Ohanin a novel protein from king cobra (ophiophagus hannah) venom

Chapter I Literature Review CHAPTER I LITERATURE REVIEW 1.1 SNAKES Snakes (class Reptilia and order Squamata) first appeared on earth during the Lower Cretaceous period probably 100 to 150 million years ago based on the oldest ‘snake-like’ fossils found in sandstone beds of Algeria (Harris 1991; Rage 1984). Biologists generally agree that snakes arose from lizard-like ancestors. Their long body shape and lack of limbs probably evolved to enable their smooth movement in dense vegetation and forest. There are about 2930 species of snakes at present (Stafford 2000). They range from giants, like the anacondas, pythons and boas that can grow up to m (23 feet), to the smaller-sized snakes, like the burrowing blind snakes that may be as small as 10 cm (4 inches) long. Although they all vary in length, the features that collectively distinguish snakes as a unique family are clearly recognizable. Generally snakes have highly flexible bodies with no eyelids, shoulder and sternum. Interestingly in pythons, boas and some other primitive snakes, some traces of the pelvis and horn-like claws at the base of the tail which resemble the hind limbs, can still be seen. 1.2 VENOMOUS SNAKES Approximately 1300 snake species are venomous (Hider et al. 1991; Stafford 2000). The evolution of the venomous form, however, was much more recent, possibly as late as the Miocene period (less than 30 million years ago) (Harris 1991). Venomous snakes are Chapter I Literature Review usually defined as those that have venom glands and specialized venom conducting fangs which enable them to inflict fatal bites upon their victims (Klemmer 1968). 1.2.1 Classification and distribution of venomous snakes The systematic classification of both venomous and non-venomous snakes still presents many problems. Most taxonomists and authorities would only recognize 11 to 13 distinct families. However, venomous snakes are generally identified in only five families. They are the Elapidae, Hydrophiidae, Viperidae, Crotalidae and Colubridae (Harris 1991). It is interesting to note that snakes are widely distributed on all continents in the world except Antarctica, New Zealand, Madagascar, Ireland, Greenland, the Azores and Canaries (Phelps 1981). They have successfully evolved into efficient predators and colonized various habitats from mangrove swamps, estuaries, freshwater lakes, streams, dunes, grasslands to forests (Garl and Roger 1989). The classification and distribution of venomous snakes in the world are shown in Table 1.1. 1.2.2 King cobra (Ophiophagus hannah) King cobra, also known as Ophiophagus hannah (Figure 1.1), belongs to the Elapidae family. It is the longest venomous snake in the world. King cobra has an average size ranging from 10 to 12 feet, but sometimes can grow up to 18 feet (5.5 meter) long (Zhao 1990). It is widely distributed in the northern parts of India, southern China (Hainan, Fujian, Guangdong, Hainan, Guangxi, Guangzhou and Hong Kong) and southeast Asia (Malaysia, Indonesia, Burma, Thailand, Philippines and Singapore) (Ganthavorn 1971; Chapter I Literature Review Zhao 1990). King cobra is generally found in dense or open rainforests, as well as mangrove swamps, bamboo thickets, savannas and even around human settlements. Its genus name, Ophiophagus, means snake eater, with ‘ophis’ and ‘phagein’ representing ‘snake’ and ‘to eat’, respectively in Latin. Hence king cobra preferentially feeds on snakes and small reptiles. These preys sometimes can be as huge as 10 feet in length. In addition to snakes, it also feeds on mice, rats, birds, frogs and fishes. The king cobra kills the prey by injecting a lethal amount of venom with its fangs. It then swallows its preys as a whole. It hunts both during the day and night time. King cobra yields an average of 420 mg of crude venom in dry weight per milking (Ganthavorn 1971). The LD50 in mouse is ~1.2 to 3.5 mg/kg via intravenous injection (Mebs 1989). The relatively low toxicity of king cobra’s venom is compensated by the large amount of venom produced and injected into the preys each time. King cobra’s venom shows predominantly haemotoxic and neurotoxic effects. The clinical manifestations upon envenomation are: drowsiness, stupor, ptosis, dysarthria, dysphagia and general muscular weakness (Ganthavorn 1971). In severe envenomation, impairment of cardiovascular function can occur (Reid 1968; Wetzel and Christy 1989). Rattlesnakes Tree Crotalidae Colubridae snakes Vipers Viperidae snakes, Sea snakes Hydrophiidae mangroves Cobras, kraits, mambas, Elapidae coral snakes Examples Family mechanism, the tail is laterally central and south America the upper jaw (opisthoglyphous) Australia, Antarctica, New Zealand, Greenland, Azores and Canaries New Zealand, Madagascar, Ireland, Venom fangs are typically grooved and mounted at the rear of nostrils and the eye sensitive pits situated on each side of the head between the Similar in general form to the Viperidae except: possess heat- bone venom fangs are large, grooved and mounted on the maxillary large, flattened triangular head and a characteristic dentition; Heavier and bulkier built than the Elapidae; sluggish; possess a All parts of the world except for America, parts of southeast Asia Europe, Africa, Asia, America mounted dorsally on the head and are equipped with closing Pacific to the western seaboards of flattened, the tongue is reduced, and salt glands have evolved Similar in general form to the Elapidae except: the nostrils are jaw (proteroglyphous) Small head with short, fixed fangs mounted at the front of the Characteristics Coastal waters of Asia and Australia, America, Africa, Asia, Australia Distribution Table 1.1 Classification and distribution of venomous snakes in the world. Table is adapted from Harris (1991). Chapter I Literature Review Chapter I Literature Review Figure 1.1 King cobra (Ophiophagus hannah). Photo is reprinted with the permission of Mr. Peter Mirtschin from Venom Supplies Pty. Ltd., Australia. Chapter I Literature Review 1.3 SNAKE VENOMS Snake venoms are secretory products of venom glands (Oron and Bdolah 1973). Typical venom glands consist of three major cell types, namely basal cells, conical mitochondriarich cells and secretory cells. Venom is only produced by secretory cells in the glands (Oron and Bdolah 1978). It is further carried from the glands to the fangs by the ducts that flow through the accessory glands. The function of the accessory glands is to prevent wasteful flow of the secretions. Venom production appears to