Parsing cost...

Ngày tải lên: 08/03/2014, 21:20

... 513H) as indicated, washed, and exposed to Kodak XAR film at )70 °C for 2–5 days using Kodak lightening plus screens RNA stability assays were carried out as described [25] Actinomycin D (Sigma: ... prepared and 20 lg of each sample were subjected to RNA blot analysis using the entire Mydj2 cDNA, radiolabelled with [c32P]dCTP, as a probe Integrity of RNAs was verified by the appar...

Ngày tải lên: 17/03/2014, 17:20

... Polymerase (Invitrogen) and the primers: PDZ-1 -2, forward: 5¢-CCGAATTCGAAGAAATCACACTTGAAAGG-3¢, and reverse: 5¢GGATCCCCATCATTCATATACATACTTGT GGGTT-3¢; PDZ3, forward: 5¢CCGAATTCCTTGGAGA TGATGAAATTACAAGGG-3¢, ... ribosomal protein S6 kinase 2, a direct substrate of ERK, thereby enhancing the activation of this latter kinase [6] Human disc-large homolog (hDlg) is a memb...

Ngày tải lên: 22/03/2014, 16:20

... overproliferation can alter the balance between neuronal populations, leading to mental disorders and neuropathologies MNB ⁄ DYRK 1A has also been implicated in various aspects of late neuronal differentiation ... Bescond M & Rahmani Z (2005) Dual-specificity tyrosine-phosphorylated and regulated kinase 1A (DYRK 1A) interacts with the phytanoyl-CoA alphahydroxylase associated protei...

Ngày tải lên: 22/03/2014, 16:21

... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... Therefore the redox state of the cysteinyl residues of the various forms of apoFNR – ‘aerobic’ and ‘anaerobic’ apoFNR, and apoFNR obtained by air-induced inactiva...

Ngày tải lên: 23/03/2014, 15:20

... t a n t ~ a t e d Form using case frames, e.g as part of a semantic net or frame hierarchy In contrast, the G,,rman language dialog system HAM-ANS (Hamburg application oriented natural language ... this change of d i r e c t i o n at the same time (cf (Sb)) A SHORT OVERVIEW OF HA~-ANS HAM-ANS is a large German natural l a n g u a g e dialog system of both considerable...

Ngày tải lên: 24/03/2014, 05:21

... biological marker of disease activity could potentially serve as a monitor of response to immunomodulatory treatment in MS However, a biological marker of disease activity, as well as response to ... Health Sciences Center in Shreveport and signed informed consent was obtained from all participants Measurement of soluble HLA A solid phase ELISA was used...

Ngày tải lên: 19/06/2014, 22:20