Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target

... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during...

Ngày tải lên: 18/02/2014, 16:20

... orders@intechweb.org Hepatocellular Carcinoma – Clinical Research, Edited by Wan-Yee Lau p cm ISBN 978-953-51-0112-3 Contents Preface IX Part Diagnosis / Differential Diagnosis Chapter Hepatocellular Carcinoma: ... Hepatocellular Carcinoma – Clinical Research Edited by Wan-Yee Lau Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright...

Ngày tải lên: 08/03/2014, 00:20

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTAT...

Ngày tải lên: 14/03/2014, 23:20

... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was...

Ngày tải lên: 16/03/2014, 05:20

... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum lumen [23], HI...

Ngày tải lên: 23/03/2014, 13:20

... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... 6C) The simulation results, based on experimentally determined parameters and a kinetic model of the 2393 The glyoxalase pathway in Leishma...

Ngày tải lên: 23/03/2014, 13:20

... limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target ... Cite this article as: d’Hennezel et al.: IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in org...

Ngày tải lên: 18/06/2014, 16:20

... non-Hodgkin’s lymphoma as a single agent as well as in combination therapy, emphasizing its high B-cell-depleting potency [8] In patients with lymphoma, rituximab infusion is frequently associated ... by the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myastheni...

Ngày tải lên: 09/08/2014, 01:21

... GS: Regulation of c-Jun N-terminal kinase by MEKK-2 and mitogen -activated protein kinase kinase kinases in rheumatoid arthritis J Immunol 2004, 17 2 :16 12 -16 18 Huang Q, Yang J, Lin Y, Walker C, Cheng ... purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 Vol No Hammaker et al Mor A, Abramson SB, Pillinger MH: The fibroblast-like syno...

Ngày tải lên: 09/08/2014, 10:20

... strand, while the silencing activity of the siRNA was maintained [18] Polo-like kinase-1 (PLK-1) belongs to the family of serine/threonine kinases and regulates cell division in the mitotic phase ... the systemic siRNA delivery with atelocollagen existed intact for at least days in tumor tissues using a mouse model [62] Preclinical application of RNAi therapy against PLK-1 in a...

Ngày tải lên: 10/08/2014, 09:22

... insulin-like growth factor 2; IGF-1R: insulin-like growth factor receptor; IGF-2R: insulin-like growth factor receptor; IRS: insulin receptor substrate; IGFBPs: insulin like growth factor binding proteins; ... expression of insulin-like growth factor binding proteins in human hepatocellular carcinoma Mol Cell Biochem 2000, 207:101-104 82 Teishima J: Decreased e...

Ngày tải lên: 10/08/2014, 21:23

... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy .....

Ngày tải lên: 10/09/2015, 08:27

... of glioma 1. 4 Re-defining assay criteria for detecting GPCs 10 1. 5 PLK1 regulation and physiological role 11 1. 5 .1 PLK1 regulation 11 1. 5.2 Physiological role of PLK1 13 1. 5.3 PLK1 and tumors 15 ... 1. 9 34   3.3 PLK1 mRNA expression is elevated in glioma tumors PLK1 over-expression is common in several cancers of the breast 116 , ovaries 117 , prostate 118 and skin...

Ngày tải lên: 02/10/2015, 17:13

... (Polo- like kinase of X laevis); Snk (serum-inducible kinase) ; Fnk (fibroblastgrowth-factor-indiucible kinase) ; Prk (proliferation-related kinase) ; Sak (Snk akin kinase) xvi Table II: Polo- like kinase ... hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation in si-PLK1 transfected Huh-7 was absent in th...

Ngày tải lên: 16/10/2015, 15:38