be regulated by the glands themselves and is independently of neural control. Venom proteins are used mainly to immobilize and kill the preys and predators as well as to support the digestion of the food swallowed by the snake (Aird 2002). The composition of venom components varies with the time of secretion into the glands. For example, venom that is freshly secreted into the glands has a different composition than venom that has been allowed to mature (De Lucca et al. 1974; Kochva and Gans 1965). It should be noted also that the variation in the population or individual, age, diet, geographical distribution and climate, can easily influence the venom’s composition quantitatively and qualitatively even within the same species (Sasa 1999). The composition of the venoms also differs between different families of venomous snakes. For example, elapid and hydrophid venoms are rich in neurotoxic proteins and peptides. They have been known to induce effects at the nervous systems (Chang 1979). On the contrary, crotalid and viperid venoms are rich in proteinases. These proteinases, such as the serine proteinases and metalloproteinases, tend to cause Chapter I Literature Review hemolytic effects and are largely responsible for the necrosis following the snake bite. However, in general, the closer the phylogenetic relationships of the snakes, the more similar are the venom properties and compositions (Tu 1996). Snake venom proteins have evolved to target different tissues, organs and physiological systems. Hence, a diversity of symptoms arises after a snake bite which will ultimately lead to failure of multiple tissues, organs and systems and often death (Torres et al. 2003). Some of the major clinical symptoms are intense localized pain, loss of consciousness, drowsiness, headache, vomiting, inflammation, bleeding, shock, hemorrhage, necrosis and muscular paralysis (Campbell 1979; Efrati 1979; Reid 1979; Russell 1979). 1.3.1 Compositions and properties of snake venoms Although snake venoms have always been of great interest for studies, it is only in the recent years serious attempts have been made to fractionate individual venoms. These studies have shown that snake venoms consist of proteins as well as non-protein components. The minor, non-proteinaceous components of snake venoms are metals, lipids, nucleotides, carbohydrates and amines. The proteinaceous components, which consist of ~ 90 to 95 % of the total dry weight of the venom, can be further grouped as enzymatic and non-enzymatic peptides and proteins (Hider et al. 1991). The major enzyme groups found in snake venoms include phospholipases A2 (PLA2), serine proteinases, metalloproteinases, phosphodiesterases, acetylcholinesterase, Chapter I Literature Review L-amino acid oxidases, glycosidase, hyaluronidase and nucleotidases (Torres et al. 2003). Generally, enzymes in the venom have molecular mass ranging from 13,000 Da to 150,000 Da. Most of these are hydrolases and possess a digestive role. There are also over 1000 non-enzymatic venom proteins that have been characterized. They are grouped into three-finger toxins, serine proteinase inhibitors, C-type lectin-related proteins, disintegrins, helveprins/ CRISPs, waprins, sarafatoxins, nerve growth factors, natriuretic peptides and bradykinin-potentiating peptides (Kini 2002; Mochca-Morales et al. 1990; Torres et al. 2003; Yamazaki et al. 2003). The first category of non-enzymatic venom peptides and proteins has a molecular mass around 1,000 Da to 25,000 Da and are rich in disulfide bonds. Therefore, they are robust and are relatively stable once isolated. Another category is the low molecular mass compounds having the molecular mass of less than 1,500 Da. They are less active biologically and are likely to be enzyme cofactors (Bieber 1979). Some of these families are selected and discussed in the subsequent literature review. 1.3.1.1 Phospholipases A2 (PLA2) Phospholipases are esterolytic enzymes that hydrolyze 3-sn-phosphoglycerides. According to the sites of hydrolysis, they are classified as phospholipase A1, A2, B, C and D (Kini 1997). Snake venoms are one of the richest sources of secretory phospholipases. Most of the snake venom phospholipases are PLA2 as they hydrolyze the sn-2 ester bond of 3-sn-phosphoglycerides, releasing lysophospholipids and fatty acids (Kini 1997). Generally, snake PLA2 enzyme is a single chain polypeptide of approximately 118 to 130 amino acid residues with high cysteine content (seven disulfide bonds) (Scott 1997). Chapter I Literature Review Snake venom PLA2 enzymes can be divided into classes I and II. Class I enzymes are abundant in Elapidae and Hydrophidae snake venoms, whereas class II proteins are mainly isolated from Crotalidae and Viperidae venoms. Class I can be further classified into classes IA and IB enzymes, based on the presence or absence of the pancreatic loop. In the region 52 to 65 (bovine pancreatic PLA2 sequence numbering) (Dufton and Hider 1983; Renetseder et al. 1985), class I proteins display an insertion of two to three amino acid residues (the ‘elapid’ loop), which is extended by a further five amino acid residues in the case of mammalian pancreatic PLA2s (the ‘pancreatic’ loop). This loop is absent in class II PLA2. The position of one of the seven disulfide bonds is also different between class I and II PLA2s. Class I PLA2s have the Cys11-Cys77 disulfide bridge which is absent in class II. But class II PLA2s possess an alternative disulfide bridge between Cys51-Cys133 at the C-terminal extension (Dufton and Hider 1983). So far, the protein and cDNA sequences of over 280 snake PLA2 enzymes have been determined (Danse et al. 1997; Tan et al. 2003). These sequences indicate that snake PLA2 contain multiple isoenzymes. Gene sequences determined further demonstrate that these isoenzymes are from different but closely related PLA2 genes likely to have evolved from the physiological PLA2 (Kordis and Gubensek 1996; Nakashima et al. 1993). Generally, the primary sequence similarity among snake venom PLA2 isoenzymes can reach ~40 to 99 %. Furthermore, they also share high similarities in their secondary structures and overall foldings (Figure 1.2) (Scott 1997). Chapter I Literature Review Interestingly, unlike mammalian PLA2 enzymes which are only involved in catalysis, snake venom PLA2 isoenzymes are able to induce wide arrays of pharmacological actions including presynaptic and postsynaptic neurotoxicity (Strong et al. 1976), myotoxicity (Gopalakrishnakone et al. 1984; Ponraj and Gopalakrishnakone 1995), cardiotoxicity (Lee et al. 1977), hemolytic (Condrea et al. 1981), anticoagulant effect (Verheij et al. 1980), antiplatelet (Chen and Chen 1989), hypotension (Huang 1984), internal hemorrhage (Vishwanath et al. 1987), organ or tissue damage and edema (Vishwanath et al. 1987, 1988). The high affinity interaction between PLA2 isoenzymes with their acceptor(s)/receptor(s) is likely due to the complementarity of the contact surfaces in terms of the ionic charges, hydrophobicity and van der Waals force (Kini 2003). Hence, snake PLA2 isoenzymes are able to induce a wide spectrum of pharmacological effects, by the mechanisms either dependent on or independent of their catalytic activity, upon binding to the targets (Kini 2003). Among these pharmacological actions, only neurotoxic, myotoxic and anticoagulant effects have been well-studied, thus providing a great challenge to protein chemists to solve the complex puzzle in the structure-function relationships and mechanisms of action (Kini 2003). 