A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

A novel protein from helicobacter pylori with a potential role in gastroduodenal diseases

... aaactcaaaa gtttagggtt tttaaaacac cctttaaaaa cgatgcccta tattttagag ggcgggagca tagaaagcga tggggctggg agcgttttaa ccaacaccca atgcctgtta gaaaaaaatc gtaaccccca tttgaatcaa aatggaatag aaaacatgct taaaaaggaa ... ttaggggcta aacaggtgct ttggtattct tatggctatc tcaaaggcga tgataccgat agccataccg acacgctcgc tcgtttttta gataaagaca ccattgttta tagcacatgc gaggatgaaa acgatgagca ctacacagcc ttaaaaaaaa tgcaagaaga attaaa...

Ngày tải lên: 26/09/2015, 09:35

103 216 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... length Vgf content in CSF in ALS In A, full-length Vgf was assessed by quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle ... Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic late...

Ngày tải lên: 03/11/2012, 10:52

8 503 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

... 5¢-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢, 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, ... TTCCATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢), HPNAP_up (5¢-GCGGAATTCCATATGAAAACATTTG AAATT-3¢) and HPNAP_low (5¢-CCGCTCGAGAGCC AAATGGG-3¢), for pET...

Ngày tải lên: 30/03/2014, 04:20

16 352 0
Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

Báo cáo y học: " A Novel Population of Mesenchymal Progenitors with Hematopoietic Potential Originated from CD14- Peripheral Blood Mononuclear Cell" potx

... absence of external influence, a population of CD14- mesenchymal cells with hematopoietic potential was harvested However, whether this population is derived from mesenchymal or hematopoietic lineage ... Collagen (Col)-I: 5’-GGA GAG TAC TGG ATC GAC CCT AAC-3’ (Forward); 5’-CTG ACC TGT CTC CAT GTT GCA-3’ (Reverse); Col-III: 5’-GAA AAA ACC CTG CTC GGA ATT-3’ (Forward);...

Ngày tải lên: 08/08/2014, 18:20

14 350 0
Ohanin   a novel protein from king cobra (ophiophagus hannah) venom 2

Ohanin a novel protein from king cobra (ophiophagus hannah) venom 2

... fragments can then associate to form an enzymatically active protein to cleave the chromogenic substrates This process is called as α-complementation Properly expressed β-galactosidase protein (after ... chemicals, adjust to pH 7.8 using glacial acetic acid and autoclave Dilute to 1X before use SOB medium (for preparation of competent cells) Tryptone Yeast extract NaCl KCl MgCl2.6H2O MgSO...

Ngày tải lên: 16/09/2015, 15:55

7 156 0
Ohanin   a novel protein from king cobra (ophiophagus hannah) venom

Ohanin a novel protein from king cobra (ophiophagus hannah) venom

... S A N P E F L G * aagacatccagtctctgaagggacccccaccccccatccatggacattactggacatccc ctgcaatcatccagggccccaccggcgggacccccaacggtcaacaccccttttcaatat gtcccttcaaataaactcactagactgg SRTX -a1 SRTX-c SRTX-b SRTX-c ... N V gagccactttgctcctgtaaagacatgacggataaagagtgcctcaatttctgccatcag E P L C S C K D M T D K E C L N F C H Q gacgtcatctggaaaaatgcggacaccagcgccaatccagagttcctaggctagctagga D V I W K N A D T S A...

Ngày tải lên: 16/09/2015, 15:55

180 230 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... three important phytopathogenic fungi: R solani, Rhizopus nigricans and Phytophthora parasitica var nicotianae The antifungal activity towards R solani was prominent (Fig 4...

Ngày tải lên: 23/03/2014, 03:20

13 501 0
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx

... 5¢-ATGCAGGTCTCCCGTGTGC-3¢, 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector ... at °C overnight The plate was then incubated with anti-(GST– MFG-E8) serum and peroxidase-labeled goat anti-(rabbit IgG) Ig as the secondary antibody, and peroxida...

Ngày tải lên: 24/03/2014, 03:21

10 517 0
Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

Báo cáo y học: "Protein C: a potential biomarker in severe sepsis and a possible tool for monitoring treatment with drotrecogin alfa (activated)" pptx

... evaluations In the PROWESS trial, plasma samples were obtained at baseline (day of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, ... to examine individually each laboratory and clinical measure for their attributes as biomarkers Biomarkers have been classified into types by the National Institutes of Health Bi...

Ngày tải lên: 13/08/2014, 08:21

11 343 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a kcat of 7.1 ± 0.7 s)1, Km of 0.182 ± 0.027 mm and kcat ⁄ Km of 3.9 · 104 m)1Æs)1 toward NADP Different from ... metabolism of H pylori Recently, the three-dimensional structures of AroE from several bacteria such as E coli, Methanococcus jannaschii, and H influenzae, and YdiB...

Ngày tải lên: 19/02/2014, 05:20

11 529 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... on the 5¢-UTR The single-strand RNA and DNA binding, cold shock domain (CSD) (also known as Y-box) proteins, play diverse roles in both transcriptional and post-transcriptional regulation of growth ... that CSD proteins form a cytoplasmic complex on VEGF mRNA that also contains the multifunctional singlestrand RNA/DNA binding protein, PTB [43–46,52–57], an...

Ngày tải lên: 19/02/2014, 12:20

13 604 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

... on the export of proteins that follow disparate targeting/translocation pathways In conclusion, the data suggest that TF, although interacting with Tat signal peptides, does not play a critical ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence i...

Ngày tải lên: 07/03/2014, 16:20

9 393 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the...

Ngày tải lên: 16/03/2014, 04:20

13 385 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-...

Ngày tải lên: 16/03/2014, 14:20

9 280 0
Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx

Báo cáo khoa học: Characterization of an N6 adenine methyltransferase from Helicobacter pylori strain 26695 which methylates adjacent adenines on the same strand pptx

... upper strand and one in the lower strand [24].Yet another variation is seen in the case of MmeI, where it has been reported that MmeI modies the adenine in the top strand of the recognition sequence ... HP0050, an N6 adenine MTase from H pylori strain 26695, can methylate two adjacent residues on the same strand, but HP0050 homologs from H pylori...

Ngày tải lên: 22/03/2014, 21:20

18 330 0
w