1.3.1.2 Snake venom L-amino acid oxidases L-amino acid oxidase (EC1.4.3.2) (LAAO) is a flavoenzyme that catalyses the L-amino acid substrate to an α-keto acid along with the production of ammonia and hydrogen peroxide. LAAOs are found in many different organisms, such as snakes, bacteria, fungi and plants. Snake venom L-amino acid oxidases (SV-LAAOs) represent the best studied 10 Bibliography II, BPP-III, and BPP-V) from Bothrops neuwiedi venom. J Protein Chem. 17, 285-289. Ferreira, L. A., Henriques, O. B., Lebrun, I., Batista, M. B., Prezoto, B. C., Andreoni, A. S., Zelnik, R. and Habermehl, G. (1992) A new bradykinin-potentiating peptide (peptide P) isolated from the venom of Bothrops jararacussu (jararacucu tapete, urutu dourado). Toxicon 30, 33-40. Ferreira, S. H. (1965) Bradykinin-potentiator factor (BPF) present in the venom of Bothrops jararaca. Br J Pharmacol. 24, 164-169. Ferreira, S. H. and Rocha e Silva, R. (1962) Potentiation of bradykinin by dimercaptopropanol (BAL) and other inhibitors of its destroying enzyme in plasma. Biochem Pharmacol. 11, 1123-1128. Ferreira, S. H. and Rocha e Silva, M. (1965) Potentiation of bradykinin and eledoisin by BPF (bradykinin potentiating factor) from Bothrops jararaca venom. Experientia 21, 347-349. Ferreira, S. H., Greene, L. J., Albaster, V. A., Bakhle, Y. S. and Vane, J. R. (1970) Activity of various fractions of bradykinin potentiator factor against angiotensin I converting enzyme. Nature 225, 379-381. Filippovich, I. (2002) A family of textilinin genes, two of which encode protein with antihaemorrhagic properties. Br J Haematol. 119, 376-384. Fry, B. G. (1999) Structure-function properties of venom components from Australian elapids. Toxicon 37. Fry, B. G. (2005) From genome to "venome": molecular origin and evolution of the snake venom proteome inferred from phylogenetic analysis of toxin sequences and related body proteins. Genome Res. 15, 403-420. Ganthavorn, S. (1971) A case of king cobra bite. Toxicon 9, 293-294. Garl, H. E. and Roger, W. B. (1989) in: Snakes of Eastern North America, pp. 1-4, George Mason University Press, Virginia, USA. Gassama-Diagne, A., Hullin-Matsuda, F., Li, R. Y., Nauze, M., Ragab, A., Pons, V., Delagebeaudeuf, C., Simon, M. F., Fauvel, J. and Chap, H. (2001) Enterophilins, a new family of leucine zipper proteins bearing a B30.2 domain and associated with enterocyte differentiation. J Biol Chem. 276, 18352-18360. Geyer, A., Fitzpatrick, T. B., Pawelek, P. D., Kitzing, K., Vrielink, A., Ghisla, S. and Macheroux, P. (2001) Structure and characterization of the glycan moeity of L- 165 Bibliography amino-acid oxidase from the Malayan pit viper Calloselasma rhodostoma. Eur J Biochem. 268, 4044-4053. Ghadessy, F. J., Chen, D., Kini, R. M., Chung, M. C., Jeyaseelan, K., Khoo, H. E. and Yuen, R. (1996) Stonustoxin is a novel lethal factor from stonefish (Synanceja horrida) venom: cDNA cloning and characterization. J Biol Chem. 271, 2557525581. Gilbert, W. and Glynias, M. (1993) On the ancient nature of introns. Gene 135, 137-144. Giuseppe, S. A. (2001) Atrial natriuretic peptide mimetics and vasopeptidase inibitors. Cardiovasc Res. 51, 416-428. Gopalakrishnakone, P., Dempster, D. W., Hawgood, B. J. and Elder, H. Y. (1984) Cellular and mitochondrial changes induced in the structure of murine skeletal muscle by crotoxin, a neurotoxic phospholiapse A2 complex. Toxicon 22, 85-98. Greene, L. A. and Rukenstein, A. (1989) in: Nerve growth factors, Vol. 12, pp. 139-147, (Rush, R.A.,Ed.), John Wiley and Sons, Chichester, UK. Guo, M., Teng, M., Niu, L., Liu, Q., Huang, Q. and Hao, Q. (2005) Crystal structure of the cysteine-rich secretory protein stecrisp reveals that the cysteine-rich domain has a K+ channel inhibitor-like fold. J Biol Chem. 280, 12405-12412. Harris, J. B. (1991) in: Snake toxins, pp. 91-129, (Harvey, A.L.,Ed.), Pergamon Press Inc, New York. Hayashi, M. A., Murbach, A. F., Ianzer, D., Portaro, F. C., Prezoto, B. C., Fernandes, B. L., Silveira, P. F., Silva, C. A., Pires, R. S., Britto, L. R. G., Dive, V. and Camargo, A. C. (2003) The C-type natriuretic peptide precursor of snake brain contains highly specific inhibitors of the angiotensin-converting enzyme. J Neurochem. 85, 969-977. Hayashi, M. A., Ligny-Lemaire, C., Wollberg, Z., Wery, M., Galat, A., Ogawa, T., Muller, B. H., Lamthanh, H., Doljansky, Y., Bdolah, A., Stocklin, R. and Ducancel, F. (2004) Long-sarafotoxins: characterization of a new family of endothelin-like peptides. Peptides 25, 1243-1251. Henry, J., Ribouchon, M. T., Offer, C. and Pontarotti, P. (1997a) B30.2-like domain proteins: a growing family. Biochem Biophys Res Commun. 235, 162-165. Henry, J., Mather, I. H., McDermott, M. F. and Pontarotti, P. (1998) B30.2-like domain proteins: update and new insights into a rapidly expanding family of proteins. Mol Biol Evol. 15, 1696-1705. 166 Bibliography Henry, J., Ribouchon, M. T., Depetris, D., Mattei, M., Offer, C., Tazi-Ahnini, R. and Pontarotti, P. (1997b) Cloning, structural analysis, and mapping of the B30 and B7 multigenic families to the major histocompatibility complex (MHC) and other chromosomal regions. Immunogenetics 46, 383-395. Hider, R. C., Karlsson, E. and Namiranian, S. (1991) in: Snake toxins, pp. 1-34, (Harvey, A.L.,Ed.), Pergamon Press Inc., New York. Higuchi, S., Murayama, N., Saguchi, K., Ohi, H., Fujita, Y., Camargo, A. C., Ogawa, T., Deshimaru, M. and Ohno, M. (1999) Bradykinin-potentiating peptides and C-type natriuretic peptides from snake venom. Immunopharmacol. 44, 129-135. Hilton, D. J., Richardson, R. T., Alexander, W. S., Viney, E. M., Willson, T. A., Sprigg, N. S., Starr, R., Nicholson, S. E., Metcalf, D. and Nicola, N. A. (1998) Twenty proteins containing a C-terminal SOCS box form five structural classes. Proc Natl Acad Sci USA. 95, 114-119. Ho, P. L., Soares, M. B., Maack, T., Gimenez, I., Puorto, G., Furtado, M. F. and Raw, I. (1997) Cloning of an unusual natriuretic peptide from the South American coral snake Micrurus corallinus. Eur J Biochem. 250, 144-149. Hodgson, W. C. and Wickramaratna, J. C. (2002) In vitro neuromuscular activity of snake venoms. Clin Exp Pharmacol and Physiol. 29, 807-814. Hogue-Angeletti, R. (1970) Nerve growth factor from cobra venom. Proc Natl Acad Sci USA. 65, 668-674. Hogue-Angeletti, R. A. and Bradshaw, R. A. (1979) in: Snake venoms, pp. 276-294, (Lee, C.Y.,Ed.), Springer-Verlag, Berlin, Heidelberg. Hougie, C. (1956) Effect of Russell's viper venom (Stypven) on Stuart clotting defect. Proc Soc Exp Biol Med. 93, 570-573. Howard-Jones, N. (1985) A CIOMS ethical code for animal experimentation. WHO Chron. 39, 51-56. Huang, H. C. (1984) Release of slow reacting substance from the guinea-pig lung by phospholipases A2 of Vipera russelli snake venom. Toxicon 22, 359-372. Inglis, A. S. (1983) Cleavage at aspartic acid. Meth Enzymol. 91, 324-332. Inoue, H., Nojima, H. and Okayama, H. (1990) High efficiency transformation of Escherichia coli with plasmids. Gene 96, 23-26. Ishii, T., Aoki, N., Noda, A., Adachi, T., Nakamura, R. and Matsuda, T. (1995) Carboxyl-terminal cytoplasmic domain of mouse butyrophilin specifically 167 Bibliography associated with a 150-kDa protein of mammary epithelial cells and milk fat globule membrane. Biochim Biophys Acta 1245, 285-292. Iwanaga, S. and Suzuki, T. (1979) in: Snake venoms., pp. 61-144, (Lee, C.Y.,Ed.), Springer-Verlag, Berlin, Heidelberg. Jones, H. M., Kubo, A. and Stephens, R. S. (2000) Design, expression and functional characterization of a synthetic gene encoding the Chlamydia trachomatis major outer membrane protein. Gene 258, 173-181. Joseph, J. S., Chung, M. C. M., Jeyaseelan, K. and Kini, R. M. (1999) Amino acid sequence of Trocarin D, a prothrombin activator from Tropidechis carinatus venom: its structurally similar to coagulation Factor Xa. Blood 94, 621-631. Joseph, R., Pahari, S., Hodgson, W. C. and Kini, R. M. (2004) Hypotensive agents from snake venom. Curr Drug Targets Cardiovasc Haematol Disord. 4, 437-459. Kan, Z., Rouchka, E. C., Gish, W. R. and States, D. J. (2001) Gene structure prediction and alternative splicing analysis using genomically aligned ESTs. Genome Res. 11, 889-900. Kang, I. C., Lee, Y. D. and Kim, D. S. (1999) A novel disintegrin salmosin inhibits tumor angiogenesis. Cancer Res. 59, 3754-3760. Kasahara, M., Gutknecht, J., Brew, K., Spurr, N. and Goodfellow, P. N. (1989) Cloning and mapping of a testis-specific gene with sequence similarity to a sperm-coating glycoprotein gene. Genomics 5, 527-534. Kato, H. and Suzuki, T. (1962) Bradykinin-potentiating peptides from the venom of Agkistrodon halys blomhoffii: Isolation of five bradykinin potentiators and amino acid sequence of two of them, potentiators B and C. Biochim Biophys Acta 58, 972-980. Kato, H., Suzuki, T., Okada, K., Kimura, T. and Sakakibara, S. (1973) Structure of potentiator A, one of the five bradykinin potentiating peptides from the venom of Agkistrodon halys blomhoffii. Experientia 29, 574-575. Katzir, I., Shani, J., Goshen, G., Sela, J., Ninary, E., Dogonovski, A. M., Shabashov, D., Inoue, S., Ikeda, K., Hayashi, K., Gorinstein, S., Deutsch, J. and Lazarovici, P. (2003) Characterization of nerve growth factors (NGFs) from snake venoms by use of a novel, quantitative bioassay utilizing pheochromocytoma (PC12) cells overexpressing human trkA receptors. Toxicon 42, 481-490. Kini, R. M. (1997) in: Venom phospholipase A2 enzymes: Structure, function and mechanism, pp. 1-28, (Kini, R.M.,Ed.), John Wiley & Sons Ltd., Chichester, England. 168 Bibliography Kini, R. M. (2002) Molecular moulds with multiple missions: functional sites in threefinger toxins. Clin Exp Pharmacol Physiol. 29, 815-822. Kini, R. M. (2003) Excitement ahead: structure, function and mechanism of snake venom phospholipase A2 enzymes. Toxicon 42, 827-840. Kini, R. M. and Evans, H. J. (1989) A common cytolytic region in myotoxins, hemolysins, cardiotoxins and antibacterial peptides. Int J Pept Protein Res. 34, 277-286. Kini, R. M. and Evans, H. J. (1995a) A hypothetical structural role for proline residues in the flanking segments of protein-protein interaction sites. Biochem Biophys Res Commun. 212, 1115-1124. Kini, R. M. and Evans, H. J. (1995b) A novel approach to the design of potent bioactive peptides by incorporation of proline brackets: antiplatelet effects of Arg-Gly-Asp peptides. FEBS Lett. 375, 15-17. Kini, R. M. and Evans, H. J. (1996) Prediction of potential protein-protein interaction sites from amino acid sequence: Identification of a fibrin polymerization site. FEBS Lett. 385, 81-86. Klemmer, K. (1968) in: Venomous animals and their venoms, Vol. 1, pp. 309-325, (Deulofeu, V.,Ed.), Academic Press, London and New York. Kloog, Y., Ambar, I., Sokolovsky, M., Kochva, E., Wollberg, Z. and Bdolah, A. (1988) Sarafotoxin, a novel vasoconstrictor peptide: phosphoinositide hydrolysis in rat heart and brain. Science 242, 268-270. Kochva, E. and Gans, C. (1965) The venom gland of Vipera palaestinae with some comments on the glands of some other viperines. Acta Anat. 62, 365-401. Kochva, E., Viljoen, C. C. and Botes, D. P. (1982) A new type of toxin in the venom of snakes of the genus Atractaspis (Atractaspidinae). Toxicon 20, 581-592. Kock, M. A., Hew, B. E., Bammert, H., Fritzinger, D. C. and Vogel, C. W. (2004) Structure and function of recombinant cobra venom factor. J Biol Chem. 279, 30836-30843. Koller, K. J., Lowe, D. G., Bennett, G. L., Minamino, N., Kangawa, K., Matsuo, H. and Goeddel, D. V. (1991) Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 252, 120-123. 169 Bibliography Kordis, D. and Gubensek, F. (1996) Ammodytoxin C gene helps to elucidate the irregular structure of Crotalinae group II phospholipase A2 genes. Eur J Biochem. 240, 8390. Kordis, D. and Gubensek, F. (2000) Adaptive evolution of animal toxin multigene families. Gene 261, 43-52. Kornalik, F. (1991) in: Snake toxins., pp. 323-375, (Harvey, A.L.,Ed.), Pergamon Press, Inc., New York. Kostiza, T. and Meier, J. (1996) Nerve growth factors from snake venoms: chemicals properties, mode of action and biological significance. Toxicon 34, 787-806. Kozak, M. (1981) Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes. Nucleic Acids Res. 9, 5233-5252. Kozak, M. (1984) Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res. 12, 857-872. Kozak, M. (1987a) An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125-8148. Kozak, M. (1987b) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol. 196, 947-950. Kozak, M. (1989) The scanning model for translation: An update. J Cell Biol. 108, 229241. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Laskowski, M. S. (1966) in: Procedures in nucleic acid research, Vol. 1, pp. 154-187, (Davies, D.R.,Ed.), Harper-Row, New York, Evanston, London. Lee, C. Y., Hod, C. L. and Eaker, D. (1977) Cardiotoxin-like action of a basic phospholipase A isolated from Naja nigricollis venom. Toxicon 15, 355-356. Levanon, E. Y. and Sorek, R. (2003) The importance of alternative splicing in the drug discovery process. Targets 2, 109-114. Levi-Montalcini, R. (1987) The nerve growth factor 35 years later. Science 237, 11541162. Lewis, R. J. and Garcia, M. L. (2003) Therapeutics potential of venom peptides. Nat Rev. 2, 790-802. 170 Bibliography Li, S., Wang, J., Zhang, X., Ren, Y., Wang, N., Zhao, K., Chen, X., Zhao, C., Li, X., Shao, J., Yin, J., West, M. B., Xu, N. and Liu, S. (2004a) Proteomic characterization of two snake venoms: Naja naja atra and Agkistrodon halys. Biochem J. 15, 119-127. Li, Z. D., Shi, C. Q., Zhang, Q. H., Xiong, Y. L., Zhou, X. D., Wang, W. Y. and Song, N. (2004b) Mechanisms of purified cobra venom factor in preventing hyperacute rejection following discordant liver xenotransplantation in rats. Zhonghua Yi Xue Za Zhi 84, 2007-2010. Li, Z. Y., Yu, T. F. and Lian, E. C. (1994) Purification and characterization of -amino acid oxidase from king cobra (Ophiophagus hannah) venom and its effects on human platelet aggregation. Toxicon 32, 1349-1358. Linz, W., Wiemer, G., Gohlke, P., Unger, T. and Scholkens, B. A. (1995) Contribution of kinins to the cardiovascular actions of angiotensin-converting enzyme inhibitors. Pharmacol Rev. 47, 25-49. Low, K. S. Y., Gwee, M. C. E., Yuen, R., Gopalakrishnakone, P. and Khoo, H. E. (1993) Stonustoxin: A highly potent endothelium-dependent vasorelaxant in the rat. Toxicon 31, 1471-1478. Marchler-Bauer, A., Anderson, J. B., DeWeese-Scott, C., Fedorova, N. D., Geer, L. Y., He, S., Hurwitz, D. I., Jackson, J. D., Jacobs, A. R., Lanczycki, C. J., Liebert, C. A., Liu, C., Madej, T., Marchler, G. H., Mazumder, R., Nikolskaya, A. N., Panchenko, A. R., Rao, B. S., Shoemaker, B. A., Simonyan, V., Song, J. S., Thiessen, P. A., Vasudevan, S., Wang, Y., Yamashita, R. A., Yin, J. J. and Bryant, S. H. (2003) CDD: a curated Entrez database of conserved domain alignments. Nucleic Acids Res. 31, 383-387. Masci, P. P., Whitaker, A. N., Sparrow, L. G., de Jersey, J., Winzor, D. J., Watters, D. J., Lavin, M. F. and Gaffney, P. J. (2000) Textilinins from Pseudonaja textilis textilis. Characterization of two plasmin inhibitors that reduce bleeding in an animal model. Blood Coagul Fibrinolysis 11, 385-393. Matsuo, H. (2001) Discovery of a natriuretic peptide family and their clinical application. Can J Physiol Pharmacol. 79, 736-740. Mebs, D. (1989) Snake venoms: toolbox of the neurobiologist. Endeavour 13, 157-161. Menez, A. (1998) Functional architectures of animal toxins: a clue to drug design? Toxicon 36, 1557-1572. Meyer, M., Gaudieri, S., Rhodes, D. A. and Trowsdale, J. (2003) Cluster of TRIM genes in the human MHC class I region sharing the B30.2 domain. Tissue Antigens 61, 63-71. 171 Bibliography Milne, T. J., Abbenante, G., Tyndall, J. D., Halliday, J. and Lewis, R. J. (2003) Isolation and characterization of a cone snail protease with homology to CRISP proteins of the pathogenesis-related protein superfamily. J Biol Chem. 278, 31105-31110. Mironov, A. A., Fickett, J. W. and Gelfand, M. S. (1999) Frequent alternative splicing of human genes. Genome Res. 9, 1288-1293. Mochca-Morales, J., Martin, B. M. and Possani, L. D. (1990) Isolation and characterization of helothermine, a novel toxin from Heloderma horridum horridum (Mexican beaded lizard) venom. Toxicon 28, 299-309. Morgan, B. P. and Harris, C. L. (2003) Complement therapeutics: history and current progress. Mol Immunol. 40, 159-170. Morrissette, J., Kratzschmar, J., Haendler, B., el-Hayek, R., Mochca-Morales, J., Martin, B. M., Patel, J. R., Moss, R. L., Schleuning, W. D. and Coronado, R. (1995) Primary structure and properties of Helothermine, a peptide toxin that blocks Ryanodine receptors. Biophys J. 68, 2280-2288. Murayama, N., Hayashi, M. A., Ohi, H., Ferreira, L. A., Hermann, V. V., Saito, H., Fujita, Y., Higuchi, S., Fernandes, B. L., Yamane, T. and de Camargo, A. C. (1997) Cloning and sequence analysis of a Bothrops jararaca cDNA encoding a precursor of seven bradykinin-potentiating peptides and a C-type natriuretic peptide. Proc Natl Acad Sci USA. 94, 1189-1193. Nakashima, K., Ogawa, T., Oda, N., Hattori, M., Sakaki, Y., Kihara, H. and Ohno, M. (1993) Accelerated evolution of Trimeresurus flavoviridis venom gland phospholipase A2 isoenzymes. Proc Natl Acad Sci USA. 90, 5964-5968. Nirthanan, S., Gopalakrishnakone, P., Gwee, M. C. E., Khoo, H. E. and Kini, R. M. (2003) Non-conventional toxins from Elapid venoms. Toxicon 41, 397-407. Nobile, M., Noceti, F., Prestipino, G. and Possani, L. D. (1996) Helothermine, a lizard venom toxin, inhibits calcium current in cerebellar granules. Exp Brain Res. 110, 15-20. Nobile, M., Magnelli, V., Lagostena, L., Mochca-Morales, J., Possani, L. D. and Prestipino, G. (1994) The toxin helothermine affects potassium currents in newborn rat cerebellar granule cells. J Membr Biol. 139, 49-55. Ogg, S. L., Komaragiri, M. V. and Mather, I. H. (1996) Structural organization and mammary-specific expression of the butyrophilin gene. Mamm Genome 7, 900905. 172 Bibliography Okazaki, Y., Furuno, M., Kasukawa, T., Adachi, J., Bono, H., Kondo, S., Nikaido, I., Osato, N., Saito, R., Suzuki, H., Yamanaka, I., Kiyosawa, H., Yagi, K., Tomaru, Y., Hasegawa, Y., Nogami, A., Schonbach, C., Gojobori, T., Baldarelli, R., Hill, D. P., Bult, C., Hume, D. A., Quackenbush, J., Schriml, L. M., Kanapin, A., Matsuda, H., Batalov, S., Beisel, K. W., Blake, J. A., Bradt, D., Brusic, V., Chothia, C., Corbani, L. E., Cousins, S., Dalla, E., Dragani, T. A., Fletcher, C. F., Forrest, A., Frazer, K. S., Gaasterland, T., Gariboldi, M., Gissi, C., Godzik, A., Gough, J., Grimmond, S., Gustincich, S., Hirokawa, N., Jackson, I. J., Jarvis, E. D., Kanai, A., Kawaji, H., Kawasawa, Y., Kedzierski, R. M., King, B. L., Konagaya, A., Kurochkin, I. V., Lee, Y., Lenhard, B., Lyons, P. A., Maglott, D. R., Maltais, L., Marchionni, L., McKenzie, L., Miki, H., Nagashima, T., Numata, K., Okido, T., Pavan, W. J., Pertea, G., Pesole, G., Petrovsky, N., Pillai, R., Pontius, J. U., Qi, D., Ramachandran, S., Ravasi, T., Reed, J. C., Reed, D. J., Reid, J., Ring, B. Z., Ringwald, M., Sandelin, A., Schneider, C., Semple, C. A., Setou, M., Shimada, K., Sultana, R., Takenaka, Y., Taylor, M. S., Teasdale, R. D., Tomita, M., Verardo, R., Wagner, L., Wahlestedt, C., Wang, Y., Watanabe, Y., Wells, C., Wilming, L. G., Wynshaw-Boris, A., Yanagisawa, M., Yang, I., Yang, L., Yuan, Z., Zavolan, M., Zhu, Y., Zimmer, A., Carninci, P., Hayatsu, N., Hirozane-Kishikawa, T., Konno, H., Nakamura, M., Sakazume, N., Sato, K., Shiraki, T., Waki, K., Kawai, J., Aizawa, K., Arakawa, T., Fukuda, S., Hara, A., Hashizume, W., Imotani, K., Ishii, Y., Itoh, M., Kagawa, I., Miyazaki, A., Sakai, K., Sasaki, D., Shibata, K., Shinagawa, A., Yasunishi, A., Yoshino, M., Waterston, R., Lander, E. S., Rogers, J., Birney, E. and Hayashizaki, Y. (2002) Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs. Nature 420, 563-573. Olivera, B. M., Imperial, J. S. and Bulaj, G. (2002) in: Perspectives in molecular toxinology, pp. 143-156, (Menez, A.,Ed.), John Wiley & Sons, Ltd, England. Ondetti, M. A., Williams, N. J., Sabo, E. F., Plusced, J., Weaver, E. R. and Kocy, O. (1971) Angiotensin-converting enzyme inhibitors from the venom of Bothrops jararaca: Isolation, elucidation of structure and synthesis. Biochem. 10, 40334039. Orimo, A., Yamagishi, T., Tominaga, N., Yamauchi, Y., Hishinuma, T., Okada, K., Suzuki, M., Sato, M., Nogi, Y., Suzuki, H., Inoue, S., Yoshimura, K., Shimizu, Y. and Muramatsu, M. (2000) Molecular cloning of testis-abundant finger protein/Ring finger protein 23 (RNF23), a novel RING-B box-coiled coil-B30.2 protein on the class I region of the human MHC. Biochem Biophys Res Commun. 276, 45-51. Oron, U. and Bdolah, A. (1973) Regulation of protein synthesis in the venom gland of viperid snakes. J Cell Biol. 56, 177-190. Oron, U. and Bdolah, A. (1978) Intracellular transport of proteins in active and resting secretory cells of the venom gland of Vipera palaestinae. J Cell Biol. 78, 488-502. 173 Bibliography Osipov, A. V., Levashov, M. Y., Tsetlin, V. I. and Utkin, Y. N. (2005) Cobra venom contains a pool of cysteine-rich secretory proteins. Biochem Biophys Res Commun. 328, 177-182. Paetzel, M., Dalbey, R. E. and Strynadka, N. C. J. (1998) Crystal structure of a bacterial signal peptidase in complex with a beta-lactam inhibitor. Nature 396, 186-190. Pandey, K. N. (2005) Biology of natriuretic peptides and their receptors. Peptides 26, 901-932. Paolillo, L., Simonetti, M., Brakch, N., D'Auria, G., Saviano, M., Dettin, M., Rholam, M., Scatturin, A., Di Bello, C. and Cohen, P. (1992) Evidence for the presence of a secondary structure at the dibasic processing site of prohormone: the pro-ocytocin model. EMBO J. 11, 2399-2405. Pawelek, P. D., Cheah, J., Coulombe, R., Macheroux, P., Ghisla, S. and Vrielink, A. (2000) The structure of L-amino acid oxidase reveals the substrate trajectory into an enantiomerically conserved active site. EMBO J. 19, 4204-4215. Paxinos, G. and Franklin, K. B. J. (2004) in: The mouse brain in stereotaxic coordinates., pp. 31-32, Elsevier Science, New York. Perez-Polo, J. R., Bomar, H., Beck, C. and Hall, K. (1978) Nerve growth factor from Crotalus adamanteus snake venom. J Biol Chem. 253, 6140-6148. Phelps, T. (1981) in: Poisonous Snakes., Blandford Press, Dorset. Politi, V., De Luca, G., Di Stazio, G., Schinina, E. and Bossa, F. (1985) A new peptide from Crotalus atrox snake venom. Peptides 6, 343-346. Ponraj, D. and Gopalakrishnakone, P. (1995) Morphological changes induced by a generalized myotoxin (myoglobinuria-inducing toxin) from the venom of Pseudechis australis (king brown snake) in skeletal muscle and kidney of mice. Toxicon 33. Ponting, C. P. and Bork, P. (1997) SPRY domains in Ryanodine receptors (Ca2+- release channels). TIPS. 22, 193-194. Proudfoot, N. J. and Brownlee, G. G. (1976) 3' Non-coding region sequences in eukaryotic messenger RNA. Nature 263, 211-214. Pung, Y. F., Wong, P. T. H., Kumar, P. P., Hodgson, W. C. and Kini, R. M. (2005) Ohanin, a novel protein from king cobra venom induces hypolocomotion and hyperalgesia in mice. J Biol Chem. 280, 13137-13147. 174 Bibliography Rage, J. C. (1984) in: Serpentes: Handbuch der Plaoherpetologie, pp. 80, Gustav Fisher, Stuttgart. Reid, H. A. (1968) in: Venomous animals and their venoms, venomous vertebrates, Vol. 1, pp. 611, (Bucherl, W.,Ed.), Academic Press, New York. Reid, H. A. (1979) in: Snake venoms., pp. 922-952, (Lee, C.Y.,Ed.), Springer-Verlag, Berlin, Heidelberg. Renetseder, R., Brunie, S., Dijkstra, B. W., Drenth, J. and Sigler, P. B. (1985) A comparison of the crystal structures of phospholipase A2 from bovine pancreas and Crotalus atrox venom. J Biol Chem. 260, 11627-11634. Rhodes, D. A., Stammers, M., Malcherek, G., Beck, S. and Trowsdale, J. (2001) The cluster of BTN genes in the extended major histocompatibility complex. Genomics 71, 351-362. Rholam, M., Nicolas, P. and Cohen, P. (1986) Precursors for peptide hormones share common secondary structures forming features at the proteolytic processing sites. FEBS Lett. 207, 1-6. Russell, F. E. (1979) in: Snake venoms., pp. 978-995, (Lee, C.Y.,Ed.), Springer-Verlag, Berlin, Heidelberg. Sakurai, T., Yanagisawa, M. and Masaki, T. (1992) Molecular characterization of endothelin receptors. Trends Pharmacol Sci. 13, 103-108. Sakurai, Y., Takatsuka, H., Yoshioka, A., Matsui, T., Suzuki, M., Titani, K. and Fujimura, Y. (2001) Inhibition of human platelet aggregation by L-amino acid oxidase purified from Naja naja kaouthia venom. Toxicon 39, 1827-1833. Samsa, G. P., Matchar, D. B., Williams, G. R. and Levy, D. E. (2002) Cost-effectiveness of ancrod treatment of acute ischaemic stroke: results from the Stroke Treatment with Ancrod Trial (STAT). J Eval Clin Pract. 8, 61-70. Sanger, F., Nicklen, S. and Coulson, A. R. (1977) DNA Sequencing with ChainTerminating Inhibitors. Proc Natl Acad Sci USA. 74, 5463-5467. Sasa, M. (1999) Diet and snake venom evolution: Can local selection alone explain intraspecific venom variation? Toxicon 37, 249-252. Sawyer, S. L., Wu, L., Emerman, M. and Malik, H. S. (2005) Positive selection of primate TRIM5alpha identifies a critical species-specific retroviral restriction domain. Proc Natl Acad Sci USA. 102, 2832-2837. 175 Bibliography Scarborough, R. M., Rose, J. W., Hsu, M. A., Phillips, D. R., Fried, V. A., Campbell, A. M., Nannizzi, L. and Charo, I. F. (1991) Barbourin. A GPIIb-IIIa-specific integrin antagonist from the venom of Sistrurus m. barbouri. J Biol Chem. 266, 9359-9362. Schweitz, H., Vigne, P., Moinier, D., Frelin, C. and Lazdunski, M. (1992) A new member of the natriuretic peptide family is present in the venom of the green mamba (Dendroaspis angusticeps). J Biol Chem. 267, 13928-13932. Scott, D. L. (1997) in: Venom phospholipase A2 enzymes: Structure, function and mechanism, pp. 97-128, (Kini, R.M.,Ed.), John Wiley & Sons Ltd., Chichester, England. Selby, M. J., Edwards, R. H. and Rutter, W. J. (1987) Cobra nerve growth factor: structure and evolutionary comparison. J Neurosci Res. 18, 293-298. Servent, D. and Menez, A. (2001) in: Handbook of neurotoxicology, pp. 385-425, (Massaro, E.J.,Ed.), Humana Press, Totowa, New Jersey. Seto, M. H., Liu, H. L. C., Zajchowski, D. A. and Whitlow, M. (1999) Protein fold analysis of the B30.2-like domain. Proteins 35, 235-249. Sharp, P. M. and Li, W. H. (1987) The codon Adaptation Index--a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 15, 1281-1295. Sheu, J. R., Yen, M. H. and Kan, Y. C. (1997) Inhibition of angiogenesis in vitro and in vivo: Comparison of the relative activities of triflavin, an Arg-Gly-Asp-containing peptide and anti-αvβ3 integrin monoclonal antibody. Biochim Biophys Acta 1336, 445-454. Smith, L. A. (1990) Cloning, characterization and expression of animal toxin genes for vaccine development. J Toxicol Toxin Rev. 9, 243-283. Smith, P. J., Brandt, W. F., Stickells, B. J. and von Holt, C. (1992) Bitis arietans nerve growth factor is a disulphide-linked homodimer. Comp Biochem Physiol B. 103, 975-980. Souza, D. H., Eugenio, L. M., Fletcher, J. E., Jiang, M. S., Garratt, R. C., Oliva, G. and Selistre-de-Araujo, H. S. (1999) Isolation and structural characterization of a cytotoxic L-amino acid oxidase from Agkistrodon contortrix laticinctus snake venom: preliminary crystallographic data. Arch Biochem Biophys. 368, 285-290. Stafford, P. (2000) in: Snakes: Structure and lifestyle, pp. 5-26, The Natural History Museum, London. 176 Bibliography Stiles, B. G., Sexton, F. W. and Weinstein, S. A. (1991) Antibacterial effects of different snake venoms: purification and characterization of antibacterial proteins from Pseudechis australis (Australian king brown or mulga snake) venom. Toxicon 29, 1129-1141. Stoltzfus, A., Spencer, D. F., Zuker, M., Logsdon, J. M. J. and Doolittle, W. F. (1994) Testing the exon theory of genes: the evidence from protein structure. Science 265, 202-207. Strong, P. N., Goerke, J., Oberg, S. G. and Kelly, R. B. (1976) beta-Bungarotoxin, a presynaptic toxin with enzymatic activity. Proc Natl Acad Sci USA. 73, 178-182. Suhr, S. M. and Kim, D. S. (1996) Identification of the snake venom substance that induces apoptosis. Biochem Biophys Res Commun. 224, 134-139. Suhr, S. M. and Kim, D. S. (1999) Comparison of the apoptotic pathways induced by Lamino acid oxidase and hydrogen peroxide. J Biochem. 125, 305-309. Sung, J. M. L., Low, K. S. Y. and Khoo, H. E. (2002) Characterization of the mechanism underlying stonustoxin-mediated relaxant in the rat aorta in vitro. Biochem Pharmacol. 63, 1113-1118. Swenson, S., Costa, F., Minea, R., Sherwin, R. P., Ernst, W., Fujii, G., Yang, D. and Markland, F. S. (2004) Intravenuos liposomal delivery of the snake venom disintegrin contortrostatin limits breast cancer progression. Mol Cancer Ther. 3, 499-511. Takasaki, C., Itoh, Y., Onda, H. and Fujino, M. (1992) Cloning and sequence analysis of a snake, Atractaspis engaddensis gene encoding sarafotoxin S6c. Biochem Biophys Res Commun. 189, 1527-1533. Takasaki, C., Tamiya, N., Bdolah, A., Wollberg, Z. and Kochva, E. (1988) Sarafotoxins S6: several isotoxins from Atractaspis engaddensis (Burrowing Asp) venom that affect the heart. Toxicon 26, 543-548. Takatsuka, H., Sakurai, Y., Yoshioka, A., Kokubo, T., Usami, Y., Suzuki, M., Matsui, T., Titani, K., Yagi, H., Matsumoto, M. and Fujimura, Y. (2001) Molecular characterization of L-amino acid oxidase from Agkistrodon halys blomhoffii with special reference to platelet aggregation. Biochim Biophys Acta 1544, 267-277. Tan, N. H. and Ponnudurai, G. (1992) Comparative study of the enzymatic, hemorrhagic, procoagulant and anticoagulant activities of some animal venoms. Comp Biochem Physiol. 103, 299-302. 177 Bibliography Tan, N. H. and Swaminathan, S. (1992) Purification and properties of the -amino acid oxidase from monocellate cobra (Naja naja kaouthia) venom. Int J Biochem. 24, 967-973. Tan, P. T. J., Kham, M. A. and Brusic, V. (2003) Bioinformatics for venom and toxin sciences. Brief Bioinform. 4, 53-62. Torii, S., Naito, M. and Tsuruo, T. (1997) Apoxin I, a novel apoptosis-inducing factor with -amino acid oxidase activity purified from Western diamondback rattlesnake venom. J Biol Chem. 272, 9539-9542. Torii, S., Yamane, K., Mashima, T., Haga, N., Yamamoto, K., Fox, J. W., Naito, M. and Tsuruo, T. (2000) Molecular cloning and functional analysis of apoxin I, a snake venom-derived apoptosis-inducing factor with L-amino acid oxidase activity. Biochemistry 39, 3197-3205. Torres, A. M., Wong, H. Y., Desai, M., Moochhala, S., Kuchel, P. W. and Kini, R. M. (2003) Identification of a novel family of proteins in snake venoms. Purification and structural characterization of nawaprin from Naja nigricollis snake venom. J Biol Chem. 278, 40097-40104. Tsetlin, V. (1999) Snake venom alpha-neurotoxins and other 'three-finger' proteins. Eur J Biochem. 264, 281-286. Tu, A. T. (1996) Overview of snake venom chemistry. Adv Exp Med Biol. 391, 37-62. Van Deenen, L. L. M. and De Haas, G. H. (1966) Phosphoglycerides and phospholipases. Ann Rev Biochem. 35, 157-194. Verheij, H. M., Boffa, M. C., Rothen, C., Bryckaert, M. C., Verger, R. and de Haas, G. H. (1980) Correlation of enzymatic activity and anticoagulant properties of phospholipase A2. Eur J Biochem. 112, 25-32. Vernet, C., Boretto, J., Mattei, M., Takashi, M., Jack, L. J. W., Mather, I. H., Rouquier, S. and Pontarotti, P. (1993) Evolutionary study of multigenic families mapping close to the human MHC class I region. J Mol Evol. 37, 600-612. Vishwanath, B. S., Kini, R. M. and Gowda, T. V. (1987) Characterization of three edema-inducing phospholipase A2 enzymes from habu (Trimeresurus flavoviridis) venom and their interaction with the alkaloid aristolochic acid. Toxicon 25, 501515. Vishwanath, B. S., Kini, R. M. and Gowda, T. V. (1988) Purification and partial biochemical characterization of an edema inducing phospholipase A2 from Vipera russelli (Russell's viper) snake venom. Toxicon 26, 713-720. 178 Bibliography Von Heijne, G. (1986) A new method for predicting signal sequence cleavage site. Nucleic Acids Res. 14, 4683-4690. Von Heijne, G. (1998) Life and death of a signal peptide. Nature 396, 111-112. Wang, J., Shen, B., Guo, M., Lou, X., Duan, Y., Cheng, X. P., Teng, M., Niu, L., Liu, Q., Huang, Q. and Hao, Q. (2005) Blocking effect and crystal structure of Natrin toxin, a Cysteine-Rich Secretory Protein from Naja atra venom that targets the BKCa channel. Biochemistry 44, 10145 - 10152. Wetzel, W. W. and Christy, N. P. (1989) A king cobra bite in New York City. Toxicon 27, 393-395. Woolfe, D. and MacDonald, A. D. (1944) The evaluation of the analgesic action of Pethidine Hydrochloride (Demerol). J Pharmacol Exp Ther. 80, 300-307. Yamazaki, Y. and Morita, T. (2004) Structure and function of snake venom cysteine-rich secretory proteins. Toxicon 44, 227-231. Yamazaki, Y., Brown, R. L. and Morita, T. (2002a) Purification and cloning of toxins from elapid venoms that target cyclic nucleotide-gated ion channels. Biochem. 41, 11331-11337. Yamazaki, Y., Hyodo, F. and Morita, T. (2003) Wide distribution of cysteine-rich secretory proteins in snake venoms: isolation and cloning of novel snake venom cysteine-rich secretory proteins. Arch Biochem Biophys. 412, 133-141. Yamazaki, Y., Koike, H., Sugiyama, Y., Motoyoshi, K., Wada, T., Hishinuma, S., Mita, M. and Morita, T. (2002b) Cloning and characterization of novel snake venom proteins that block smooth muscle contraction. Eur J Biochem. 269, 2708-2715. Yao, S., Masters, S. L., Zhang, J. G., Palmer, K. R., Babon, J. J., Nicola, N. A., Nicholson, S. E. and Norton, R. S. (2005) Backbone 1H, 13C and 15N assignments of the 25 kDa SPRY domain containing SOCS box protein (SSB-2). J Biomol NMR 31, 69-70. Yeh, C. H., Peng, H. C. and Huang, T. F. (1998) Accutin, a new disintegrin, inhibits angiogenesis in vitro and in vivo by acting as integrin αvβ3 antagonist and inducing apoptosis. Blood 92, 3268-3276. Zhao, E. (1990) in: Snakes of Medical Importance (Asia-Pacific Region). pp. 243-268, (Chou, L.M.,Ed.), Vetak Service, Singapore. Zhou, Q., Nakada, M. T., Arnold, C., Shieh, K. Y. and Markland, F. S. (2000a) Contortrostatin, a dimeric disintegrin from Agkistrodon contortrix contortrix, inhibits angiogenesis. Angiogenesis 3, 259-269. 179 Bibliography Zhou, Q., Hu, P., Ritter, M. R., Swenson, S. D., Argounova, S., Epstein, A. L. and Markland, F. S. (2000b) Molecular cloning and functional expression of Contortrostatin, a homodimeric disintegrin from southern copperhead snake venom. Arch Biochem Biophys. 375, 278-288. 180 [...]... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgacggataaagagtgcctcaatttctgccatcag E P L C S C K D M T D K E C L N F C H Q gacgtcatctggaaaaatgcggacaccagcgccaatccagagttcctaggctagctagga D V I W K N A D T S A N P E F L G * aagacatccagtctctgaagggacccccaccccccatccatggacattactggacatccc ctgcaatcatccagggccccaccggcgggacccccaacggtcaacaccccttttcaatat gtcccttcaaataaactcactagactgg... ctggcggccggcgggctgctgctgctgctggccctggccgccctcgaggggaagccggcg L A A G G L L L L L A L A A L E G K P A ccctcggcgctgtcgcagctgctggagaagcgctccgaggaccaggcggcagcagggcgc P S A L S Q L L E K R S E D Q A A A G R atcatcgacggaggagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg I I D G G D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgtcggataaagagtgcctcaatttctgccatcag E P L C S C K D M S D K E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaaagacatgacggataaagagtgcctctatttctgccatcag E P L C T C K D M T D K E C L Y F C H Q ggcatcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg G I I W R D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgtcggataaagagtgcctcaatttctgccatcag E P L C S C K D M S D K E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaacgacatgacggatgaagagtgcctcaatttctgccatcag E P L C T C N D M T D E E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgacggataaagagtgcctctatttctgccatcag E P L C S C K D M T D K E C L Y F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaacgacatgacggatgaagagtgcctcaatttctgccatcag E P L C T C N D M T D E E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaacgacatgacggatgaagagtgcctcaatttctgccatcag E P L C T C N D M T D E E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgacggataaagagtgcctctatttctgccatcag E P L C S C K D M T D K E C L Y F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgctcctgtaaagacatgtcggataaagagtgcctcaatttctgccatcag E P L C S C K D M S D K E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaacgacatgacggatgaagagtgcctcaatttctgccatcag E P L C T C N D M T D E E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg D V I W R D T K Q A A R D P S P Q R N V gagccactttgcacctgtaacgacatgacggatgaagagtgcctcaatttctgccatcag E P L C T C N D M T D E E C L N F C H Q gacgtcatctggagagacacgaagcaggccgcgagagacccctcgccgcagcgcaacgtg... that SV-LAAOs elicit wide arrays of pharmacological actions For example, SV-LAAOs from Crotalus adamanteus and Crotalus atrox can associate specifically with mammalian endothelial cells (Suhr and Kim 1996) and can either induce (Ahn et al 1997; Ali et al 2000; Li et al 1994) or inhibit platelet aggregation (Sakurai et al 2001; Suhr and Kim 1996; Takatsuka et al 2001; Tan and Swaminathan 1992) It was... 1.3.1.9 Waprins Waprins is a new family of snake venom proteins with a molecular mass ranging from 5 to 6 kDa It was originally identified from the venom of Naja nigricolis (Torres et al 2003) Because of its sequence similarity to WAPs (Whey Acidic Proteins), this new family of snake venom proteins was named Waprins (WAP related proteins) The novel protein isolated was thus named nawaprin (Naja waprin)... (Viperidae, Asia), pseudechetoxin from Pseudechis australis (Elapidae, Australia), ophanin from Ophiophagus hannah (Elapidae, Asia) and tigrin from Rhabdophis tigrinus tigrinus (Colubridae, Asia) Helothermine from the lizard venom was shown to modulate the activity of a variety of ion channels, including voltage-gated calcium channels, potassium channels and ryanodine receptors (Mochca-Morales et al 1990; . New Zealand, New Zealand, Madagascar, Ireland, Greenland, Azores and Canaries Examples Cobras, kraits, mambas, coral snakes Sea snakes Vipers Rattlesnakes Tree snakes, mangroves snakes. Australia, Pacific to the western seaboards of central and south America Europe, Africa, Asia, America America, parts of southeast Asia All parts of the world except for Australia, Antarctica,. SV-LAAOs elicit wide arrays of pharmacological actions. For example, SV-LAAOs from Crotalus adamanteus and Crotalus atrox can associate specifically with mammalian endothelial cells (Suhr and